1. an important source of fresh water is groundwater. answer the following questions about human use of groundwater. (a) using a cross section of the ground, draw the water table, an unconfined aquifer, and a confined aquafer. (b) explain the factors that create an artesian well. (c) describe the concerns that scientists have regarding the pumping of water from confused aquifers. (d) explain how cones of depression near the coasts of continents can lead to saltwater intrusion of water wells.

Answers

Answer 1

A) Using a Cross Section of Ground, we have:

Water Table: A water table is the upper surface of the underground area where the water is located. It is the boundary between the water-saturated soil and the unsaturated soil.Unconfined Aquifer: An unconfined aquifer is an aquifer that is not surrounded by a confining layer of impermeable material. It is an open system where water is able to move freely through the aquifer.Confined Aquifer: A confined aquifer is surrounded by a confining layer of impermeable material. This type of aquifer is typically found at deeper depths than unconfined aquifers.

B) Factors that create an artesian well include a confined aquifer, a recharge area at a higher elevation, and a permeable layer of material or rock formation. The confined aquifer must be filled with water that is pressurized by the weight of the water above it. The recharge area must be located at a higher elevation than the confined aquifer. Finally, a permeable layer of material or rock formation must be present to allow water to move freely through the aquifer.

C) Scientists have a number of concerns regarding the pumping of water from unconfined aquifers. These include depletion of the water table, disruption of the natural hydrologic cycle, and interference with natural ecosystems. Additionally, pumping of water from unconfined aquifers can cause the water table to drop, resulting in a decrease in the amount of water available for human use and the potential for increased water contamination.

D) Cones of depression near the coasts of continents can lead to saltwater intrusion of water wells. This happens when the groundwater is pumped from the aquifer faster than it can be replenished, creating a cone-shaped depression in the water table around the well. The resulting lower pressure in the aquifer causes the seawater to intrude into the well, resulting in saltwater contamination of the water supply.

Learn more about human use of groundwater:

https://brainly.com/question/1099860

#SPJ4


Related Questions

How is thermal energy transferred through the atmosphere and hydrosphere? What effects does this transfer have on climate?

Answers

Thermal energy transferred through the atmosphere and hydrosphere by convection and conduction modes of heat transfer.

Solar radiation is the primary source of thermal energy received by the planet since there is no need for a medium in the radiation mode of heat transmission as there are no material media in space due to its vacuum state. Thermal energy from the earth's core also reaches the atmosphere and hydrosphere through vents (small openings on the planet's surface), fissures in the crust, and volcanic eruptions. Molecules move during convection, which causes warmer (higher energy) molecules to flow into colder locations and transfers the thermal energy to other molecules by displacement, conduction, and radiation. The earth, life, and weather are ultimately powered by thermal exchanges. The interaction of thermal energy that is received, held, and distributed makes up the term "climate." Thus, the transmission of heat energy creates the climate. The heat reflected from the earth's surface is trapped by greenhouse gases in the atmosphere, which has kept the planet's temperature constant. Heat transferred to the hydrosphere causes water to vaporise and establishes a water cycle, which together with other factors leads to the development of climate.

To learn more about heat transfer visit,

https://brainly.com/question/13433948

#SPJ4

If it is 12:00 at the Prime Meridian what time would it be at the following locations?
a) Kingston, Jamaica at 77 degrees West
b) Havana, Cuba at 82 degrees West
c) Melbourne, Australia at 145 degrees East
d) Manila, Philippines at 121 degrees East

Answers

Explanation:

a) Kingston, Jamaica at 77 degrees West (12:00 noon?

b) Havana, Cuba at 82 degrees West (12:00 noon)

c) Melbourne, Australia at 145 degrees East (3:00am)

d) Manila, Philippines at 121 degrees East (1:00 am)

Answer: I think it B.)

How many earth masses of iron are spread out by a typical supernova like that of cassiopeia a?

Answers

The iron in Cassiopeia A has the mass of about 70,000 times that of the Earth

The supernova remnant Cassiopeia A (or Cas A) is the result of the destruction of a massive star. Strongest radio emitter outside the solar system, Cassiopeia A can be found in the constellation Cassiopeia, almost 11,000 light-years from Earth.

NASA’s Chandra X-Ray Observatory found that the exploding star released 1 million Earth-masses of oxygen, 70,000 Earth-masses of iron, 70,000 Earth-masses of silicon, and 10,000 Earth-masses of sulphur.

Nitrogen, carbon, hydrogen, and phosphorus have all been discovered in previous research. All the elements necessary to form DNA, including oxygen and the elements Chandra has identified, are being blasted into space in Cassiopeia A.

To learn more about Cassiopeia A, click here:

https://brainly.com/question/29901972

#SPJ4

what is the most important consideration when evaluating lightning rods as a means to protect a building from lightning strikes in violent storms?

Answers

Lightning rods must provide safe, effective grounding and be highly corrosion-resistant to protect a building from lightning strikes.

Evaluating Lightning Rods for Protection from Violent Storms

The most important consideration when evaluating lightning rods as a means to protect a building from lightning strikes in violent storms is their ability to provide safe and effective grounding. The grounding system must be designed to safely direct lightning away from the building, and must be properly installed and maintained. Additionally, the lightning rod should be made of a material that is highly resistant to corrosion, as this will ensure its long-term effectiveness.

Learn more about lightning rods: https://brainly.com/question/11912977

#SPJ4

the hottest layer of the earth that has 2 layers composed of liquid and solid iron and nickel.

Answers

Answer: the outer core.

Explanation: the explanation or definition of the outer core is in your question!

An employee wishes to return a set of comic books as well as merchandise that she has purchased. You should inform the employee that she may return the:

merchandise for store credit, but comic books are not returnable.
merchandise for cash, but comic books are not returnable.
comic books for store credit, but merchandise is not returnable.
comic books for cash, but merchandise is not returnable.
merchandise and comic books for store credit.

Answers

We should inform the employee that she may return the merchandise and comic books for store credit. The correct option is e.

What is a comic book?

A comic book, also called comic-book, comic magazine or in the United Kingdom and Ireland, simply comic, is a publication that consists of comic art in the form of sequential juxtaposed panels that represent individual scenes. Panels are often accompanied by descriptive prose and written narrative, usually, dialogue contained in word balloons emblematic of the comics art form. "Comic Cuts" was a British comic published from 1890 to 1953.

The first modern comic book, Famous Funnies, was released in the US in 1934.

Learn more about comic, here:

https://brainly.com/question/1418309

#SPJ1

How is solar radiation distributed around the Earth through atmospheric circulation?

Answers

The energy that reaches the Earth's equator is redistributed through air currents and ocean currents.

Atmospheric movement is the big-scale movement of air and collectively with ocean stream is the method by means of which thermal power is redistributed at the floor of the Earth. The Earth's atmospheric movement varies from year to year, but the huge-scale shape of its movement stays fairly steady.

The smaller scale climate systems – mid-latitude depressions, or tropical convective cells – arise chaotically, and long-range weather predictions of those cannot be made past ten days in practice, or a month in concept (see chaos idea and the butterfly effect).

The Earth's weather is an effect of its illumination by means of the solar and the legal guidelines of thermodynamics. The atmospheric circulation may be viewed as a heat engine driven by way of the sun's electricity and whose power sink, in the end, is the blackness of the area.

To learn more about Atmospheric circulation visit here:

brainly.com/question/788466

#SPJ4

how the injection of of wastewater from oil and gas production into deep wells can cause earthquakes?

Answers

Fluid injected of wastewater at depth is occasionally linked hydraulically to faults. This reduces the effect that friction has on faults because the pressure of the fluid within the fault increases. Therefore, they are more likely to experience earthquakes because of this.

Energy companies often dispose of wastewater by injecting it deep below to prevent contaminating surface water. More earthquakes have occurred in Oklahoma and other states as a result of this process.

Earthquake may be exacerbated when water is injected deep underground, leading to pressure that deforms the surrounding rock and pushes faults toward slipping. Poroelasticity is the term used to describe this phenomenon. Water can induce earthquakes via poroelasticity at great distances from the injection well since it does not need to be injected directly into the fault.

To learn more about earthquake, click here:

https://brainly.com/question/29500066

#SPJ4

the mineral group that makes up the largest percentage of rock-forming minerals and comprises over 90% of the earth’s crust material is

Answers

Silicates are a group of minerals that are characterized by their chemical composition, which is based on the silica tetrahedron, a structure made up of silicon and oxygen atoms.

They are the most abundant minerals on Earth's crust, making up over 90% of the Earth's crust material.

They can be found in various types of rocks, such as igneous, metamorphic, and sedimentary rocks, and are formed by the solidification of magma or lava, by alteration of pre-existing rocks, or by precipitation from solution.

The most common silicate minerals are feldspar, quartz, mica, and clay minerals.

These minerals are very important in the formation and alteration of rocks, as well as in the weathering and erosion process. They also play a key role in many natural phenomena such as earthquakes, volcanic eruptions, and the formation of soils.

To learn more about earth’s crust material at

https://brainly.com/question/988291?referrer=searchResults

#SPJ4

whats the difference between purified and spring water

Answers

spring water is naturally filtered underground, it's collected from springs or boreholes. purified water is any type of water that has undergone a controlled filtration process to remove impurities.

what area would most likely what area would most likely experience the greatest amount of natural erosion?

Answers

The area that would most likely experience the greatest amount of natural erosion is the desert area.

There is a great likelihood that significant volumes of natural erosion will occur in the desert. Erosion can occur whenever ice, water, or wind moves across a surface; however, because gravity is a component, it is more likely to occur on slopes that are sloping downward. Moving water has degraded the majority of the land in deserts. There is a greater chance of flash flooding and mudflows because there is insufficient vegetation to delay or stop the runoff. The most prevalent locations for wind erosion are deserts, coastal sand dunes, and beaches. If certain land conditions are present, wind erosion can also occur in agricultural settings.

To learn more about Desert area, click here:

https://brainly.com/question/5446227

#SPJ4

All of the following are evidence supporting the theory of plate tectonics except for: ____________ a. measurements of plate motions b. ocean floor drilling c. hot spots d. changes in the Moon's orbit due to shifting plates

Answers

All of the following are evidence supporting the theory of plate tectonics except for changes in the Moon's orbit due to shifting plates.

What is Moon's orbit due to shifting plates?

Because of the Sun's intense gravitational pull on the Moon, which has resulted in the Moon's orbit around Earth lengthening, the researchers hypothesized that the Earth's plates may be moving. Convection in the mantle, which flows at a pace of only a few millimeters per year for the solid mantle, is what propels tectonic plate movements on Earth. The Moon's mantle lacks convection and vigorous tectonic plate movements because it is too chilly to move readily.

Learn more about moon's orbit:https://brainly.com/question/11792856

#SPJ4

5. What did MLK believe and teach about love?

Answers

This kind of love, in King's words, is "God's love functioning in the human heart." It implies that you value all people equally, regardless of how they appear, and that you love as God loves.

What about marriage did Luther King stand in?

King stated in front of the NCC that the "concept of love" is at the heart of nonviolence. When we reach agape love, he added, "we love others because God loves them, not because we enjoy the others, not because their behaviors and ways allure to us.

What was MLK's position on loving your enemies?

There is a force there that finally changes people. Jesus urges us to love our enemies because of this. Although if really hate you opponents, there is no possibility for you to change and alter them. But then if you hate your adversaries, you'll learn that the ability to forgive lies at the very heart of love.

To know more about Love Visit :

https://brainly.com/question/3761662

#SPJ1

Why do the northern and southern hemispheres have opposite seasons? That is, why is it that when we are experiencing summer, Australians are experiencing winter?

Answers

Seasons are opposite in the northern and southern hemispheres. The northern and southern hemispheres switch places as the Earth revolves around the Sun.

The seasons are caused by Earth's tilted axis. Different regions of the Earth are exposed to the Sun's strongest rays at various times of the year. Therefore, the Northern Hemisphere experiences summer when the North Pole tilts toward the Sun. Additionally, winter in the Northern Hemisphere occurs when the South Pole tilts toward the Sun.

The northern and southern hemispheres always experience the opposing seasons, regardless of the time of year. This is due to the fact that, depending on whether it is summer or winter, one region of the planet is alternately more directly exposed to the Sun's rays than the other.

Read more about northern and southern at

https://brainly.com/question/13661560

#SPJ4

what would happen to iain if he wasn't in a pressurized airplane as he flew to the bottom of the stratosphere?

Answers

if Iain was not in a pressurized airplane while flying to the bottom of the stratosphere, he would be exposed to the harsh and hostile conditions of the upper atmosphere, including very low air pressure, extreme cold, and high levels of harmful ultraviolet radiation.

This would likely result in severe injury or death. The lack of atmospheric pressure at such high altitudes can cause the body's fluids to boil and gas to expand rapidly, leading to decompression sickness (also known as "the bends"). Additionally, the lack of protection from the sun's radiation could cause serious damage to his skin and eyes.

Here you can learn more about stratosphere

brainly.com/question/18328977

#SPJ4

What drives natural selection?

Answers

Answer:

Individuals in a population are naturally variable, meaning that they are all different in some ways. This variation means that some individuals have traits better suited to the environment than others. Individuals with adaptive traits, traits that give them some advantage, are more likely to survive and reproduce.

which type of adaptation allows an animal to deceive its predator?

Answers

Mimicry is a type of adaptation that allows an animal to deceive its predator by resembling a different organism or inanimate object. This can make the animal appear less desirable as prey or make it more difficult for the predator to locate the animal.

This type of adaptation is where an organism has evolved to resemble another organism or inanimate object in order to gain an advantage in its environment. This can include deceiving predators, attracting mates, or avoiding detection. There are different types of mimicry, such as Batesian mimicry, where a harmless organism mimics a harmful one, and Müllerian mimicry, where multiple harmful organisms resemble each other.

Learn more about  Mimicry here:https://brainly.com/question/94811

#SPJ4

the seasonal migration of livestock between mountains and lowland pastures is

Answers

 Transhumance is defined as the seasonal movement of livestock (herds) between mountains and lowland pastures. Cows are usually taken to  lowlands in the winter and  highlands in the sumer.m

transhumance is a type of pastoralism or nomadism, the seasonal movement of livestock between fixed summer and winter pastures. In mountainous regions (vertical migration), this means migrating between high meadows in summer and low-lying valleys in winter. Shepherds usually have a permanent home in the valley. In general, only herds move with the specific number of people needed to support them, with the main population staying on base.  more susceptible to disruption by change.  

Traditional or fixed herding occurs throughout the inhabited world, especially in Europe and Western Asia. Dairy products (milk, butter, yoghurt, cheese) of migrating herds are often important to pastoral societies, as they can make up a large part of the diet of such groups. There are words for meadows, and  these words are often used as place names.Examples are hafod in Wales, shieling in Scotland, and alp in German-speaking  Switzerland.

To know more about Pastoral:

https://brainly.com/question/14497302

#SPJ4

What are the main points of Darwin's theory of evolution?

Answers

Answer:

More organisms are produced than can survive because of limited resources.

what is the connection between a man like mungo and imperialism

Answers

Answer: Mungo Park , a Scottish explorer to travel across the Niger River to gain access over it. Imperialism is the practice of a country to increase its power by taking control over other countries. Both are connected in the sense that both function in order to be supreme over others and gain control and dominance.


What do the numbers on the map represent?
1. air pressure
2.temperatures
3. humidity levels
4. amount of precipitation

Answers

Answer: All of the above

Explanation: If there is no answer to that then I have no idea because the map lists all of the above.

Answer:

temperatures (B)

Explanation:

it says numbers so temp

-9x + 3 = -7x - 15 what is the answer to this? And the work to get the answer

Answers

Answer:

9/8

Explanation:

Subtract 3 from both sides

-9x+3=-7x-15

-9x=3-3=7x-15-3

then simply

-9x=7x-18

subtract 7 from both sides

-9x=7x-18

-9x-7=7x-18-7x

combine like terms

-16x= -18

Divide both sides

-16 = -18

-16     -16

x=9/8

India is one of the 12 mega diversity countries of the world
Explain
class 9
5 marks question

Answers

Answer:

The term "biodiversity," sometimes known as "biological diversity," refers to the wide range of life that may be found on earth, as well as the social groups they can establish and the environments in which they can survive. India is a nation with enormous biodiversity.

Explanation:

India has over 47,000 plant species, making it a nation with a high level of biodiversity. In terms of plant diversity, it ranks fourth in Asia and tenth overall. With more than 15,000 flowering species, it makes up 6% of all flowering plants in the globe. In its fresh and saltwater waters, there are 90,000 kinds of creatures and a huge diversity of fish.

Hope it helps!

on the guyou projection, which latitude shows the least distortion: 0, 30, 60, or 90 degrees?

Answers

The least distorted latitude on the Guyou projection is 0 degrees. This is because the Guyou projection is a cylindrical projection which is based on the Mercator projection and is designed to be used for mapping the equator.

The Guyou projection maintains constant scale along the equator, meaning that shapes, area, and distance along the equator are all true to scale. This means that at 0 degrees latitude, there is no distortion of any kind, making it the least distorted latitude on the Guyou projection. Distortion increases as you move away from the equator, at 30, 60, and 90 degrees, making 0 degrees the best latitude to use when using the Guyou projection.

know more about latitude here

https://brainly.com/question/28606059#

#SPJ11

This Colorado ski town is the largest in Summit County, Colo., and hosts Ullr Fest every January. Where are we?
A Breckenridge
B Aspen
C Boulder

Answers

Answer: Breckenridge

Explanation: That is the biggest city in the county and hosts that festival

a long deep valley along the edges of some ocean basins

Answers

The geographical features associated with the deep ocean basins are trenches, ocean ridges and rises, abyssal plains and submarine mountainous regions. Abyssal plains are long, deep valley along the edges of some ocean basin.

Trenches: They are long, relatively narrow canyon-like features that run parallel to continental margins. They are the deepest part of ocean basins.

Abyssal plains: It is an underwater plain on the deep ocean floor at depths between 4500–6000 meters that extends from the continental rise to the distant deep ocean basin where continental-derived sediment deposition is not significant.

To know more about basin, visit:

https://brainly.com/question/1675090

#SPJ4

What types of economic activities do people who live in deserts engage in?

Answers

People who live in the desert are engaged in economic activities like Desert mining, Rearing livestock, Handicrafts, and Trade.

The main economic activities that people living in the desert are engaged in include rearing animals such as goats, sheep, camels, etc. They get milk, leather, and animal hair from them.  This leather is used in making belts and slippers and is then sold in the bigger markets in cities at high costs. Animal hair is used in making mats, carpets, clothes, and blankets.

Desert mining is also done. There are many valuable metallic minerals found in deserts, like copper, silver, iron, lead-zinc ore, and uranium.

People are also engaged in Handicrafts and seasonal agriculture during rains for only a few months.

Read more about Animal Rearing at:

https://brainly.com/question/19474533

Which of these statements best explains the shape of the Earth?
a. Because of its rotation about its axis, Earth has a greater circumference around the equator than around the Prime Meridian.
b. Because of its revolution around the sun, Earth has a greater circumference around the equator than around the Prime Meridian.
c. Because of its rotation about its axis, Earth has a greater circumference around the Prime Meridian than around the equator.
d. Because of its revolution around the sun, Earth has a greater circumference around the Prime Meridian than around the equator.

Answers

I think A.




I hope this helps<3

The "great ocean conveyor belt" is an ocean current that helps move heat energy around the earth and keeps our atmosphere more liveable. this ocean current is caused by differences in water density. these differences are caused mainly by:____.

Answers

The “great ocean conveyor belt” is an ocean current that plays a vital role in keeping our planet's atmosphere liveable. This current works by transferring heat around the globe, regulating temperatures and making life possible.

The ocean conveyor belt is driven by differences in water density, which are caused mainly by two factors: temperature and salinity. Colder and saltier water is denser and sinks to the bottom, while warmer, less salty water rises to the surface. This cycle of warm and cold water currents creates a continuous loop of ocean conveyor belt motion.

By moving heat energy around the globe and regulating temperatures, the ocean conveyor belt helps maintain a livable climate. This ocean current is an essential part of keeping our planet liveable, and highlights the importance of protecting our oceans and their inhabitants.

To learn more about ocean, click here:

https://brainly.com/question/16237714

#SPJ4

by avoiding excessive tillage, soil quality is enhanced by group of answer choices minimizing loss of organic matter. adding diverse crops. all of these are correct. maximizing soil removal.

Answers

Minimizing the loss of organic matter, adding diverse crops, and avoiding excessive tillage are correct ways to enhance soil quality. Maximizing soil removal is not the correct way to enhance soil quality.

The Enhance Soil Quality

The purpose of enhancing soil quality is to improve soil's physical, chemical, and biological properties to support plant growth and productivity, promote biodiversity, and improve soil health overall. This can lead to increased crop yields and resistance to environmental stress, as well as improved water retention, nutrient availability, and soil structure. Additionally, healthy soils can help reduce the need for synthetic fertilizers and pesticides and can help mitigate the effects of climate change by sequestering carbon.

While the methods used to enhance soil quality, such as minimizing loss of organic matter, adding diverse crops, and avoiding excessive tillage, are considered best practices in agriculture and horticulture, it's not a daily routine for everyone. Many farmers, gardeners, and land managers may use these methods regularly to maintain and improve the quality of their soils. However, not everyone who grows plants or manages land will use these methods, and some people may not know the importance of soil quality or how to enhance it.

Learn more about Enhance Soil Quality here:

https://brainly.com/question/21678504

#SPJ4

Other Questions
1. Who experience this discrimination?2. What kind of discrimination was it? What happened? What was their reaction?3. How was it resolved?4. If you were in their shoes, what would you have done differently?please help any kind of discrimination like your famili or friend please help coused idont have me brad and janet are getting divorced and splitting up their assets. brad is leaving the state and giving up his claim to their shared property. what type of special warranty deed will janet and brad utilize to give sole ownership to janet? a satisfactory ecg recording should have ________. the manager of a furniture factory finds that it costs $2600 to manufacture 90 chairs in one day and $4800 to produce 290 chairs in one day. (a) express the cost c (in dollars) as a function of the number of chairs x produced, assuming that it is linear. Warren wanted to save money to purchase a new car. He started by saving $1 on the first of January. On the first of February, he saved $4. On the first of March, he saved $16. So on the first day of each month, he wanted to save four times as much as he did on the first day of the previous month. If Warren continues his savings pattern, how much will he need to save on the first day of October? On a separate sheet of paper, explain how the routeLewis and Clark followed ontheir return trip differed fromthe route they followed asthey set out moving west.Why do you think the twoexplorers split up for part ofthe route? PLEASE HELP!!! URGENT identify the reactants and products of photosynthesis Fell:compassionate ::broken Can a participle phrase function as an adverb? HELP ASAP!!!!! What is the value of the following expression?[6 4 + 50 (12 + 13) + 2] 3 What professional can help you prepare your income tax return? Read Voluntourism: an opportunity too good to be true and The Opportunity of a Lifetime and answer the questions.How are points developed? What is the claim? Is there a counterclaim? If so, what is it? How is it refuted or weakened? What is the effect of the identified devices or appeals? How does this device or appeal help achieve the purpose of the speech or text? What is the authors attitude toward the topic? How does the tone affect the audience? How does the tone help achieve the authors purpose? Which details are emphasized in each medium? What does the different emphasis reveal about the authors position and purpose? What is the effect of the different elements emphasized? a co-worker is to employee as a (n) is to a (n) What are the benefits brought by technology and explain why is it beneficial in the field of healthcare? A computer is performing a binary search on a sorted list of 20 items. What is the maximum number of steps it needs to find the item? the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25 Work out the equation of the line shownbelow.Give your answer in the form y = mx + c,where m and c are integers or fractions intheir simplest forms.Y-160-140--120--100-80-60-40-20--80 -70 -60 -50 -40 -30 -20 -10 0-20--40--60-80--100-120--140---160-10 20 30 40 50 60 70 80 x