A 13. 5 liter balloon is heated from 248 K to 324 K. What will its new

volume be?

Answers

Answer 1

The new volume of the balloon will be determined by the Ideal Gas Law.

What is Ideal Gas Law?

The Ideal Gas Law is a mathematical equation used to describe the behavior of an ideal gas under a given set of conditions. It states that, at a constant temperature and pressure, the pressure, volume and amount of gas present are all directly proportional.

This law states that the product of the pressure, volume, and temperature of a gas is a constant.
Since the pressure of the balloon remains constant, the new volume is inversely proportional to the temperature.
Therefore, the new volume can be calculated by dividing the original volume (13.5 liters) by the ratio of the original temperature (248 K) to the new temperature (324 K),
which is 248/324 = 0.76.
The new volume of the balloon is then 13.5 liters / 0.76 = 17.76 liters.

To learn more about Ideal Gas Law
https://brainly.com/question/15882021
#SPJ4


Related Questions

which condition is caused by nitrogen bubbles and requires the use of a decompression chamber?

Answers

Decompression sickness is caused by nitrogen bubbles and requires the use of a decompression chamber.

Decompression sickness, also known as generalised barotrauma or the bends, refers to injuries produced by a sudden drop in the pressure that surrounds you, which can be caused by either air or water. It most typically happens in scuba or deep-sea divers, although it can also occur during high-altitude or unpressurized air travel.

Decompression sickness occurs when there is a sudden decrease in pressure (for example, during rise from a dive, escape from a caisson or hyperbaric chamber, or ascent to altitude), which causes gas previously dissolved in blood or tissues to develop bubbles in blood vessels. Pain, neurologic problems, or both are common complaints. Milder symptoms come from the production of bubbles in the skin or joints, but high numbers of bubbles in the venous circulation might cause lung injury.

To learn more about Decompression sickness, here

https://brainly.com/question/30281408

#SPJ4

the type of chemical reaction that occurs when magnesium chloride solution (mgcl2) reacts with sodium carbonate solution (na2co3)

Answers

The chemical reaction that occurs when magnesium chloride solution (mgcl2) reacts with sodium carbonate solution (na2co3) is named a replacement reaction.

It is important to keep in mind that the relative locations of metals in the electrochemical series play a role in determining whether or not a single replacement reaction occurs. Because aluminum is more reactive than copper and comes before copper in the electrochemical series, aluminum is capable of reacting with copper chloride. On the other hand, because magnesium is further along in the electrochemical series than aluminum and because magnesium is more reactive than aluminum, aluminum does not react with magnesium chloride.

When magnesium chloride solution and sodium carbonate solution interact, a white precipitate results from the replacement reaction.

You can also learn about replacement reaction from the following question:

https://brainly.com/question/15995721

#SPJ4

How do you predict the product of a chemical reaction?

Answers

To predict the product of a chemical reaction, one can use the chemical equation and the Law of Conservation of Mass to balance the equation and determine the products.

Using the chemical equation and the Law of Conservation of Mass to balance the equation and determine the products.

Using the knowledge of common chemical reactions and patterns, such as acid-base reactions, oxidation-reduction reactions, and neutralization reactions.

Using the reactivity of the reactants and the conditions of the reaction, such as temperature and catalysts, to predict the products.

Another way is to use the knowledge of common chemical reactions and patterns, such as acid-base reactions, oxidation-reduction reactions, and neutralization reactions. These reactions follow a set pattern and the products can be predicted by understanding these patterns.

The reactivity of the reactants and the conditions of the reaction, such as temperature and catalysts, also play a crucial role in predicting the products. A change in conditions can lead to a change in the products of a reaction.

Learn more about catalysts

brainly.com/question/14356166

#SPJ4

whats the best animal to have as a pet

Answers

These animals make the best pets for home are dogs,rabbit, cats,fish and tortoises.

What is animals?

Animals can be defined as multicellular eukaryotic organisms that form the biological kingdom Animalia. Animals consume organic material breathe oxygen are able to move.

Therefore, some important of domesticated animals are dogs, cats, sheep and goats. Fishes are reared and used for food, fish oil, manure, glue, and some important medicinal purposes and also camels, horses and elephants are used for transportation

Learn more about animals here: brainly.com/question/19884444

#SPJ1

What percent of ch4 is carbon?

Answers

Answer: 74.87%

Explanation: We'll use methane, CH4, as an example. The formula weight of methane is [12.01 + (4 x 1.008)] = 16.04. In terms of mass, methane is (4.032/16.04) x 100 = 25.13% hydrogen and (12.01/16.04) x 100 = 74.87% carbon.

For this exercise, you can simulate the described conditions by changing the values in the Run Experiment tool, under the Experiment tab, in the simulation. The hints run through each step in the calculation, where the equations are given before this part. The second hint calculates the temperature change, which is the only step that requires the simulation.


Use the simulator to react 93 mL of 0. 6 M HNO2 with 93 mL of 0. 8 M NaOH at an initial temperature of 20. 00 ∘C; note the final temperature. Use the data from the simulation to calculate the change in enthalpy per mole of product (n). Estimate the density of the liquid to be 1. 00 g/mL

Answers

The change in enthalpy per mole of product 3.21 J/mmol.

What is enthalpy?

Enthalpy is a measure of energy in a thermodynamic system. It is defined as the sum of the internal energy of the system plus the product of the pressure and volume of the system. The enthalpy of a system is typically expressed in units of energy per unit of mass or moles.

1. Calculate the number of moles of HNO2 and NaOH:
n(HNO2) = (93 mL) x (0.6 M) = 55.8 mmol
n(NaOH) = (93 mL) x (0.8 M) = 74.4 mmol
2. Calculate the number of moles of product (n):
n = n(HNO2) + n(NaOH) = 130.2 mmol
3. Use the simulator to determine the temperature change:
Final temperature = 40.20 ∘C
Temperature change = 40.20 - 20.00 = 20.20 ∘C
4. Calculate the change in enthalpy per mole of product (n):
Change in enthalpy per mole of product (n) = (20.20 ∘C) x (4.184 J/g∙∘C) x (1.00 g/mL) / (130.2 mmol) = 3.21 J/mmol.

To learn more about enthalpy
https://brainly.com/question/21369686
#SPJ4

What is the ionic bond of magnesium and oxygen?

Answers

Ionic bonds is also called electrovalent bonds because the bond is made between the atoms with opposite charges and the forces acting between them s electrovalent force. Ionic bonds of oxygen and magnesium is that they transfer two electrons per atom between them to make an ionic bond.

Ionic bond is the force that is generated between the two charged species and it is particular that one has excess of electrons and the other one has loss of electrons so that they can generate opposite charges between them in order to attract them to each other. this is the strongest force between the atoms. ionic bonds have the most attractive force in the atom and the most strong it. by this primary information, we can firmly consider that ionic  bonds are called electrovalent bonds because the bond is made between the atoms with opposite charges and ionic bonds of oxygen and magnesium is that they transfer two electrons per atom between them to make an ionic bond.

Learn more about Ionic Bonds:

brainly.com/question/11527546

#SPJ4

Can H2O and O2 form hydrogen bonds?

Answers

Yes, water (H2O) and oxygen (O2) can form hydrogen bonds. Hydrogen bonding is a type of intermolecular force in which a hydrogen atom, covalently bonded to a highly electronegative atom.

In the case of water, the oxygen atom in one molecule is attracted to the hydrogen atoms in another molecule. This creates a strong bond between the molecules, known as a hydrogen bond. The hydrogen bonds in water (H2O) are responsible for many of its unique properties, such as its high boiling point and its ability to form a liquid at room temperature. Oxygen (O2) molecule doesn't have any hydrogen atoms to form hydrogen bonds, but it can form weak dipole-dipole interactions with other O2 molecules, which are not as strong as hydrogen bonds. It's important to note that hydrogen bonding is a relatively weak type of intermolecular force compared to covalent or ionic bonds, but it plays a key role in the properties of many substances, such as water and many other organic compounds.

To know more about H2O please refer: https://brainly.com/question/13820422

#SPJ4

In what type of reaction is oxygen involved with, usually in combination with the release of a lot of heat and light?

Answers

When a combustion reaction occurs, oxygen plays a part in the process, usually along with the production of a lot of heat and light. A combustion reaction takes place when oxygen is available.

Total combustion reaction, which generates energy, carbon dioxide, water molecules in a gaseous state, and other products, is one of the two types of this process. Hydrocarbons are frequently used to create energy in combustion reactions. When a combustion reaction occurs, oxygen plays a part in the process, usually along with the production of a lot of heat and light. From the food our bodies digest to the way the sunlight we receive is created, chemical processes occur all around us. Understanding physical and chemical changes is essential before beginning chemical processes.

Learn more about molecules here

https://brainly.com/question/19556990

#SPJ4

State what happens to the potential energy of the molecules in a solid sample of hexane at -95°C as heat is added until the hexane is completely melted.

Answers

As heat is added to the solid sample of hexane at -95°C, its potential energy increases. This causes the bonds between the molecules to weaken and eventually break, leading to a transition from a solid to a liquid state. The potential energy continues to increase until the hexane is completely melted.

What is potential energy of the molecules?

This refers to the energy of a molecule as a result of the positions of its nuclei, r. This energy of a system of two atoms is based on the distance between them. At large distances the energy is zero, which means “no interaction”.

potential energy of the molecules is calculated using the formula:

P.e = mgh

Where,

P.e =  potential energy

m = mass

g = Gravitational force

h= height

Learn more about potential energy on

https://brainly.com/question/30004572

#SPJ1

Give 1 pH value where benzoic acid and dibromobenzene would be in different layers in an extraction. Assume that possible pH values are between 0 and 14.

Answers

The pH value where benzoic acid and dibromobenzene would be in different layers in extraction is 7.

Benzoic acid is a weak acid and has a pKa of 4.2, which means it will exist mostly in the form of the acid (HA) at pH values lower than 4.2 and mostly in the form of the salt (A-) at pH values higher than 4.2.

Dibromobenzene is a neutral compound and its pH does not affect its behavior.

If we take pH = 7 which is higher than the pKa of benzoic acid, benzoic acid will exist mostly in the form of salt (A-) in this pH range and Dibromobenzene will remain neutral.

So, Benzoic acid will be in the aqueous layer and Dibromobenzene will be in the organic layer during extraction.

To learn more about Benzoic acid:

https://brainly.com/question/28299797

#SPJ4

small amounts of spilled bases can be neutralized and made safe with

Answers

The small amounts of spilled bases can be neutralized and made safe with the boric acid

To neutralized the small amount of the spilled base we should use a weak acid. The boric acid is the weak acid that is useful to neutralized the small amount of spilled base. After that it should be clean with a paper towel or the sponge.

The acid-base neutralization reaction is the reaction when the acid and base will combine and formed the salt and the water. The boric acid is weak acid as it does not completely dissociates to produce the hydrogen ion , H⁺ ion.

To learn more about base here

https://brainly.com/question/12883745

#SPJ4

How many atoms are in two moles of methane ch4?

Answers

The number of the atoms are in the two moles of the methane , CH₄ is 12.044 × 10²³ atoms.

Given that :

The number of the moles of methane = 2 mol

The molar mass of the methane, CH₄ = 16 g/mol

The number of the moles = mass / molar mass

The mass of the methane, CH₄ = 16 g

The number of the atoms in the 16 g of the methane , CH₄ or 1 mole of methane = 6.022 × 10²³ atoms.

The number of atoms in 2 moles = 2 × 6.022 × 10²³

                                                       = 12.044 × 10²³ atoms

The molecules of the methane contains the four hydrogen atoms and the one carbon atom.

To learn more about moles here

https://brainly.com/question/14528756

#SPJ4

What is the relative formula mass of CH4?

Answers

The relative mass of methane is 16.043. This is the ratio of the mass of molecule to the mass unit.

The Relative molecular mass is the ratio of the mass of a molecule to the unified atomic mass unit or the mass of a formula unit of the compound relative to the mass taken as exactly 12. There are 4 steps to calculating the relative molecular mass of a molecule or compound given its chemical formula. Use the chemical formula to determine how many atoms of each element are present in the compound. Write a mathematical expression to calculate the total mass of all the elements in the compound. Use the Periodic Table to find the relative atomic mass of each element. Substitute the values for the relative atomic mass (atomic weight) of each element into the equation. Then we find the relative mass.

To learn more about Relative mass please visit:

https://brainly.com/question/29793727

#SPJ4

select one: a. water molecules are held together by polar covalent bonds. b. water molecules have an overall negative charge. c. water molecules should be attracted to nonpolar oils. d. water is a compound consisting of a 2:1 ratio of oxygen to hydrogen.

Answers

Option A. water molecules are held together by polar covalent bonds is correct.

A polar covalent molecule is water (H2O). The two hydrogen atoms do not uniformly surround the oxygen atom in the molecule. A water molecule has two poles: a positive charge on the hydrogen pole (side) and a negative charge on the oxygen pole due to the unequal sharing of electrons between the atoms and the asymmetrical form of the molecule (side). The water molecule is electrically polar.

A water molecule has no overall charge, but each hydrogen atom has a little positive charge, and each oxygen atom has a slight negative charge.

Water molecules are polar, which makes them more drawn to other polar or charged molecules (like an ion). Oils and fats are examples of nonpolar compounds. Since these nonpolar molecules are chargeless, water is not drawn to them.

In water molecules, hydrogen and oxygen combine in a ratio of  2:1.

To learn more about water molecules try:

https://brainly.com/question/21426318

#SPJ4

oxygen is the element that has 8 protons in its nucleus. if you start out with a neutral oxygen atom and it then loses 2 electrons, what is a good way to describe the resulting object?

Answers

The loss of two electrons causes the atom to have a net positive charge of two.

In order to reach the n=2 energy level and an octet of electrons in the outermost shell, oxygen, which has an electron configuration of (2, 6), must gain two electrons.

When an atom has an equal amount of protons and electrons, it also has an equal number of electric charges, both positive and negative (the electrons) (the protons). The atom is referred to as neutral since its overall electric charge is zero.

When electrons are added to or taken away from an object, an electrical charge is produced. An object acquires a negative charge when electrons are introduced to it because electrons have a negative charge. An object acquires a positive charge when its electrons are removed.

To know more about oxygen click here

https://brainly.com/question/2272415

#SPJ4

how are orbit and electron cloud models of the atom different

Answers

The difference between an orbit and an electron cloud is that an orbit is an area around the nucleus, whereas an electron cloud is a visual representation of where negative charge electrons are most likely present.

An area where an electron is very likely to be is called the electron cloud. The electron cloud is a tool for modelling the atom and is used to describe the behaviour of electrons. The location in space where an electron is most likely to be can be seen in the electron cloud. According to the electron cloud model, although we can never be certain of an electron's precise location, it is more likely that they are in certain regions.

Orbitals are those regions with a thick electron cloud where there is a high probability of finding an electron. Bohr put forth an orbital model. According to the orbital model, the negative electron orbit the astral nucleus in a ringlike pattern with the closest orbit to the nucleus having the lowest energy level. The electrons in this model can only be in very fixed fixed orbits, ruling out all other possibilities.

Learn more about electron here:

https://brainly.com/question/1255220

#SPJ4

The normal boiling point of methanol is 64. 7oC. A solution containing a nonvolatile solute dissolved in methanol has a vapor pressure of 715. 0 torr at 64. 7oC. What is the mole fraction of methanol in this solution

Answers

The mole fraction of methanol in this solution is 0.939.

The mole fraction of methanol in the solution can be calculated using the formula:

mole fraction of methanol = vapor pressure of methanol / (vapor pressure of methanol + vapor pressure of solute)

Since the normal boiling point of methanol is 64.7oC, its vapor pressure at that temperature is 760 torr (atmospheric pressure). The solution has a vapor pressure of 715.0 torr at 64.7oC, so the vapor pressure of the solute is 760 - 715 = 45 torr.

Therefore, the mole fraction of methanol in the solution is:

mole fraction of methanol = 715 / (715 + 45) = 715 / 760 = 0.939

To know more about mole fraction refer to:

brainly.com/question/20719489

#SPJ4

describes any element that can exhibit more than one structural form in the same state - solid, liquid, or gas.​

Answers

An element that can exhibit more than one structural form in the same state is called an allotrope.

Are there any industrial or technological applications that utilize this property of an element?

Yes, there are industrial and technological applications that utilize the property of elements that can exhibit more than one structural form in the same state. For example, carbon exists in multiple structural forms such as graphite and diamond. In industry, graphite is used in lubricants, batteries, and as a refractory material, while diamond is used for cutting and polishing due to its extreme hardness. Additionally, this property of an element is also utilized in technologies such as semiconductors and in the production of advanced materials such as aerospace composites.

To know more about Allotrope visit: https://brainly.com/question/28294770

#SPJ1

green plants use light from the sun to drive photosynthesis, a chemical reaction in which liquid water and carbon dioxide gas form aqueous glucose and oxygen gas. calculate the moles of glucose produced by the reaction of of carbon dioxide. be sure your answer has a unit symbol, if necessary, and round it to significant digits.

Answers

The majority of the energy required for life on Earth is produced and maintained by photosynthesis, which is also substantially responsible for producing and maintaining the oxygen content of the atmosphere. 

6CO₂ + 6H₂O = 6O₂ + C₆H₁₂O₆

6 moles of water are required for 1 mole of glucose.

Therefore, 0.9 x 6 = 5.4 moles of water are needed for every mole of glucose.

5.4 x 18 = 97.2 g

Plants and other living things employ a process called photosynthesis to transform light energy into chemical energy that can then be released through cellular respiration to power the organism's activities. Carbohydrate molecules like sugars and starches, which are created from carbon dioxide and water, contain some of this chemical energy.

Want to know more about photosynthesis visit the link which is given below;

https://brainly.com/question/29764662

#SPJ4

how many people are in 3 moles of people?​

Answers

Answer:

1.8066 x [tex]10^{24}[/tex] people

Explanation:

One mole of any substance has 6.022 x [tex]10^{23}[/tex] number of particles in it.

Using the ratio method:

   moles     :    people

        1          :   6.022 x [tex]10^{23}[/tex]

         3        :     X

X = (3 x 6.022 x [tex]10^{23}[/tex])

X = 1.8066 x [tex]10^{24}[/tex] people

When two oxygen atoms form a bond?

Answers

Two oxygen atoms form a bond, they create a molecule of dioxygen, or O2. Diatomic oxygen is the most stable and common form of oxygen in the Earth's atmosphere.

It is a colorless, odorless, and tasteless gas that is essential for life on Earth. Oxygen is a highly reactive element, and as such it can bond with many other elements. The covalent bond between two oxygen atoms is quite strong and it requires a significant amount of energy to break it. In nature, oxygen often combines with other elements to form compounds such as water (H2O), carbon dioxide (CO2), and ozone (O3). In the atmosphere, molecular oxygen (O2) makes up about 21% of the total volume of dry air. The majority of oxygen is produced by photosynthesis in plants and other organisms, and is consumed through respiration and combustion. In addition to its role in life processes, oxygen is also used in many industrial and technological applications, such as in the production of steel, the generation of electricity, and the propulsion of rockets.

To know more about oxygen please refer: https://brainly.com/question/13370320

#SPJ4

what is the smallest particle into which an element can be divided and still be the same substance?

Answers

An atom is the smallest component of a substance into which an element can be divided while retaining its identity. Atom hasn't gained many significant new features in the last few years.

However, we have been updating the security and compound during this time to ensure that we're being good stewards of the project and product. The opportunity to analyse the conceptual character of the term "element" is extremely rare, but it can be done by looking at the connection that now exists between chemists and philosophers of chemistry. From the food our bodies digest to the way the sunlight we receive is created, chemical processes occur all around us. Understanding physical and chemical changes is essential before beginning chemical processes.

Learn more about compound here

https://brainly.com/question/13516179

#SPJ4

Of the following types of bonds or interactions between atoms, which is the WEAKEST? van der Waals forces, ionic bond, hydrogen bond, covalent bond

Answers

Van der Waals forces are the types of bonds or interactions between atoms.

Molecules/atoms can stick to each other. But much more weakly than a bond. Covalent bond strength: 50-200 kJ/mole Intermolecular force: 1-12 kJ/mole

But these weak interactions control many critical properties: boiling and melting points, vapor pressures viscosities, etc.

Molecules that have permanent dipoles are attracted to each other.

–  The positive end of one is attracted to the negative end of the other, and vice versa.

–  These forces are only important when the molecules are close to each other.

To know more about forces here

https://brainly.com/question/12785175

#SPJ4

) Retake question In aqueous solutions, which type of bond or force has similar bond strength as ionic bond interactions? Nonpolar covalent bond Hydrogen bonds Polar covalent bond

Answers

In aqueous solutions, hydrogen bonds have a bond strength that is similar to that of ionic bond interactions.

Ionic bonds are formed between two ions with opposite charges, such as a sodium ion (Na+) and a chloride ion (Cl-), resulting in an ionic compound like NaCl. These bonds are very strong and are a result of the electrostatic attraction between the positively charged ion and the negatively charged ion. Hydrogen bonds, on the other hand, are formed between a hydrogen atom and a highly electronegative atom, such as nitrogen or oxygen. These bonds are also a result of electrostatic attraction, but they are not as strong as ionic bonds. They are present in many biological molecules such as DNA, proteins and they also play an important role in hydrogen bonding between water molecules. Nonpolar covalent bonds are formed between atoms with the same or very similar electronegativity, resulting in a nonpolar compound. They are weaker than both ionic and hydrogen bonds. Polar covalent bonds are formed between atoms with different electronegativity. They are stronger than nonpolar covalent bonds but weaker than ionic and hydrogen bonds.

To know more about hydrogen bond please refer: https://brainly.com/question/21054466

#SPJ4

8. A solution of ammonium phosphate is mixed with a solution of aluminum nitrate. If
aluminum phosphate is insoluble in water, what is the balanced reaction?

Answers

(NH₄)₃PO₄ (aq) + AI(NO₃)₃ (aq)→AIPO₄ (s) + 3NH₄NO₃ (aq)  is the balanced reaction?

What is a balanced reaction ?

An equation for a chemical reaction is said to be balanced if both the reactants and the products have the same number of atoms and total charge for each component of the reaction. In other words, both sides of the reaction have equal amounts of mass and charge.

The odorless, white crystalline solid known as aluminum phosphate is frequently utilized in liquid or gel form. Cosmetics, dental cement, paintings, paper, and pharmaceuticals all make use of it. An odorless, colorless to white solid, aluminum nitrate has no scent. It serves as an antiperspirant, corrosion inhibitor, and nitrating agent in addition to being used to tan leather.

To learn more about balances reaction use link below:

https://brainly.com/question/23877810

#SPJ1

how many dozen eggs are in 42 eggs??​

Answers

Answer:

3 and 1/2

Explanation:

if you count by twelves you see twelve goes in fourty-two 3 times and there are 12 eggs in a dozen. and we have 6 eggs left over if we multiply 6 by two you get 12.

Please help ASAP
Which liquid would have the
highest vapor pressure
(molecules in the gas phase
above the liquid)?

Answers

It would be B

I hope that helped

What is the reaction of c2h4 O2?

Answers

Ethylene is burned as a result of the reaction between C2H4 (ethylene) and O2 (oxygen), producing CO2 and H2O as byproducts. C2H4 + 3O2 -> 2CO2 + 2H2O is the reaction's chemical formula.

Ethylene (C2H4) is a hydrocarbon and the simplest alkene (a molecule containing a carbon-carbon double bond). It is a colorless and flammable gas with a sweet odor. Ethylene is used primarily in the production of polyethylene, a widely used plastic, as well as in the production of other chemicals such as ethylene oxide and ethylene glycol. It is also used as a ripening agent for fruits and as a sterilizing agent for certain types of plants. Ethylene is produced naturally by plants, and its production can be increased by certain stress factors such as injury or disease.

To know more about ethylene please refer:

https://brainly.com/question/28303854

#SPJ4

How many carbon atoms are in CO2?

Answers

There is one carbon atom present in CO₂.

Carbon dioxide(CO₂), is a chemical compound which is composed of one atom of carbon and two atoms of oxygen. The two oxygen atoms are covalently bonded to the single carbon atom.

CO₂ has its widespread importance for sustainability of life on earth. It is a colorless, odorless and non-combustible greenhouse gas. It serves as an essential greenhouse gas because it traps heat from the atmosphere. CO₂ can absorb infrared radiations. Human beings and animals exhale carbon dioxide and it is taken up by the plants from the atmosphere to carry out the process of photosynthesis.

To know more about CO₂  here

https://brainly.in/question/17805750

#SPJ4

Other Questions
In parallelogram JKLM, JK=5x1, KL=11x+3, and LM=3x+7. 1. Who experience this discrimination?2. What kind of discrimination was it? What happened? What was their reaction?3. How was it resolved?4. If you were in their shoes, what would you have done differently?please help any kind of discrimination like your famili or friend please help coused idont have me brad and janet are getting divorced and splitting up their assets. brad is leaving the state and giving up his claim to their shared property. what type of special warranty deed will janet and brad utilize to give sole ownership to janet? a satisfactory ecg recording should have ________. the manager of a furniture factory finds that it costs $2600 to manufacture 90 chairs in one day and $4800 to produce 290 chairs in one day. (a) express the cost c (in dollars) as a function of the number of chairs x produced, assuming that it is linear. Warren wanted to save money to purchase a new car. He started by saving $1 on the first of January. On the first of February, he saved $4. On the first of March, he saved $16. So on the first day of each month, he wanted to save four times as much as he did on the first day of the previous month. If Warren continues his savings pattern, how much will he need to save on the first day of October? On a separate sheet of paper, explain how the routeLewis and Clark followed ontheir return trip differed fromthe route they followed asthey set out moving west.Why do you think the twoexplorers split up for part ofthe route? PLEASE HELP!!! URGENT identify the reactants and products of photosynthesis Fell:compassionate ::broken Can a participle phrase function as an adverb? HELP ASAP!!!!! What is the value of the following expression?[6 4 + 50 (12 + 13) + 2] 3 What professional can help you prepare your income tax return? Read Voluntourism: an opportunity too good to be true and The Opportunity of a Lifetime and answer the questions.How are points developed? What is the claim? Is there a counterclaim? If so, what is it? How is it refuted or weakened? What is the effect of the identified devices or appeals? How does this device or appeal help achieve the purpose of the speech or text? What is the authors attitude toward the topic? How does the tone affect the audience? How does the tone help achieve the authors purpose? Which details are emphasized in each medium? What does the different emphasis reveal about the authors position and purpose? What is the effect of the different elements emphasized? a co-worker is to employee as a (n) is to a (n) What are the benefits brought by technology and explain why is it beneficial in the field of healthcare? A computer is performing a binary search on a sorted list of 20 items. What is the maximum number of steps it needs to find the item? the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25