a 79-year-old woman who takes several medications for a variety of chronic health problems has been prescribed an oral antiplatelet aggregator that is to be taken once daily. the nurse has encouraged the woman to take the pill at the same time of day that she takes some of her other medications. what is the most likely rationale for the nurse's advice?

Answers

Answer 1

The nurse has encouraged woman to take the pill at the same time of day that she takes some of other medications as : integrating new drug into the client's existing schedule promotes adherence.

Why did the nurse encouraged to take the pill at the same time as other medications?

When new drug therapy begins, plan the new drug schedule to coincide with other prescribed schedules whenever possible. If the client already takes drug three times a day with meals, and new drug must be taken once a day, client should take new drug with breakfast when other drugs are also taken.

In this way, client need not remember another time to take the drug and this kind of planning promotes therapeutic adherence. This strategy does not benefit drug metabolism or reduce the risk of adverse effects.

To know more about drug therapy, refer

https://brainly.com/question/1890407

#SPJ4


Related Questions

you need to rule out air-fluid levels for a chest exam on a patient that has had traumatic injuries, what is the best way to obtain this exa

Answers

Lateral decubitus, afflicted side down. Only when the central ray is pointed parallel to the fluid or air levels can they be distinguished clearly.

How examine lung?Consequently, the erect or decubitus position should be employed to indicate air or fluid levels. The lateral decubitus position with the affected side down is the best for demonstrating small quantities of fluid within the pleural space. The lateral decubitus position with the affected side up is the best for demonstrating small amounts of air within the pleural space.The term pneumoperitoneum refers to the presence of air or gas in the abdominal (peritoneal) cavity. Small amounts of free peritoneal air may go undetected on x-rays, but they are frequently found on computed tomography (CT).

For more information on lung examination kindly visit to

https://brainly.com/question/30162602

#SPJ4

a nurse is reinforcing teaching to client who has aphasia. which of the following actions by the nurse is appropriate when communicating with the client?a. raising her voice level when speaking to the clientb. asking the client open ended questionsc. clarifying client statements with the family as neededd. having the client use eye blinks to indicate yes or noI don't have the results yet

Answers

The nurse would encourage the patient to converse and collaborate with a speech therapist as needed, the nurse would not tell the patient to remain silent.

What is aphasia ?

A person with aphasia has difficulty speaking or understanding other people when they are speaking. When the areas of the brain that regulate spoken language are damaged or disturbed, this occurs. With illnesses like stroke, it occurs frequently.

Brain damage brought on by a stroke, which occurs when a blood artery in the brain bursts or becomes blocked, is the most frequent cause of aphasia. Language-related brain regions suffer cell death or damage as a result of blood flow problems.

Learn more about Aphasia here:

https://brainly.com/question/14550208

#SPJ4

code 99224 reports subsequent observation care. the description of this code states that the code is reported

Answers

The codes 99224 is used to report patient's condition when in treatment.

In brief:

These are CPT codes 99224–99226 which are used to report observation care on a daily basis. These codes cover reports like a review of the medical file, the findings of diagnostic tests, and a response to a change in the patient's condition since the last doctor's evaluation.

What are CPT codes?

The Current Procedural Terminology (CPT) codes is a system of codes that offer medical professionals a uniform language for recording medical services and procedures for streamline reporting, to increase accuracy and efficiency.

To know more about CPT codes, visit:

https://brainly.com/question/4286447

#SPJ4

the nurse recognizes the decline of which system most often influences an older adult's ability to maintain safety?

Answers

The nurse is aware that an older adult's ability to maintain safety is frequently impacted by sensory system decline.

Who is nurse?

Licensed healthcare providers with expertise in promoting and maintaining health, nurses may work independently or under the supervision of a doctor, surgeon, or dentist. A nurse is a person who has received special training in caring for the sick and injured. In order to treat patients and keep them healthy and fit, nurses collaborate with doctors and other healthcare professionals. Additionally, nurses provide end-of-life care and support for grieving family members. A nurse's main responsibility is to take care of patients by attending to their physical needs, avoiding illness, and treating medical conditions. Nurses must observe and monitor the patient while documenting any pertinent data to support treatment decision-making.

Here,

The nurse is aware that aging frequently affects an older adult's capacity to maintain safety.

To know more about nurse,

https://brainly.com/question/28317833

#SPJ4

congenital defect in the roof of the mouth where the palatine bones of the skull do not close properly

Answers

Cleft palate is congenital defect in the roof of the mouth where the palatine bones of the skull do not close properly.

What is congenital cleft palate?Birth abnormalities like cleft lips and palates happen when a baby's mouth or lips do not develop normally during pregnancy.When the palate does not close completely during development before birth, there is an opening or cleft in the roof of the mouth, which is known as a cleft palate. A birth defect affects about 3% of all newborns. Cleft lip and/or palate birth abnormalities are among the most prevalent birth malformations.Nasal reflux during feedings is caused by a cleft palate, a developmental flaw in the hard palate that causes connection between the oral and nasal chambers. It is one of the most prevalent congenital malformations and, with the right diagnosis and surgical care, has a favourable prognosis.

To learn more about Cleft palate refer to:

https://brainly.com/question/28272976

#SPJ4

a nurse discontinues an infusion of a unit of packed red blood cells (rbcs) because the client is experiencing a transfusion reaction. after discontinuing the transfusion, which action should the nurse take next?

Answers

After discontinuing the transfusion, the nurse's next action is to contact a healthcare provider.

Transfusion reactions are all events that occur due to blood transfusions. The potential for complications with blood transfusions is considerable, but most problems occur only in patients who require repeated or large volumes of transfusions. The risks associated with the transfusion of specific blood components are low. Nonetheless, these risks must be weighed against the benefits of each transfusion performed.

So that when a client experiences a transfusion reaction, the nurse must immediately contact a health care provider so that they can be treated as soon as possible and nothing bad happens.

This question is multiple choice:

A Removing the IV catheterB Contacting the healthcare providerC Changing the solution to 5% dextrose in waterD Obtaining culture of the tip of the catheter device removed from the client

The correct answer is B.

Learn more about transfusion reactions at https://brainly.com/question/21209477.

#SPJ4

a nurse is preparing a dose of furosemide for an older adult with heart failure. the health care provider orders furosemide 1 mg/kg to be given intravenously. the client weighs 50 kg. the concentration of the drug is 40 mg/4ml (10 mg/ml). how many milliliters would the nurse administer? record your answer using a whole number.

Answers

A nurse will prepare a 5 mL dosage of furosemide for an elderly person with heart failure.

Furosemide is just a loop diuretic (water pill) that keeps your body from absorbing excessive amounts of salt. This permits the salt to be excreted in your urine instead. Furosemide is prescribed to treat fluid retention (edema) in patients suffering from congestive heart failure, liver illness, or a kidney problem such as nephrotic syndrome. Furosemide is also prescribed to treat hypertension (hypertension). Furosemide belongs to a class of drugs known as loop diuretics (also known as water pills). Furosemide is used to treat fluid retention (edema) and swelling caused by heart failure, liver illness, renal disease, or even other medical disorders. It works by increasing the urine flow via the kidneys.

Furosemide is also used to treat high blood pressure, either alone or in combination with other medications (hypertension). High blood pressure makes the heart & arteries work harder. If it persists for an extended period of time, the heart & arteries may cease to operate correctly. This can cause damage to the blood arteries in the brain, heart, or kidneys, leading to a stroke, heart failure, and renal failure. High blood pressure may also raise the likelihood of having a heart attack. Controlling blood pressure may make certain issues less probable.

To know more about the Heart failure, here

https://brainly.com/question/29059231

#SPJ4

which characteristic related to achieveing autonomy would the nurse anticipate when providing care to a toddler? hesi

Answers

Ritualism is a characteristic related to achieving autonomy would the nurse anticipate when provinding care to a toddler

What is toddler age ritualism ? The nurse anticipates the toddler-age client to exhibit ritualism during this stage of development in order to achieve autonomy. The nurse would also anticipate the toddler-age client to exhibit negativism, not positivity. Magical thinking is a characteristic the nurse anticipates for the preschool-age, not toddler-age, client. Object permanence is a characteristic that the nurse anticipates for the infant, not the toddler.Ritualistic behavior may first start around the bedtime “routine.” Example of Possible Early Signs: Having to do the same exact behavior when tucking your child into bed (e.g. flatten out sheets, check for bugs). Having to say an exact phrase back to your child (e.g. saying I love you in a particular way).

For more information on ritualism kindly visit to

https://brainly.com/question/29840382

#SPJ4

Complete question : Which characteristic related to achieving autonomy does the nurse anticipate when providing care to a toddler-age client?

1. Ritualism

2. Positivity

3. Magical thinking

4. Object permanence

a nurse instructor is teaching a class of student nurses about the nature of pain. which statements accurately describe this phenomenon? select all that apply.

Answers

When someone is in pain, it must exist, according to them. Injury to the tissue causes pain, which is an emotional and sensory response. Tempo, place, source, transmission, and etiology are used to categorize different types of pain.

Are nurses and registered nurses the same thing?

The term "registered nurse" refers to a nurse who has completed all school requirements, obtained all necessary licenses, and been given state-issued authorization to practice nursing (RN). You can also run across the term "registered nurse" when looking for a job or post.

How fast is it possible to become a nurse?

Depending on the nursing school you decide to enlist in, it can take you as little as 16 months or as long as four years to become a registered nurse. Chi Akanegbu.

To know more about Nurse visit:

https://brainly.com/question/29655021

#SPJ4

after pulmonary artery catheter insertion, the nurse assesses a pulmonary artery pressure of 45/25 mm hg, a pulmonary artery occlusion pressure (paop) of 20 mm hg, a cardiac output of 2.6 l/ minute and a cardiac index of 1.9 l/min/m2. what is the best interpretation of these findings by the nurse?

Answers

The best interpretation of these findings by the nurse is to Begin a dobutamine infusion.

PAOP testing is useful for estimating left ventricular filling pressure and distinguishing between the cardiac and non-cardiac origin of pulmonary edema. The clinical evaluation of PAOP, which is based on physical symptoms of pulmonary congestion, is questionable.

When the pressure in the blood veins flowing from the heart to the lungs becomes too high, this is referred to as pulmonary hypertension. The blood vessels going to the lungs have more muscle in their walls when you have pulmonary hypertension. Arterial occlusion pressure (AOP) is the minimum pneumatic tourniquet inflation pressure necessary to halt arterial blood flow into the limb, and its use has been demonstrated to be effective in optimizing tourniquet cuff pressures.

To learn more about pulmonary artery occlusion pressure, here

https://brainly.com/question/29427731

#SPJ4

a registered nurse is caring for a client according to the total client care model of nursing. | which activity performed by the nurse manager would be appropriate in this situation? select all that apply. one, some, or all responses may be correct.

Answers

In a hospital or clinical setting, nurse supervisors oversee the nursing staff. They oversee patient care, decide on management and budgetary matters, establish work schedules, plan meetings, and decide on personnel.

Who is the client, exactly?

The client, a noun such as a person, a company, etc., requests the expert's advice. a person who uses computer programs and is a client of, enrolled with, or receives support from a welfare service.

What makes one individual a client as opposed to another?

While a client is a special kind of consumer who uses a company's expert guidance, a customer is anyone who makes a purchase from a business, whether it be goods or services. In addition to often making purchases of things, customers frequently obtain medical care and advice.

To know more about Client visit:

brainly.com/question/29453670

#SPJ4

how can a nurse best assure the management of personal long-term self-reflection that is associated with professional interaction with clients?

Answers

However, little study has been done to examine the underlying assumptions that nurses have about their function in long-term disease self-management.

Why do nurses think?

In order to find personal meanings derived from nurse practitioner encounters and interpersonal interactions, nurses deliberately "bend back" their attention when reflecting.

What does nursing self-reflection entail?

According to Lautebach and Becher, self-reflection is essential for nurses to engage in when providing care for others and has transformative effects since it helps practitioners connect with their inner own selves truth.

To know more about self-management visit:

https://brainly.com/question/4621248

#SPJ4

the test that checks for the susceptibility of a pathogen to specific antibiotics is ________.

Answers

The test that checks for the susceptibility of a pathogen to specific antibiotics is sensitivity testing. The correct answer is B.

Sensitivity testing, also known as antibiotic susceptibility testing, is a laboratory test used to determine the susceptibility of a pathogen (such as a bacteria) to specific antibiotics. The test is performed by growing a culture of the pathogen in the presence of different concentrations of an antibiotic and then measuring the minimum concentration at which the pathogen is unable to grow. The results of the test can be used to guide treatment decisions and help physicians choose the most appropriate antibiotic for a particular infection. 

This question should be provided with answer choices, which are:

A. KOH mountB. Sensitivity testingC. Gram-stainD. Direct examination

The correct answer is B.

Learn more about pathogen here: brainly.com/question/10500193

#SPJ4

which two factors would the nurse state influence the effectiveness of a leader? select all that apply. one, some, or all responses may be correct.

Answers

Two elements that affect the leader's effectiveness are readiness and assessment. The two elements that must be evaluated to determine the preparedness level of the leader are ability and willingness.

What skills are necessary for nurses to lead effectively?

Nurses must possess two crucial sets of competences in order to be more competent leaders and complete partners: a general set that may serve as the basis for just any management opportunity and an additional specialized set designed for a particular context, period, and place.

Why are nurses being urged to take up leadership roles?

taking the phone call, The demand for nurses to take on leadership roles can be met by developing leadership programs for nurses, providing mentorship, and being involved in political.

To know more about leaders visit:

https://brainly.com/question/28299329

#SPJ4

a nurse in a prenatal clinic is caring for a client who is in the first trimester of pregnancy. the client's health record includes this data: g3 t1 p0 a1 l1. how should the nurse interpret this information? (select all that apply) a. client has delivered one newborn at term b. client has experienced no preterm labor c. client has been through active labor d. client has had two prior pregnancies e. client has one living child

Answers

The nurse should interpret this information are a.Client has delivered one newborn at term = T1d. Client has had two prior pregnancies = G3e. Client has one living child = L1.

Which term would the nurse use to describe the first fetal movements that a pregnant client feels?Around 20 weeks into the pregnancy, you could feel the foetus move for the first time. Quickening is the name of this phenomena.During the first trimester, significant changes to your body also take place. Numerous symptoms, including as nausea, exhaustion, breast discomfort, and frequent urination, are frequently brought on by these changes. Even though these are typical pregnant symptoms, every woman's experience is unique.The client seeks knowledge on foetal development, physical changes, and nutrition as a result of becoming aware of the foetus as an individual and the anticipated changes of pregnancy.

To learn more about first trimester refer to:

https://brainly.com/question/10205945

#SPJ1

What is the food insecurity rate in the United States?

Answers

Answer:

According to data from the USDA, in 2019, an estimated 11.1% of households in the United States, or around 14 million households, were considered to be food insecure at some point during the year. This means that these households lacked consistent access to enough food for every member to lead a healthy life.

Answer:

In 2021, 89.8 percent of U.S. households were food secure throughout the year. The remaining 10.2 percent of households were food insecure at least some time during the year, including 3.8 percent (5.1 million households) that had very low food security. Food insecurity was unchanged from 10.5 percent in 2020. Food insecurity increased from 10.7 percent in 2001 to nearly 12 percent in 2004, declined to 11 percent in 2005–07, then increased to 14.6 percent in 2008. Food insecurity peaked at 14.9 percent in 2011 and has declined since.

a nurse is providing medication education to a patient who just started taking ibuprofen which information will the nurse include in the teaching

Answers

Learn about the patient teachings and nursing implications of ibuprofen (motrin) in this article. The dosage, appropriateness, interactions, and adverse effects should also be considered.

What is the ibuprofen patient instruction?

In order to avoid GI distress, instruct the patient to ibuprofen with meal or milk. Teach the patient not to lie down for fifteen to thirty minutes after taking the medication to prevent esophageal discomfort.

What is the purpose of ibuprofen?

Menstrual pain and other mild to severe pain are also treated with it . Ibuprofen, which is available without a prescription, is used to treat mild aches and pains such migraines, muscle aches, osteoarthritis, menstrual cramps, the cold virus, toothaches, and backaches as well as fever.

To know more about ibuprofen visit:

https://brainly.com/question/29221668

#SPJ4

a nurse is performing an assessment on a 78-year-old patient. which assessment findings indicate vulnerability for social isolation?

Answers

Assessment finding that indicate vulnerability for social isolation is hearing impairment makes it impossible to drive

early-onset dementia and recent spouse losses.

What is vulnerability assessment?When a friend or family member passes away, it's common for people to isolate themselves. This is especially true for seniors who have lost many loved ones in their generation. mental health problems Social isolation is a common cause of, as well as a common consequence of, problems including anxiety, sadness, and low self-esteem.Older persons are more likely to experience issues including living alone, losing relatives or friends, chronic sickness, and hearing loss, which raise their risk of loneliness and social isolation. Regardless of the level of social contact, loneliness is the sensation of being alone.

For more information on vulnerability assessment kindly visit to

https://brainly.com/question/1395802

#SPJ4

the technology informatics guiding education reform (tiger) initiative was designed to use health information technology in nursing practice by focusing on which initiatives? select all that apply.

Answers

The guiding education reform (Tiger) is designed to focus on the following initiatives:

Nursing management quality Interprofessional care coordinationClinical NursingIT management in nursing (e.g. informatics nurse officer)

TIGER stands for Information Technology Guiding Educational Reform. This is an initiative that started as a grassroots effort in 2006 and was established in three phases to promote the education of healthcare professionals in the use of information technology in providing care.

HIMSS' Informatics Technology Guiding Education Reform (TIGER) provides the global health workforce with innovative informatics/eHealth tools and resources to transform health for all.

The TIGER Initiative is aimed at helping one's profession to adopt informational tools, principles, theories, and practices that make healthcare safer and more effective, efficient, patient-delivered, and fair for all stakeholders.

Learn more about Technology Guiding Educational Reform at https://brainly.com/question/11474700

#SPJ4

the registered nurse (rn) delegates the tasks of caring for a client with pressure ulcers. the client suffers further tissue necrosis during treatment. which factor could result in further | tissue damage?

Answers

The reason for registered nurses (RN) to delegate the task of caring for clients with pressure sores who suffer from tissue necrosis is to perform wound irrigation by a patient care associate (PCA).

Patient care associates (PCA) should not irrigate wounds because the improper technique can cause tissue damage. A nurse is qualified in wound care; Therefore, wound debridement is unlikely to cause tissue necrosis. Pressure ulcers are associated with pain.

LPN-given oral pain relievers provide pain relief but do not cause tissue necrosis. Have a Licensed Practice Nurse (LPN) in a new location

This question is multiple choice:

1. Cleaning of the wound by the registered nurse (RN)2. Performing irrigation of the wound by the patient care associate (PCA)3. Administering of oral analgesics by the licensed practical nurse (LPN)4. Repositioning the client every 1-2 hours by the licensed practical nurse (LPN

Learn more about patient care associates at https://brainly.com/question/12568140
#SPJ4

order: antibiotic 100 mg po q 6h. child weighs 55 lb. drug insert recommends 2mg/kg per dose, q 6h available 100mg/5ml is the ordered dose safe according to the recommendation on the package insert?

Answers

The majority of medications are dosed for children in accordance with their body weight (mg/kg) or body surface area (mg/m2) Prior to computing dosages based on body weight, care must be taken to correctly convert body weight from pounds to kilograms (1 kg= 2.2 lb).

What is Pediatric Dosage Calculations?Considering that dosages are frequently specified as mg/kg/day or mg/kg/dose, prescriptions that are written as "mg/kg/d" need to be clarified by the prescribing physician.Chemotherapeutic medications are frequently dosed based on body surface area, necessitating an extra verification step (BSA calculation) prior to dosing. Orders written in "mL" rather than "mg" are unacceptable and need to be clarified because medications come in different concentrations.When determining doses, diagnostic information is helpful because dosage also varies depending on the indication. When administering medication to youngsters, the next examples are frequently seen.

Example:

For an infant weighing 22 lbs. and suffering from otitis media, determine the dosage of amoxicillin suspension in mLs. The suspension is available in a concentration of 400 mg/5 mL and the dosage is 40 mg/kg/day divided BID.

Convert pounds to kilograms.

22 lb divided by one kilogram and two pounds equals ten kilograms.

2. Determine the dosage in milligrams:

10 kg x 40 mg/kg/day = 400 mg/day

3. Multiply the dosage by the frequency:

200 mg/dose BID from 400 mg/day divided by 2 (BID)

Step 4: Convert the mg dosage to milliliters:

200 mg/dose x 400 mg/5.0 mL equals 2.5 mL BID.

To Learn more About body weight refer To:

https://brainly.com/question/25622260

#SPJ1

a long-term care facility is seeking an advanced practice nurse to educate the staff regarding palliative care for the residents. the facility would benefit most by hiring which advanced practice nurse?

Answers

According to EDP principles, goals and outcomes that have a direct influence on patient care are developed during the planning stage.

These patient-specific objectives and their accomplishment help to guarantee a successful outcome. In this stage of goal planning, nursing care plans are crucial.

It's a terrific idea to set daily, weekly, and even monthly goals to assist you adjust to your new professional practice job. These objectives may cover a range of subjects. Goals for enhancing time management, self-care, self-advocacy, clinical skills, critical thinking, and problem solving are a few examples.

For patients who need care for more than 30 days, long-term care is appropriate. It is necessary for those who have significant developmental disabilities, mental health issues, or physical deficiencies that call for ongoing care.

Learn more about to patient-specific objectives

https://brainly.com/question/28852516

#SPJ4

marnie is pregnant and taking vitamin a supplements to boost her immune system and prevent night blindness. however, she is concerned that she may be increasing the risk of serious birth defects in her unborn child. which dri would inform marnie about the maximum amount of vitamin a she could consume without risk of side effects? adequate intake (ai) estimated average requirement (ear) upper limit (ul) recommended dietary allowance (rda)

Answers

Dri would inform marnie about the maximum amount of vitamin a she could consume without risk of side effects is Upper Limit (Ul).

What is Night blindness ?

Poor vision at night or in low light is known as night blindness. Light can pass through the cornea and into the eye. The iris of the eye changes form as light enters the eye, either by opening up and allowing more light to enter or closing down and allowing less light to enter to alter the size of the pupil.

Unfortunately, depending on the underlying problem that is causing night blindness, treatment is not always an option. If a vitamin A deficiency is the cause of your night blindness, you can simply treat it by making dietary changes.

Learn more about Night blindness here:

https://brainly.com/question/2579514

#SPJ4

the nurse assesses for symptoms of insulin shock with may include select one: a. tremors, bradycardia, hunger, dizziness, and cool moist skin b. tremors, tachycardia, hunger, dizziness, and cool moist skin c. tremors, tachycardia, insomnia, dizziness, and flushed skin d. tremors, bradycardia, fatigue, dizziness, and flushed skin

Answers

The nurse assesses for symptoms of insulin shock as tremors, tachycardia, hunger, dizziness and cool moist skin.

Insulin shock is a kind of extreme hypoglycemia in which blood sugar levels drop dangerously low. If untreated over an extended period of time, it can result in loss all consciousness and possibly death. Insulin shock can develop in persons with either type 1 or type 2 diabetes if such drugs are used. Insulin coma therapy seems to have been a time-consuming procedure that necessitated the use of skilled personnel and a specialised unit.

Patients with schizophrenia were nearly always chosen because they had a fair prognosis as well as the physical strength to endure the hard therapy. There were no established treatment recommendations. Various hospitals and psychiatrists created their own procedures. In most cases, injections were given six days a week for around two months.

To know more about the Insulin shock, here

https://brainly.com/question/28012806

#SPJ4

What portion of the nervous system is outside of the central nervous system and contains nerves?(a) The integrated nervous system(b) The spinal nervous system(c) The motor nervous system(d) The sensory nervous system(e) The peripheral nervous system.

Answers

The peripheral nerve system The autonomic nervous system, the ganglia (groups of nerve cells outside the CNS), the autonomic nervous system, the autonomic nervous system, and the PNS are all included in the PNS.

What is peripheral nervous system?There are also 12 pairs of cranial nerves.

Two halves, the central nervous system and the peripheral nervous system, combine to form the nervous system of bilateral animals. Outside of the brain and spinal cord, the peripheral nervous system (PNS) is made up of nerves and ganglia.

The portion of your nervous system outside of your brain and spinal cord is called your peripheral nervous system (PNS). Both carrying out commands from your brain to various parts of your body and conveying information from various parts of your body back to your brain depend on it.

For more information on peripheral nervous system kindly visit to

https://brainly.com/question/2156614

#SPJ4

which of the 10 leading causes of death in the united states in 2015 are significantly influenced by diet?

Answers

The 10 leading causes of death in the united states in 2015 are significantly influenced by diet are breast cancer, lung cancer, colorectal cancer, heart disease, cancer, stroke, diabetes, nephritis, influenza, pneumonia.

What is death cause?

The disease or injury that set off the chain (sequence) of morbid (disease-related) events that resulted in death, or the circumstances surrounding the accident or violent act that resulted in the fatal injury, are considered the cause of death. The three main categories of causes of death are injuries, noncommunicable (chronic) conditions, and communicable (infectious and parasitic diseases, as well as maternal, perinatal, and nutritional conditions). It is possible to examine the interactions between diseases by using the two-thirds of death certificates that list multiple causes of death. The majority of deaths have multiple causes, and chronic diseases like diabetes and hypertension are among them. Analysis of multiple causes may be useful for injury surveillance.

here,

Breast cancer, lung cancer, colorectal cancer, heart disease, cancer, stroke, diabetes, nephritis, influenza, and pneumonia are the top 10 causes of death in the United States in 2015, and each of these conditions is significantly influenced by diet.

To know more about death cause,

https://brainly.com/question/2106116

#SPJ4

the nurse is caring for an 80-year-old patient who is taking warfarin (coumadin). which action does the nurse understand is important when caring for this patient?

Answers

Anticoagulant users are more likely to get bleeding. Patients who are older are more likely to experience falls that result in bruising issues. It's crucial to start a fall-risk protocol.

What distinguishes registered nurses from nurses?

A nurse who has completed all school requirements, obtained all necessary licenses, and been given state-issued authorization to practice nursing is referred to as a "registered nurse" (RN). You might also come across the word "registered nurse."

How long will it take me to become a nurse?

Depending on the nursing education you decide to enroll in, the registered nurse program may take little enough as 16 months or as lengthy as four years to complete. Akanegbu here.

To know more about Nurse visit:

brainly.com/question/29655021

#SPJ4

the nurse is caring for a patient who has been declared brain dead. the patient is considered a potential organ donor.in order to proceed with donation, the nurse understands that

Answers

In order to proceed with organ donation, the nurse understands that the patient must be declared brain dead and that the organ procurement organization must be involved.

Brain death is the irreversible cessation of all brain functions, including the brainstem, which controls vital functions such as breathing and heart rate.

Brain death is determined through a series of tests, such as the apnea test, which is performed by a physician, and it is legally recognized as a death in most countries.

Once a patient is declared brain dead, the nurse will work with an organ procurement organization to coordinate the donation process.

The nurse will ensure that the patient's wishes regarding organ donation are respected and that the family is informed and has the opportunity to ask questions and express any concerns.

The nurse will also monitor the patient's vital signs and administer medication as needed to maintain organ function until the organs are removed for transplantation.

Learn more about brain death at

https://brainly.com/question/29838898

#SPJ4

Functions of patient care depending on lighting and appliances of the life safety and critical branches shall be connected to the essential electrical system alternate power source so that all functions supplied by these branches are automatically restored within ? seconds.

Answers

Functions of patient care depending on lighting and appliances of the life safety and critical branches shall be connected to the essential electrical system alternate power source so that all functions supplied by these branches are automatically restored within 10 seconds 517.32(B).

What is the meaning of patient care in medical terms

It begins by explaining what “patient” means and what medical practice is. Medical practice is the act of providing health services to those in need. There are different types of health services practiced. One is the medical diagnosis and another is the treatment or health service itself. In the medical field, the patient is one of the most important people involved.

Patient care ensures that the patient is kept happy and comfortable with their wellbeing in mind. It is their right to be treated with dignity and care, and they have the right to have their privacy maintained. All the records regarding the treatment should be maintained so that when the patient needs to consult the doctor he can produce his records. The staff should be aware of the different procedures that are to be followed and they should be trained to execute them properly.

Learn more about caring patients at

https://brainly.com/question/29518316.

#SPJ4

the nurse is caring for an 82-year-old patient who takes digoxin to treat chronic atrial fibrillation. when caring for this patient, to monitor for drug side effects, what will the nurse carefully assess?

Answers

The correct option is C  ;  Serum creatinine and liver function tests (LFTs) , Blurred vision, nausea, and visual impairment are symptoms of poisoning (such as seeing green and yellow halos).

Digoxin poisoning is more likely to occur in those with low potassium levels. If digoxin poisoning is not treated right once, a patient may experience severe bradycardia and perhaps pass away.

Alanine transaminase (ALT) and aspartate transaminase (AST), alkaline phosphatase (ALP), gamma-glutamyl transferase (GGT), serum bilirubin, and others are frequently included in liver function tests.

Your liver function is normal if your ALT and AST test results fall between the range of 7 to 56 units per liter and 10 to 40, respectively. Anything beyond the normal range of the liver function test indicates there may be liver issues or an infection and has to be identified and treated.

Learn more about to Serum creatinine

https://brainly.com/question/28189858

#SPJ4

Full Question ;

the nurse is caring for an 82-year-old patient who takes digoxin to treat chronic atrial fibrillation. when caring for this patient, to monitor for drug side effects, what will the nurse carefully assess?

A. Complete blood count and serum glucose levels

B. Pancreatic enzymes and urinalysis

C. Serum creatinine and liver function tests (LFTs)

D. Serum lipids and electrolytes

Other Questions
identify the reactants and products of photosynthesis Fell:compassionate ::broken Can a participle phrase function as an adverb? HELP ASAP!!!!! What is the value of the following expression?[6 4 + 50 (12 + 13) + 2] 3 What professional can help you prepare your income tax return? Read Voluntourism: an opportunity too good to be true and The Opportunity of a Lifetime and answer the questions.How are points developed? What is the claim? Is there a counterclaim? If so, what is it? How is it refuted or weakened? What is the effect of the identified devices or appeals? How does this device or appeal help achieve the purpose of the speech or text? What is the authors attitude toward the topic? How does the tone affect the audience? How does the tone help achieve the authors purpose? Which details are emphasized in each medium? What does the different emphasis reveal about the authors position and purpose? What is the effect of the different elements emphasized? a co-worker is to employee as a (n) is to a (n) What are the benefits brought by technology and explain why is it beneficial in the field of healthcare? A computer is performing a binary search on a sorted list of 20 items. What is the maximum number of steps it needs to find the item? the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25 Work out the equation of the line shownbelow.Give your answer in the form y = mx + c,where m and c are integers or fractions intheir simplest forms.Y-160-140--120--100-80-60-40-20--80 -70 -60 -50 -40 -30 -20 -10 0-20--40--60-80--100-120--140---160-10 20 30 40 50 60 70 80 x A 2kg block is attached to a spring for which k=200N/m, it is hold at an extension of 5cm and then released at t=0. Find the displacement as a function of time. The velocity , acceleration and total energy when x=+_ A/2. the lowest prices. the most product options. the fewest product options. superior value for the price. the bloch sphere geometric representation of a quantum state is parameterized by two angles and such that . what are the values of the angles and for the state Evaluate the expression for x = -8.x = 16, and x = 4.X 4 which nursing action is appropriate when providing care to a patient who experiences apiration because of enteral feedings A. I hiked on mountain paths, biked on wooded trails, and kayaked on clear ponds.B. These drones can soar, swoop, hover, and even make the buzzing sound of a housefly.C. Mr. Patel improves our school every day by teaching his classes well, he coaches his team well, he even gives personal advice and counseling to students who need it.D. We are kinder, more thoughtful, more conscientious, better students. The first category of evaluation and management codes is?