a rock is thrown downward from the top of a 37.6-m-tall tower with an initial speed of 11 m/s. assuming negligible air resistance, what is the speed of the rock just before hitting the ground?

Answers

Answer 1

−29.27m/s is the speed of the rock just before hitting the ground when a rock is thrown downward from the top of a 37.6-m-tall tower with an initial speed of 11 m/s. assuming negligible air resistance.

What do you mean by initial speed?

When gravity first exerts force on an object, its initial velocity describes how quickly the object moves. The final velocity, on the other hand, is a vector number which gauges a moving body's speed and direction after it has reached its maximum acceleration.

To find: the speed of the rock just before hitting the ground

v f2 =v i2 +2aΔy, with v i =−11m/s and Δy=−37.6m

vf2​ =v i2+2aΔy

v2=(−11m/s) 2+2(−9.80m/s 2)(−37.6m)

v=−29.27m/s

To know more about initial speed visit

https://brainly.com/question/19348675

#SPJ4


Related Questions

microwaves are very efficient at heating water, but all electromagnetic waves can cause matter to heat up. why is this?

Answers

The internal heat produced by the product's absorption of electrical energy from the electromagnetic field, which is based on intermolecular friction caused by ionic conduction and dipolar rotation, is that causes the temperature to rise during microwave heating.

Any material subjected to electromagnetic radiation will become heated; microwave heating is a multi physics process involving electromagnetic waves and heat transport. Four heating sources are caused by the electric and magnetic fields' quick changes. A conductive material will conduct electricity in the presence of any electric field.

In a microwave, any substance with a significant number of electric dipoles will warm up. Additionally, the heating of food in microwave ovens has nothing to do with the resonance of water molecules.

To know more about heat

https://brainly.com/question/29552826

#SPJ4

in steady flow, the velocity of a fluid particle at any point is constant in time. on the other hand, a fluid accelerates when it moves into a region of smaller cross-sectional area. (a) explain what causes the acceleration. (b) explain why the condition of steady flow does not rule out such an acceleration.

Answers

The acceleration is caused by an increase in the fluid's velocity due to the conservation of mass, and the steady flow does not rule out acceleration as the overall mass flow rate and total energy is constant over time.

The acceleration of a fluid in a region of smaller cross-sectional area is caused by an increase in the fluid's velocity due to the conservation of mass. As the fluid moves into an area with a smaller cross-sectional area, the fluid particles must increase their velocity in order to maintain the same mass flow rate. This increase in velocity results in an acceleration of the fluid.

The condition of steady flow does not rule out such an acceleration because steady flow refers to a steady state, meaning that the overall mass flow rate and total energy of the fluid is constant over time. However, this does not mean that the velocity of the fluid particles must be constant at all points within the fluid. In fact, as the fluid moves into an area with a smaller cross-sectional area, the fluid particles must accelerate in order to maintain the steady mass flow rate.

To learn more about acceleration visit: https://brainly.com/question/460763

#SPJ4

a 5-kg cannon-ball acts as a piston in a cylinder with a diameter of 0.1 m. as the gun-powder is burned a pressure of2 mpa is created in the gas behind the ball. what is the acceleration of the ball if the cylinder ( cannon) is pointing horizontally?

Answers

The acceleration of the ball when the cylinder (cannon) is pointing horizontally is 0.125 m/s2.

The goal of this exercise is to calculate the acceleration of a 5-kg cannon-ball when it acts as a piston in a cylinder with a diameter of 0.1 m. As the gun-powder is burned, a pressure of 2 MPa is created in the gas behind the ball.

To calculate the acceleration of the ball, we must use the equation:

a = F/m

Where F is the force exerted on the ball, and m is its mass. The force on the ball can be calculated using the pressure P and the area A of the cylinder (A=πr2):

F = PA

Substituting this into the equation for acceleration, we get:

a = (Pπr2)/m

Substituting the values for P, π, r, and m, we get:

a = (2 MPa * 3.14 * (0.1 m)2) / 5 kg

a = 0.125 m/s2

Therefore, the acceleration of the ball when the cylinder (cannon) is pointing horizontally is 0.125 m/s2.

To learn more about acceleration, click here:

https://brainly.com/question/12550364

#SPJ4

How much work is performed by an elevator with a mass of 500kg if it lifts three people with a combined mass of 180kg a total distance of 100 meters?

Answers

Total amount of work done by the elevator is force* Displacement = 6800000 Joules.

What is work done ?

It should be converted to energy in order to move an item. Energy may be transferred by the use of force. Work done refers to the amount of energy used by a force to move an item.

The product of a force's component acting in the displacement's direction and its magnitude is known as the work done by the force. Formula. The following formula may be used to determine work by multiplying force and distance in the direction of the force. Unit: W = F d.

Force applied across a distance is called work. Examples of labor include dragging down a captive helium balloon, pushing a car up a hill, and raising an object against the gravitational attraction of the Earth. Energy manifests mechanically as work. The joule (J), or newton-meter (N m), is the accepted unit of work.

The total forece acting on the elevator = (500 + 180 )*10 = 6800 N

Total distance traveled = 100 m

Total amount of work done by the elevator is force* Displacement = 100 * 6800 = 6800000 Joules.

To learn more about Workdone refer to :

https://brainly.com/question/15173174

#SPJ1

a satellite used for gps devices must be in a geosynchronous orbit, meaning it must remain in position over the same spot on the earth. what is the period of a geosynchronous satellite? hours calculate this period in seconds. show unit conversions. find the orbital radius of this satellite if it is positioned over the equator.

Answers

The period of a geosynchronous satellite is 24 hours, or 86,400 seconds.

To calculate the orbital radius of a geosynchronous satellite over the equator, we must first understand the formula for the period of a satellite in an elliptical orbit.

This formula is given by T = 2π√a^3/μ, where T is the period, a is the semi-major axis of the orbit, and μ is the standard gravitational parameter of the central body. Knowing this formula, we can calculate the semi-major axis of the orbit by rearranging the formula and solving for a.

The semi-major axis can then be used to find the orbital radius by multiplying it by 2. The semi-major axis can be found by plugging in the given values and solving for a.

Plugging in the given values of the period (86,400 seconds), μ (3.986005x10^14 m^3/s^2), and rearranging the formula, we get a = (T^2μ/4π^2)^1/3. Substituting in the given values and solving for a, we get a = 42,164 km. To find the orbital radius, we multiply this value by 2, giving us an orbital radius of 84,328 km.

For more questions like Satellite click the link below:

https://brainly.com/question/11446806

#SPJ4

Compare how radiowaves and gamma rays are produced ( 6 marks )

Answers

When compared to each other, radio waves are produced by the movement of negatively-charged electrons whereas gamma rays are produced in nuclear reactions.

How are radio waves and gamma rays produced?

The back-and-forth movement of negatively charged electrons inside an antenna produces radio waves.

Radio waves have the longest wavelengths of all the waves in the electromagnetic spectrum. Radio waves are typically found at frequencies of 300 gigahertz and below.

On the other hand, nuclear explosions, lightning, and radioactive decay generate gamma rays.

Learn more about radio waves and gamma rays at: https://brainly.com/question/1687295

#SPJ1

UNIT 2 Dynamics 2.K Acceleration of Systems NAME DATE 22 RUTINOVU Case 1 Case 2 ! 98 N Scenario In both cases shown above, a block of mass Mis set on a rough table. The block is connected to a string that passes over an ideal pulley. In Case 1, the free end of the string is connected to a hanging object of mass m= 10 kg. In Case 2, the hanging object is removed and a person grabs the free end of the string and pulls with a constant force equal to 98 N, the weight of the hangir cases, the block is released from rest the same distance from the right edge of the table. Using Representations PART A: The dots below represent each object in Case 1. Draw the forces acting on those objects after the system is released. Use the grids to draw longer arrows to represent stronger forces. Assume that m

Answers

The Delta is larger than zero, the acceleration is 2.57 m/s. It was calculated how long Block 1 would take to land. Takes 1.85 seconds for Delta T.

What is the acceleration of Systems?One times two masses equals the penitential power. This equation can be slightly altered by adding the number -1 to both sides. We can attempt it. The mass of Stephen is one divided by two less. Our third equation is this one. The result of adding the first and second equations is Um 1. Let me also put that in writing. The answer to this question is 1 plus 2. To obtain Um 1 -8 2 and G -1 x 2, I shall adhere to the value of T two minus T one from equation number three. The mass is the same as the sound speed. The values are equal to one minus cm two and one, as shown by the modified version of the acceleration equation.Z multiply it by 0.5. One plus two cm. I respect the principles. We were able to get 18 minus 10 by dividing 9.8 m/s square by 0 5 4 g. Plus 28 is a lot of badly. The rate of acceleration is 2.57 m/s square. The equation of motion predicts how long it will take the block to touch the ground. The generous husband's value is equal to U. P plus half of a delta T square, and the nonvalues are 888-609.Wherever the Delta is larger than zero, the acceleration is 2.57 m/s. It was calculated how long Block 1 would take to land. Takes 1.85 seconds for Delta T.

To learn more about Acceleration refer to:

https://brainly.com/question/460763

#SPJ4

How is the force of gravity related to the distance between objects?

Answers

The gravitational force F between the bodies of masses M and m separated by a distance d between them is given by the formula,

F = (G M m)/d².

As gravitational force is inversely proportional to the square of the separation distance between the two interacting objects, more separation distance will result in weaker gravitational forces. Due to this, the gravitational force increases by four times when the distance between two bodies is halved and decreases by one-fourth when it is doubled.

This is how gravitational force between two objects is dependent on the distance when G is a universal gravitational constant.

To know more about gravity:

https://brainly.com/question/14703154

#SPJ4

Flapping flight is very energy intensive. A wind tunnel test on an 89 g starling showed that the bird used 12 w of metabolic power to fly at 11 m/s.

Answers

Flapping flight is very energy intensive then the metabolic power for starting flight is 134.8W/kg

What is metabolic power?

This translates to a measurement of the total energy required, per unit of time, to recreate the ATP required for work performance as metabolic power.

Instead, the actual oxygen consumption (VO2) at any given time could be equal to, higher than, or lower than the actual metabolic power.

Evaluating :

Starling mass, m, is 89 grams, or 89/1000 kilograms.

                        1 kg = 1000 g

                         P = 12 W for power

                           Velocity, v = 11 m/s

We must locate metabolic power before we can start flying. Considering that

                          Metabolic energy for takeoff = P/m

Using the equation ,

Starting metabolic power for flight equals 12/0.089

The metabolic power needed to take off is 134.8 W/kg.

Consequently, the metabolic power required to begin flight is 134.8W/kg.

To know more about metabolic power visit:

brainly.com/question/24267617

#SPJ4

what device was used to measure the magnetic field intensity, allowing scientists to study the magnetic properties of rocks?

Answers

Magnetometers are frequently used to measure the Earth's magnetic field, conduct geophysical surveys, find different kinds of magnetic anomalies, and calculate the dipole moment of magnetic materials.

How is a magnetic field's strength determined?

To measure the magnetic field at a specific location in space, a magnetometer, also known as a gaussmeter, is employed. The magnetic field's direction can also be measured by some devices. Since their invention in the middle of the nineteenth century, these devices have developed into precise, accurate measurement tools.

The magnetometer, also referred to as a magnetic sensor, is a vital sensor used in all kinds of aircraft and spacecraft to measure magnetic induction (magnetic field intensity).

To know more about magnetic field visit:

https://brainly.com/question/23096032

#SPJ4

What is the final velocity of the ball at its highest point?

Answers

The final velocity of the ball at its highest point of a projectile's trajectory is zero, because the object is at the highest point of its trajectory and it's not moving.

When an object is projected into the air, it is subject to the force of gravity pulling it downward. This force causes the object to follow a parabolic trajectory, where the velocity of the object changes constantly. As the object reaches the highest point of its trajectory, it has reached its maximum height and its upward velocity is zero. The object is at the highest point of its trajectory and it's not moving, so the final velocity is zero. It's important to note that at this point, the net force acting on the object is also zero, the force of gravity is pulling it downward. It is worth mentioning that this is true for a projectile under the effect of gravity only. If there were other forces acting on the projectile, like air resistance, the final velocity at the highest point would not be zero.

To know more about velocity please refer: https://brainly.com/question/12550364

#SPJ4

Identify the main systems involved:
Hormones move through the runner's bloodstream, stimulating her body
systems to work harder. (select 2 answers)
circulatory
digestive
endocrine
excretory
integumentary
immune/lymphatic
muscular
nervous
reproductive
respiratory
skeletal

Answers

Answer:

her circulatory system & endocrine system

what is the magnitude of the net gravitational force fgrav on the mass at the origin due to the other two masses?

Answers

The magnitude of the net gravitational force Fg on the mass at the origin due to the other two masses is 5.87×10⁻⁴ N.

The gravitational force on a body is given as Fg= (G×m₁×m₂)/ r², where G is the gravitational constant and its value is 6.67×10⁻¹¹ Nm²/kg². The force on the mass at the origin due to the first mass F₁= G×m²/(x₁)²=6.37×10⁻⁴N( x₁=110cm). This F₁ force is directed along the -x direction.

The force on the mass at the origin due to the second mass F₂= G×m²/(x₂)²= 5.07×10⁻⁵N (x₂=390cm). This F₂ force is directed along the +x direction.

So the gravitational force on the mass at the origin due to the other two masses is F(grav)= G×m²/(x₁²-x₂²) = (6.37×10⁻⁴-(5.07×10⁻⁵)=5.87×10⁻⁴N.

For further learning about gravitational force, refer to this link:

https://brainly.com/question/21500344

#SPJ4

consider the operator for observing the spin projection along the x-axis what is the spectral decomposition of ?

Answers

The spectral decomposition is |+><+|-|-><-| and thus The correct option d is correct.

What is spectral decomposition?

Spectral decomposition is a type of mathematical analysis used to divide a complex system into its constituent parts. It is a powerful tool used in areas such as signal processing, engineering, physics, and mathematics to help uncover the underlying structure of a system. Spectral decomposition can be used to analyze signals on a time-frequency basis, revealing frequency components that are present in the signal. The decomposition can also be used to identify and analyze the structure of a system and its components, such as its modes of vibration and waveforms.The spectral decomposition of the operator for observing the spin projection along the x-axis is given by:1. Spin-up projection operator : [tex]$\dfrac{-\hbar}{2}\sigma_x$.[/tex]The spectral decomposition thus consists of three operators that project onto the three states of spin: spin-up, spin-down, and spin-zero. This allows us to measure the spin projection along the x-axis with high accuracy.

[tex]\left[\begin{array}{ccc}0&1\\1&0\end{array}\right][/tex]

= [tex](1 \times 0) - (0 \times 1)[/tex]

This matches the special decomposition of |+><+|-|-><-| in the format.

Therefore, the correct option is D.

To know more about spectral decomposition click-

brainly.com/question/18081509

#SPJ4

a metal surface has a work function of 1.50 ev. calculate the maximum kinetic energy, in ev, of electrons ejected from this surface by electromagnetic radiation of wavelength 311 nm. (c

Answers

The maximum kinetic energy of electrons ejected from a metal surface by electromagnetic radiation of wavelength 311 nm is 2.50 ev.

Define kinetic energy?

 Kinetic energy is the energy an object has because of its motion. If we want to accelerate an object, then we must apply a force. Applying a force requires us to do work. After work has been done, energy has been transferred to the object, and the object will be moving with a new constant speed.

Kinetic energy is a form of energy possessed by an object due to its motion. Potential energy is the form of energy possessed by an object due to its position or state. Formula used is. K E = 1 2 m v 2.

Kinetic energy is the energy associated with the movement of objects. The kinetic energy of an object depends on both its mass and velocity, with its velocity playing a much greater role. Let a body of mass M moving with velocity V. K. E=21MV2, its SI unit is Jule.

To learn more about kinetic energy refers to;

https://brainly.com/question/8101588

#SPJ4

18. a tire of 2.0 ft diameter is placed on a balancing machine where it is spun so that its tread is moving at a constant speed of 60 mph. a small stone is stuck in the tread of the tire. what is the acceleration of the stone as the tire is being balanced?

Answers

The centripetal acceleration of the stone as the tire being balanced would be 2,358.40 m/s²

The direction of the velocity varies at each point or changes continuously when an item travels in a circle with radius R and a constant speed v. Centripetal acceleration is the term for an object's acceleration brought on by a constant change in direction.

To find the acceleration of the stone, we can use the centripetal acceleration formula:

Ac = V²/R

In this case, we are given that:

The diameter of the tire (d) = 2 ft = 0.61 meter

The constant speed (v) = 60 mph = 26.82 m/s

The radius of the tire (R) = d/2 = 0.61 m :2 = 0.305 m

Thus, the centripetal acceleration of the stone:

Ac = V²/R

Ac = 26.82²/0.305

Ac = 2,358.40 m/s²

To learn more about centripetal acceleration, click here:

https://brainly.com/question/79801

#SPJ4

A thermometer which was not accurately calibrated indicates -0.5°C at the lower fixed point and 106°C at the upper fixed point. What temperature does the register when the true temperature is 60°C

Answers

When the true temperature is 60°C, the thermometer registers 69.97°C.

How to find calibration on a thermometer?

Using the formula:

(indicated temperature - lower fixed point) / (upper fixed point - lower fixed point) = (true temperature - lower fixed point) / (upper fixed point - lower fixed point)

Inserting the values:

( - 0.5 - ( - 0.5)) / (106 - ( - 0.5)) = (60 - ( - 0.5)) / (106 - ( - 0.5))

Solving for the true temperature, we get:

(60 - (-0.5)) / (106 - (-0.5)) = (60.5) / (106.5)

Multiplying both sides of the equation by (106.5) to get:

60.5 = (60.5) / (106.5) x (106.5)

Therefore, the thermometer will register 69.97°C when the true temperature is 60°C.

Learn more on thermometer here: https://brainly.com/question/2339046

#SPJ1

why does the moon look red during a lunar eclipse?

Answers

Answer:

Explanation:

blb

find the length of a pendulum that oscillates with a frequency of 1.0HZ

Answers

The 0.25 m is the length of a pendulum that oscillates with a frequency of 1.0HZ.

What is frequency ?

The number of waves that travel through a fixed location in a specific amount of time is known as frequency. As a result, if a wave travels for 1/2 second, the frequency is 2 per second. 100 times per hour is the frequency if it takes 1/100 of an hour.

What is oscillation ?

Oscillation is a revolving motion between two states or locations. The side-to-side swing of a pendulum or the up-and-down motion of a spring with a weight are two examples of periodic motions that repeat themselves in a regular cycle and are considered oscillations.

Therefore,  0.25 m is the length of a pendulum that oscillates with a frequency of 1.0HZ.

Learn more about frequency from the given link.

https://brainly.com/question/254161

#SPJ1

where does the energy come from that is used to attach a 3rd phosphate to adp?

Answers

ADP is transformed into ATP using energy produced by the catabolism of glucose. The third phosphate is momentarily connected to a substrate when ATP is employed in a reaction; this is the process known as phosphorylation.

The phosphorylation of carbohydrates is typically the first step in their metabolism. Cells can store carbs thanks to phosphorylation, which prevents molecules from moving back across the transporter. The process of phosphorylating glucose is essential to the metabolism of sugar. The initial rate of phosphorylation of glucose (ATP-D-glucose 6-phosphotransferase) and non-specific hexokinase is the rate-limiting step in the liver's metabolism of glucose. Glucose can pass readily through hepatic cells (ATP-D-hexose 6-phosphotransferase). The role of glucose 6-phosphate in glycogen synthase High blood glucose levels cause increased intracellular amounts of glucose 6 phosphate in the liver, skeletal muscle, and fat (adipose) tissue. Hexokinase without specificity and ATP-D-glucose 6-phosphotransferase (ATP-D-hexose 6-phosphotransferase).

Learn more about phosphorylation

brainly.com/question/15585148

#SPJ4

Object A has a momentum of +20 kg m/s, and object B has a momentum of -6 kg m/s. The two objects collide. After the collision, object A has a momentum of -4 kg m/s. What is the momentum of object B after the collision?

Answers

The  momentum of object B after the collision is + 18  kg m/s.

What is principle of momentum conservation?

The principle of momentum conservation asserts that momentum is never created nor destroyed but only modified by the action of forces as they are represented by Newton's equations of motion. This applies to a particular issue area.

According to principle of momentum conservation:

The  momentum of object B after the collision = total initial momentum - momentum of object A after the collision

=  +20 kg m/s  -6 kg m/s - ( -4 kg m/s)

= + 18  kg m/s

Learn more about momentum here:

https://brainly.com/question/24030570

#SPJ1

if light strikes a body of water at an angle of 55° the angle of reflection will be

Answers

When light strikes a body of water at an angle of 55°, the angle of reflection will be 55°.

This is due to the law of reflection, which states that the angle of incidence (the angle between the incoming light and the normal line to the surface) is equal to the angle of reflection (the angle between the reflected light and the normal line to the surface).

The angle of incidence is 55° and the angle of reflection is also 55°, this means that the reflected light will also be at an angle of 55° with respect to the normal line to the surface of the water.This law applies to any type of mirror surface, whether it is a flat surface or a curved surface, and it also applies to all types of light, including visible light, infrared light, and ultraviolet light.

It is important to note that when the light strikes the surface of the water at an angle of 55°, it will also refract, meaning that it will bend upon entering the water. The angle of refraction, the angle between the light and the normal line to the surface after it enters the water, can be calculated using Snell's Law.

Learn more about angle of reflection at : https://brainly.com/question/12617938

#SPJ4

which of the following is true of the object as it moves? (a) it has a constant acceleration while moving up the plane and a greater acceleration when moving down the plane. (b) it has a constant acceleration while moving up the plane and a smaller acceleration when moving down the plane. (c) it moves with a constant velocity both up and down the plane. (d) it has the same acceleration as it moves up and down the plane. (e) it has a continuously varying acceleration as it moves up and down the plane.

Answers

(d) It has the same acceleration as it moves up and down the plane.

As we know we need external force for an increase or decrease in the motion of a body and for moving up the plane to keep on moving one needs to supply a constant force. whether moving toward up or down. And for a simple moving body on a frictionless smooth surface, a body keeps on moving with the same acceleration.

(Force)f = m*(a1-a2) ................... a1 (Final accelaration), a2 (Initial Accelaration)

where m= Mass

a =  acceleration

and as Force(f) = 0

either mass(m) or difference of acceleration(a) need to be Zero.

and we know mass can not be zero so

The change in acceleration is zero which implies

Constant or same acceleration.

Learn More about External Forces:

https://brainly.com/question/1992782

#SPJ4

you hold a bucket in one hand. in the bucket is a 470 g rock. you swing the bucket so the rock moves in a vertical circle 2.1 m in diameter. what is the minimum speed the rock must have at the top of the circle if it is to always stay in contact with the bottom of the bucket?

Answers

The minimum speed the rock must have at the top of the circle if it is to always stay in contact with the bottom of the bucket is 4.56 m/s.

To determine the minimum speed the rock must have at the top of the circle, we need to consider the centripetal force acting on the rock. The centripetal force is provided by the tension in the string holding the bucket, and it must be greater than or equal to the force of gravity acting on the rock.

The centripetal force is given by the equation: F_c = ma = mv^2/r

where F_c is the centripetal force, m is the mass of the rock, a is the centripetal acceleration, v is the speed of the rock and r is the radius of the circle.

The force of gravity acting on the rock is given by the equation: F_g = m*g

where F_g is the force of gravity, m is the mass of the rock and g is the acceleration due to gravity.

Since the rock always stays in contact with the bottom of the bucket, the centripetal force must be greater than or equal to the force of gravity:

F_c = mv^2/r >= mg

So, we can rearrange the equation to find the minimum speed the rock must have at the top of the circle:

v >= sqrt(r*g)

Given, the rock's mass is 470g, radius of the circle is 2.1 m, and the acceleration due to gravity is 9.8 m/s^2

m = 0.470 kg

r = 2.1 m

g = 9.8 m/s^2

v >= sqrt(rg) = sqrt(2.19.8) = sqrt(20.78) = 4.56 m/s

So the minimum speed the rock must have at the top of the circle if it is to always stay in contact with the bottom of the bucket is 4.56 m/s.

Learn more about centripetal force at : https://brainly.com/question/11324711

#SPJ4

Two elevators were being used in a building but both have different power ratings. Use the
information provided below to calculate the difference in the power rating of the elevators.
Elevator 1 is able to transfer 4.4kJ of energy in the time it takes for the elevator to travel 30m at a
speed of 2m/s.
Elevator 2 is able to transfer 5.5kJ of energy in the time it takes for the elevator to travel 30m at a
C speed of 3m/s.
You will need another equation to help you answer these questions.

Answers

The difference in power rating of the two elevators is 0.26 kW. Elevator 2 has 0.26kW higher power rating than elevator 1.

What is power?

Power is a measure of the rate at which energy is transferred or work is done. It is often measured in watts (W) or kilowatts (kW). Power is the product of the force acting on an object and the velocity at which the force is exerted. The standard unit of power is the watt (W), which is equal to one joule of energy per second.

To calculate the difference in power rating of the elevators, we need to find the power rating of each elevator. Power can be defined as the rate at which energy is transferred or work is done. The equation for power is:

Power = Work / Time

In this case, the work is the amount of energy transferred and the time is the time it takes for the elevator to travel 30m at a given speed.

For Elevator 1:

Power = 4.4 kJ / (30m / 2m/s) = 4.4 kJ / 15s = 0.29kW

For Elevator 2:

Power = 5.5 kJ / (30m / 3m/s) = 5.5 kJ / 10s = 0.55kW

To find the difference in power rating, we subtract the power rating of Elevator 1 from the power rating of Elevator 2:

Difference in power rating = 0.55kW - 0.29kW = 0.26kW

So, the difference in power rating of the two elevators is 0.26 kW. Elevator 2 has 0.26kW higher power rating than elevator 1.

To learn more about power from the given link:

https://brainly.com/question/25864308

#SPJ1

Ratio of dimension of k.e and power

Answers

The proportion of kinetic energy to power in dimensions is [T].

The following determines the object's kinetic energy:

E = ½mv²

The mass formula in dimensions is [m] = [M].

The dimensional velocity formula is [v] = [LT-1].

Kinetic energy's dimensional formula is [K] = [ML2T-2].

Power is the amount of work completed each second. It comes from:

P = W / t

[W] = [ML2T-2] is the dimensional formula for work done.

The time dimension formula is [t] = [T].

The dimensionless power equation is [P] = [ML2T-3].

The kinetic energy to power ratio is [K]/[P] = [ML2T-2] / [ML2T-3].

[K] / [P] [T]

Therefore, [T] is the ratio of the dimensions of kinetic energy to power. This is the necessary remedy as a result.

To learn more about Kinetic Energy from given link

https://brainly.com/question/25959744

#SPJ1

a class f model rocket engine can provide an impulse between 40-80 n-s. a student attaches a class f rocket that can apply an impulse of 60 n-s to a model rocket of mass 3.0 kg. what is the max speed it will reach?

Answers

The max speed it will reach is 20 m/s. Speed can be determined by divide impulse with mass.

Speed is a scalar quantity that refers to "how fast an object is moving." It is typically measured in units of distance per unit of time, such as meters per second (m/s) or kilometers per hour (km/h). It is the magnitude of velocity, which is a vector quantity that also includes direction. In other words, velocity specifies both how fast an object is moving and in what direction it is moving, while speed only specifies how fast the object is moving.

The maximum speed a rocket will reach can be calculated using the equation:

Speed = (Impulse / Mass)

In this case, the impulse is 60 N-s and the mass is 3.0 kg, so:

Speed = (60 N-s) / (3.0 kg) = 20 m/s

So the max speed the model rocket will reach is 20 m/s.

Learn more about speed, here https://brainly.com/question/28224010

#SPJ4

Which of the following lines of reasoning involves proving a event occurs, and assuming
something about the mechanisms leading to that conclusion?
O productive reasoning
O inductive reasoning
O deductive reasoning
O reductive reasoning

Answers

Correct option is C, deductive reasoning involves proving a event occurs, and assuming something about the mechanisms leading to that conclusion.

Deductive reasoning -

In deductive reasoning, a conclusion is drawn from the agreement of multiple premises that are frequently assumed to be true. Deductive reasoning is also referred to as top-down reasoning. Deductive reasoning is built on making logical assumptions and drawing conclusions from them.

It is predicated on a broad assertion or hypothesis that is assumed to be true (sometimes referred to as a premise). In order to arrive at a clear, logical conclusion, the premise is used. The if/then statement is a typical illustration. Deductive reasoning informs us that A Equals C if A = B and B = C.

To learn more about deductive reasoning from given link

https://brainly.com/question/7284582

#SPJ1

Physical science helppppppppppppppp

Answers

Explanation:

number 1

power = iv = 10×3 = 30 watt

number 2

power in R1

P=V²/R1

p=15²/10

p=22.5

power in R2

p=15²/5

p=45

number 3

energy= power ×time. time changed from hour to sec

energy=200 ×10800

energy= 2,160,000 watt sec

or in hours

energy= 200× 3

energy= 600 watt hour

number 4

from energy formula we obtained that

power=energy/ time

so

power=1000/30

power = 33.3 joule per second

the average density of a planet is 3.44 g/cm3. what is its density in kg/m3? (enter your answer in scientific notation.)

Answers

3440 KG/m3 is the same as 3.44 g/ cm3As the SI unit of density is kilogram per cubic meter so, we need to convert g/cm3 to kilogram per cubic meter

As density is the property of matter that deals with the mass per cubical unit place it occurs or places it is required. Or we can say it also deals with the floating property of a substance. Density decides the floating of an object. The less the density more floating the object is and it does not sink easily. it has a formula as

d= m/v..........(Mass/Volume)

To convert gram/ cm3

1 g/cm3 is the same as 1000kg/meter cubic

as

10 gram to kg, divide it by 1000, and 10/1000 = 0.01 kg

so 1000 gram = 1 kg

for cm to m, we need to multiply by 100

so

3.44* (100)*100*100/1000

3440000/1000

3440kg/m3

Learn More about density: https://brainly.com/question/6838128

#SPJ4

Other Questions
HELP ASAP!!!!! What is the value of the following expression?[6 4 + 50 (12 + 13) + 2] 3 What professional can help you prepare your income tax return? Read Voluntourism: an opportunity too good to be true and The Opportunity of a Lifetime and answer the questions.How are points developed? What is the claim? Is there a counterclaim? If so, what is it? How is it refuted or weakened? What is the effect of the identified devices or appeals? How does this device or appeal help achieve the purpose of the speech or text? What is the authors attitude toward the topic? How does the tone affect the audience? How does the tone help achieve the authors purpose? Which details are emphasized in each medium? What does the different emphasis reveal about the authors position and purpose? What is the effect of the different elements emphasized? a co-worker is to employee as a (n) is to a (n) What are the benefits brought by technology and explain why is it beneficial in the field of healthcare? A computer is performing a binary search on a sorted list of 20 items. What is the maximum number of steps it needs to find the item? the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25 Work out the equation of the line shownbelow.Give your answer in the form y = mx + c,where m and c are integers or fractions intheir simplest forms.Y-160-140--120--100-80-60-40-20--80 -70 -60 -50 -40 -30 -20 -10 0-20--40--60-80--100-120--140---160-10 20 30 40 50 60 70 80 x A 2kg block is attached to a spring for which k=200N/m, it is hold at an extension of 5cm and then released at t=0. Find the displacement as a function of time. The velocity , acceleration and total energy when x=+_ A/2. the lowest prices. the most product options. the fewest product options. superior value for the price. the bloch sphere geometric representation of a quantum state is parameterized by two angles and such that . what are the values of the angles and for the state Evaluate the expression for x = -8.x = 16, and x = 4.X 4 which nursing action is appropriate when providing care to a patient who experiences apiration because of enteral feedings A. I hiked on mountain paths, biked on wooded trails, and kayaked on clear ponds.B. These drones can soar, swoop, hover, and even make the buzzing sound of a housefly.C. Mr. Patel improves our school every day by teaching his classes well, he coaches his team well, he even gives personal advice and counseling to students who need it.D. We are kinder, more thoughtful, more conscientious, better students. The first category of evaluation and management codes is? Which of these is a new form of payment that has been recently accepted in some companies?A. CashB. CheckC. Credit CardD. Cryptocurrency 9800 workers in Arizona retired in 2010 as compared to 23,430 in 2009. What is the absolutechange in the number of workers that retired? evaluating a company's performance not only by its ability to generate economic profits but also by its impact on people and the planet. Triple bottom line