Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

Answer 1

The dark organelles labelled E is called the Ribosomes.    

Answer 2
The answer is Ribosomes

Related Questions

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the likelihood that an organism could become extinct. Which of the following could also increase an organism's chances of extinction? A. an increase in predation, competition, and/or disease B. a lack of genetic diversity in an organism's species C. the inability to reproduce D. all of these

Answers

Answer:

D

Explanation:

all of those are likely to increase an organisms chances of extinction

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

The opposable thumb is a trait that connects us to other primates; allowing us to grab and use tools and increasing chances for survival. This means it is a(n) __________.

Answers

Answer:

The options to this question are;

A. genotype

B. adaptation

C. selective pressure

D. stabilizing pressure

The answer is B) Adaptation

Explanation:

Adaptation is the process whereby an organism becomes well suited to survive in its natural environment, which is aided by the possession of certain traits called adaptive features. For example, the fins of a fish makes it fit to survive in an aquatic environment, likewise the opposable thumbs of humans make us well suited to survive in our environment.

As stated in the question, the opposable thumb i.e. movement of the thumb independently of the other four fingers, is a characteristics of primates. This unique feature (opposable thumb) allows us to grab things, get a good grasp of tools, use tools effectively, write things, etc. All these ability due to the possession of opposable thumb increases our chances of survival. Hence, the possession of opposable thumb is regarded as an ADAPTATION

Which of the following statements is true?

Photosynthesis is a type of homeostasis.
Unicellular organisms have differentiated cells.
Respiration is a type of metabolism.
Multicellular organisms are made of only one cell.

Answers

Answer:

Respiration is a type of metabolism.

Answer:

C. Respiration is a type of metabolism

Explanation:

Both B and D are incorrect because:

Multicelluar organisms have more than one cell; while singlecelled organisims only have one cell.

Also, homeostasis is a natural way an organisms body reacts to different situations, like when you sweat, your body is realising a way to lower the heat in your body. Therfore, A. is also incorrect.

Hope this helped!


Mention the types of bees​

Answers

Answer:

ok thus very good percent few Mohammad khan

-gene 1
-gene 2
-gene 3
How are these three genes related?

Answers

Answer:

Depends on the locations of these gene segment on the chromosome whether it be found on the same or different.

It can either be linked or unlinked.

How do I work this question out I’m struggling

Answers

I think the best thing to do is use a ruler maybe.

Why does the land around a once active coal mine remain barren?
A: Toxic nitrous oxides were released into the soil killing all plants.
B: C: Ozone is formed from hydrocarbons which prevent the growth of plants.
Please don't just take points. Thank you and have a good day

Answers

Hello!!

The answer is A. Toxic nitrous oxides were releassed into the soil killing all plants

Answer:

Empty coal mines are flooded with acid rain so no life forms can survive.

Explanation:

1. Viruses such as avian (bird) flu and swine flu that mutate and can spread from animals to human populations are known as what?
O A. Vectors
O B. Transmuting viruses
O C. Epidemics
O D. Zoonoses

Answers

Answer:

B

Explanation:

they are transmuting viruses

B. Transmuting viruses is the answer

What factor about cellular respiration are you testing? ( what makes the three bottles different?)

Answers

Answer:

Gas.

Explanation:

Gas which is present makes the three bottles different from one another. There are three factors which is used for testing of cellular respiration such as amount of oxygen consumed during this process, amount of glucose used and amount of carbondioxide produced during cellular respiration. During cellular respiration, oxygen used in order to break down glucose and releases high amount of energy with the waste materials such as carbondioxide gas.

if you think about fat as old stuff,what new stuff can be made from it

Answers

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

Fat is derived from plant and animal sources. They include seeds, fruits, fatty fish.

Fats serve as a source of energy in organisms and also serve as insulation.

If you think about fat as old stuff,what new stuff can be made from it means of the things fats can be made from and they include Paints, Lubricants, Biofuel, Face cream, Soap etc. These products are manufactured in industries on a large scale due to their high demand.

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

john is testing the effect of temperature on the solubility of sugar in water

Answers

Answer:

As John is testing the effect of temperature on the solubility of sugar in water. To test this, he will measure the amount of sugar dissolved at different temperature level.

A possible answer to a scientific question that can be tested is a

Answers

The key to a good and manageable investigation is to choose a topic of interest, then ask what is called a “testable question.” Testable questions are those that can be answered through hands-on investigation by the student.

1. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. A phylogenetic tree containing two main branches for evolutionary relationships among the animals.
B. The first branch leads to Drosophila.
C. The second branch divides into two branches, 2a and 2b. Branch 2a leads to Lancelet.
D. Branch 2b divides into two branches: 3a and 3b. Branch 3a leads to Zebrafish.
E. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Frog.
F. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Chicken.
G. Branch 5b divides into two branches leading to Human and Mouse, respectively.
2. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.
B. The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.
C. A frog is the ancestor of both a mouse and a chicken.

Answers

The figure shows a tree diagram with two main branches. The first branch leads to Drosophila. The second branch divides into two branches 3a and 3b. Branch 3a leads to Lancelet. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Zebrafish. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Frog. Branch 5b divides into two branches: 6a and 6b. Branch 6a leads to Chicken. Branch 6b divides into two branches leading to Human and Mouse, respectively.

This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.

The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

A frog is the ancestor of both a mouse and a chicken.

The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.

Answer:

The answer is below

Explanation:

Given the information above, and from the available pictures which showed the detailed analysis of the information presented in the question. It can be concluded that, the nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

Hence, the right answer is option B.

Why is it necessary to separate oxgynated blood and deoxgynated blood in living organisums?

Answers

Answer:

For efficient transportation of blood.

Explanation:

What can you learn about by studying DNA?

Answers

Answer:

Explanation:

                  The study of human DNA and genetics can be intellectually fascinating, but it also has plenty of practical applications. From the use of DNA in court cases to the discovery of new therapies for genetic diseases, a thorough understanding of the human genome can have important medical, social and legal impacts.

A molecule will become an ion when which of the following happens?

Answers

Loses or gains a charge

Which of the following are all examples of pollution
Pesticide Run-off
Desertification
Global Warming
Poaching
Burning of Fossil Fuels

Answers

Burning fossil fuels

Name 2 features/tools in Drive that makes it easy to collaborate on assignments?

Answers

1. Live action
It shows what people are editing on your assignment so that you know what they have changed on it
2. Comments
When people have a suggestion, all they simply do is comment
Hope this helped! If it did, please mark as brainiest!

how does the cell wall contributes towards maintaining homeostasis in the cell​

Answers

Answer:

The water wants to flow from the higher concentration, which is outside of the cell, to the lower concentration, which is inside of the cell. The cell membrane helps to regulate and slow down the flow of water into the cell. This is yet another way that the cell membrane helps maintain homeostasis.

I hope it helps ❤️

HELP
In humans, ventilation, digestion, and blood flow are important biological processes. Explain the relationship between the structure of tissues or organs and one of these processes.

Answers

Answer:

I am assuming the question is asking how do the processes relate to one another.

Explanation:

Ventilation happens in the lungs, where carbon dioxide and oxygen are exchanged in the alveoli. This is done via cappilaries that surround the alveoli. Cappilaries are small blood vessels, which are collecitelvy part of the blood flow system (circulation) of the body. In reguards to the digestion, there are capillaries in the vili (which are tiny finger-like structures) so that they can pick up the nutrients during digestion. Another way blood flow and digestion are connected is because the stomach is a muscle, thus is moves and requires energy. That energy comes from the oxygen and nutrients that is supplied by the blood. These are just some examples.

Help!!!
I'll give brainliest the brainliest. ​

Answers

Answer:

resists the turgor  pressure of the cell:  A : cell wall

controls the activities of  the cell : C : nucleus

site of the chemical  reactions of the cell  including synthesis of  proteins:  D : cytoplasm

Answer:

1. A -  Cell Wall

2. C - Nucleus

3. B. Mitochondria

Give brainliest

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

Protects the cell and controls what enters and leaves the cell

Answers

Answer:

- Endoplastic reticulum

-cell membrane

-ribosomes

-mithocondrion

^ all the ansers

Explanation:

Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

What is Cell Membrane?

The cell membrane is also called the plasma membrane. It is composed of a semipermeable lipid bilayer that regulates the transport of materials into and out of the cell. It protects the cell and provides a stable environment within the cell, and this membrane serves many functions.

The main function of the cell membrane is to transport nutrients into the cell, while another is to remove toxins from the cell. Cellular membranes are composed of glycerophospholipids, which are molecules composed of glycerol, a phosphate group, and two fatty acid chains.

Thus, Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

Learn more about Cell Membrane, here:

https://brainly.com/question/11906743

#SPJ2

Your question is incomplete, most probably complete question is:

_____Protects the cell and controls what enters and leaves the cell

A) cell wall

B) lysosomes

C)cell membrane

D)Vacuole

carbohydrate are store in animal cell in the form of​

Answers

Answer:

molecule glycogen

Plants store carbohydrates in long polysaccharides chains called starch, while animals store carbohydrates as the molecule glycogen.

Glycogen molecule, which is found in the cytosol of the cell

why is it necessary yo separate oxgynated and deoxgynated blood in livng oranisum

Answers

Explanation:

it is necessary in mammals and birds to separate oxygenated and deoxygenated blood because this makes their circulatory system more efficient and helps in maintaining a constant body temperature

When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. glycolysis; dihydroxyacetone phosphate the electron transport system; coenzyme Q glycolysis; fructose-6-phosphate the citric acid cycle; pyruvate the citric acid cycle; acetyl CoA

Answers

Answer:

 glycolysis; dihydroxyacetone phosphate

When fats are used as an energy source, the glycerol portion enters the glycolysis when it has been converted to dihydroxyacetone phosphate. Thus, the correct option is A.

What is the Glycolysis?

Glycolysis may be defined as the process in which glucose (sugar) is partially broken down by cells in enzyme reactions that do not need oxygen.

In order to obtain energy from fats, triglycerides must be broken down into fatty acids and glycerol through hydrolysis. The fatty acids enter to Krebs cycle and are converted into acetyl CoA.

While the glycerol portion enters into glycolysis and is converted into dihydroxyacetone phosphate.

Therefore, the correct option for this question is A.

To learn more about Glycolysis, refer to the link:

https://brainly.com/question/737320

#SPJ2

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA
Other Questions
n at least one hundred words, explain how Shirley Jackson uses symbolism to express a theme in her short story The Lottery. Use evidence from the story to support your answer. Please help. Ill mark you as brainliest if correct! New technology inallows producers to use materials from all over the world to manufacture goods. Help me please.. The 4th term of an exponential sequence is 108 and the common ratio is 3. Calculate the value of the eighth term of the sequence. four examples of primary sources of Mention population They are Find the measure of of RA. A. 24 B. 2 C. 12 D. 3 3. What is the type of government in which rulers are not responsible for the will of the people? I got dictatorship. A. What are the two types? Explain the differences of each. I. II. Which two-dimensional shape is formed if a plane intersects the cylinder shown,perpendicular to the base?A) CircleB) SquareC) RectangleD) Ellipse please help me!simplify Excellent Manufacturers Inc. has a current production level of 20,000 units per month. Unit costs at this level are: Direct materials $0.26 Direct labor 0.40 Variable overhead 0.16 Fixed overhead 0.21 Marketing fixed 0.25 Marketing/distribution variable 0.42 Current monthly sales are 18,000 units. Jax Company has contacted Excellent about purchasing 1,550 units at $2.00 each. Current sales would NOT be affected by the onetimeonly special order, and variable marketing/distribution costs would NOT be incurred on the special order. What is Ratzlaff Company's change in operating profits if the special order is accepted? Two long straight wires carry currents perpendicular to the xy plane. One carries a current of 50 A and passes through the point x = 5.0 cm on the x axis. The second wire has a current of 80 A and passes through the point y = 4.0 cm on the y axis. What is the magnitude of the resulting magnetic field at the origin? 2. What is the volume of the regular pyramid to the nearest whole number?14 cm12 cm A standard deck of cards contains 52 cards. One card is randomly selected from the deck: Compute the probability of randomly selecting a queen or club from a deck of cards. If x represents the rate that Joy traveled at for the first half of the trip, write anexpression that represents the amount of time it takes Joy to complete the second half of thetrip at the slower rate. WILL MARK BRAINLIEST !! find the coordinates F after a dilation about the origin of 2.5 write your answer in AB form Activities that involve the production or purchase of merchandise and the sale of goods and services to customers, including expenditures related to administering the business, are classified as: Multiple Choice Financing activities. Investing activities. Help please all questions. Given the function f(x) = -2c+cx-x^2, and f^-1(5) = -1, find c Match each practice of the Agricultural Revolution with its description.