Differentiate between sub-cellular and acellular particles with examples

Answers

Answer 1

Answer:

Explanation:

Sub-cellular particles are particles smaller than the living cell and are found suspended in the cytosol (of a cell) like the nucleus, golgi complex and the mitochondria.

While acellular particles/organisms are particles that do not have a cell like the virsues, viroids and prions. They are not alive/inactive outside a living environment but become active immediately they are inside a living environment (like a cell).

Answer 2

Sub-cellular particles are structures that are found within a cell. These structures perform specific functions and are essential for the cell to carry out its biological processes.

Examples of sub-cellular particles include organelles such as the nucleus, mitochondria, endoplasmic reticulum, Golgi apparatus, and lysosomes. These structures are composed of both proteins and lipids and are enclosed by a membrane.

Acellular particles, on the other hand, are particles that do not possess a cellular structure and are not alive. These particles are much smaller than cells and are unable to carry out any metabolic processes.

Examples of acellular particles include viruses, prions, and viroids. These particles are composed of either DNA or RNA and can replicate themselves only within a host cell. They do not have their own metabolism and rely on the host cell for replication and survival.

To learn more about particles, refer below:

https://brainly.com/question/13874021

#SPJ11


Related Questions

latex from _______ is the source of biodiesel
A. Jatropa
B. Tulasi
C. Neem
D. Cactus​

Answers

Latex from cactus is the source of biodiesel.

What factor about cellular respiration are you testing? ( what makes the three bottles different?)

Answers

Answer:

Gas.

Explanation:

Gas which is present makes the three bottles different from one another. There are three factors which is used for testing of cellular respiration such as amount of oxygen consumed during this process, amount of glucose used and amount of carbondioxide produced during cellular respiration. During cellular respiration, oxygen used in order to break down glucose and releases high amount of energy with the waste materials such as carbondioxide gas.

If capeland switches from producing 0 watermelons to producing 18 million tons of watermelons, what does it give up?

Answers

Answer:

Attached to this solution is an image of the complete question and data.

The correct answer is:

6 million pairs of shoes

Explanation:

From the diagram attached to this answer, the following data can be gotten:

Watermelons                   shoes

(Millions of tonnes)          (Millions of pairs)

0                                        15

8                                        14

14                                       12

18                                       9

20                                      5

21                                       0

From the pattern of the data shown above, we notice that as the production of one commodity increases, the other is given up (decreases)

Therefore, to find how much shoes are given up if Capeland switches from 0 watermelons to 18 million tons of watermelon, we will find the difference between the number of shoes produced at 0 and at 18 million tons of watermelon

at 0 watermelon; shoes = 15 million pairs

at 18 million tons of watermelon; shoes = 9 million pairs

Therefore, number of shoes given up = 15 - 9 = 6 million pairs

Hence, 6 million pairs of shoes are given up tp increase production of watermelon from 0 to 18 million tons

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

how does the cell wall contributes towards maintaining homeostasis in the cell​

Answers

Answer:

The water wants to flow from the higher concentration, which is outside of the cell, to the lower concentration, which is inside of the cell. The cell membrane helps to regulate and slow down the flow of water into the cell. This is yet another way that the cell membrane helps maintain homeostasis.

I hope it helps ❤️

how can new stuff be made from old stuff

Answers

Answer:

BUY A NEW ONE

clean it

or sell it , with the money you sold the item use that money to buy a new one

Explanation:

Answer:

That is called upcycling. IKEA has started doing that with their products

Explanation:

Name 2 features/tools in Drive that makes it easy to collaborate on assignments?

Answers

1. Live action
It shows what people are editing on your assignment so that you know what they have changed on it
2. Comments
When people have a suggestion, all they simply do is comment
Hope this helped! If it did, please mark as brainiest!

Which best describes food when it reaches the stomach?

Answers

Explanation:

The polysaccharides have been broken down.

Which of the following are all examples of pollution
Pesticide Run-off
Desertification
Global Warming
Poaching
Burning of Fossil Fuels

Answers

Burning fossil fuels

3.
Read this sentence from the passage.
The tortoises which live on those
islands where there is no water,
or in the lower, arid parts of
the others, feed mainly on the
succulent cactus.
The word succulent MOST LIKELY
means
A. dried out.
B. chunky.
C. moist.
D. tough.

Answers

i think it’s C because cactuses store water in them, and also it mentions that the tortoises live in dry areas so it makes sense that they’re feeding on cactuses to get some water


Mention the types of bees​

Answers

Answer:

ok thus very good percent few Mohammad khan

The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the likelihood that an organism could become extinct. Which of the following could also increase an organism's chances of extinction? A. an increase in predation, competition, and/or disease B. a lack of genetic diversity in an organism's species C. the inability to reproduce D. all of these

Answers

Answer:

D

Explanation:

all of those are likely to increase an organisms chances of extinction

Why does the land around a once active coal mine remain barren?
A: Toxic nitrous oxides were released into the soil killing all plants.
B: C: Ozone is formed from hydrocarbons which prevent the growth of plants.
Please don't just take points. Thank you and have a good day

Answers

Hello!!

The answer is A. Toxic nitrous oxides were releassed into the soil killing all plants

Answer:

Empty coal mines are flooded with acid rain so no life forms can survive.

Explanation:

carbohydrate are store in animal cell in the form of​

Answers

Answer:

molecule glycogen

Plants store carbohydrates in long polysaccharides chains called starch, while animals store carbohydrates as the molecule glycogen.

Glycogen molecule, which is found in the cytosol of the cell

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

When you centrifuge the DNA isolated from the bacteria, the DNA separates into two classes. One class of labeled DNA includes very large molecules (thousands or even millions of nucleotides long), and the other includes short stretches of DNA (several hundred to a few thousand nucleotides in length). Which two classes of DNA do these different samples represent

Answers

Answer:

Leading strand and Okazaki fragments

Explanation:

The two classes of DNA that the different samples represent include the leading strand and the Okazaki fragments.

The large molecules DNA with thousands/millions of nucleotides constitutes the leading strand of the DNA while the short stretches of DNA with just a few thousand nucleotides in light constitute the Okazaki fragments.

This is because, during replication, the leading strands of DNAs are usually synthesized in a continuous manner and end up forming a long, continuous daughter strand while the lagging strands are usually synthesized in short, discontinuous fragments known as the Okazaki fragments.

The continuous/discontinuous replication of the leading/lagging strands of the DNA is due to the characteristics of the enzyme responsible for adding bases to the growing daughter strands. The DNA polymerase enzyme can only add nucleotides in the 5' to ' direction.

A possible answer to a scientific question that can be tested is a

Answers

The key to a good and manageable investigation is to choose a topic of interest, then ask what is called a “testable question.” Testable questions are those that can be answered through hands-on investigation by the student.

Adequate food safety practices lead to less: A:Food waste B:Insurance costs C:Hospitalizations D:Training

Answers

The answer to this question is HOSPITALIZATIONS

Food is very important as it is contains the source of energy. However, food can easily be contaminated majorly by MICROORGANISMS, hence, the reason they must be well kept and preserved. Every individual should oblige by the safety rules that guide handling of food (cooked or raw).

Some of the safety rules include;

* Proper washing of hands before and after cooking* Cook food thoroughly* Separate cooked and raw food* Keep food at safe temperatures etc.

Therefore, adequate food safety practices will help reduce HOSPITALIZATIONS caused by disease causing agents.

Learn more at: https://brainly.com/question/14608053

Hospitalizations will be less if adequate food safety practices are adopted.

Adequate food safety practices lead to less hospitalizations in the society because most people hospitalize due to bad food habits and food poisoning. If we implement safety measures related to food then we can save ourselves from various diseases as well as prevent ourselves from going to the hospital so in my opinion hospitalizations will be less if sufficient food safety measures are adopted by the people.

Learn more: https://brainly.com/question/17155329

Which of the following statements is true?

Photosynthesis is a type of homeostasis.
Unicellular organisms have differentiated cells.
Respiration is a type of metabolism.
Multicellular organisms are made of only one cell.

Answers

Answer:

Respiration is a type of metabolism.

Answer:

C. Respiration is a type of metabolism

Explanation:

Both B and D are incorrect because:

Multicelluar organisms have more than one cell; while singlecelled organisims only have one cell.

Also, homeostasis is a natural way an organisms body reacts to different situations, like when you sweat, your body is realising a way to lower the heat in your body. Therfore, A. is also incorrect.

Hope this helped!

Helpppppp!!!
Which of the following is an example of a hormone?

Adrenaline
Blood
Calcium
Thyroid

Answers

I believe the answer is adrenaline, the rest just dont make sense

Answer:

Adrenaline is an example of a hormone. Hormones are chemical messengers in your body, which carry around messages. Adrenaline is a hormone that is released when you are in fear, stress, or doing something dangerous.

Let me know if this helps!

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

Help!!!
I'll give brainliest the brainliest. ​

Answers

Answer:

resists the turgor  pressure of the cell:  A : cell wall

controls the activities of  the cell : C : nucleus

site of the chemical  reactions of the cell  including synthesis of  proteins:  D : cytoplasm

Answer:

1. A -  Cell Wall

2. C - Nucleus

3. B. Mitochondria

Give brainliest

When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. glycolysis; dihydroxyacetone phosphate the electron transport system; coenzyme Q glycolysis; fructose-6-phosphate the citric acid cycle; pyruvate the citric acid cycle; acetyl CoA

Answers

Answer:

 glycolysis; dihydroxyacetone phosphate

When fats are used as an energy source, the glycerol portion enters the glycolysis when it has been converted to dihydroxyacetone phosphate. Thus, the correct option is A.

What is the Glycolysis?

Glycolysis may be defined as the process in which glucose (sugar) is partially broken down by cells in enzyme reactions that do not need oxygen.

In order to obtain energy from fats, triglycerides must be broken down into fatty acids and glycerol through hydrolysis. The fatty acids enter to Krebs cycle and are converted into acetyl CoA.

While the glycerol portion enters into glycolysis and is converted into dihydroxyacetone phosphate.

Therefore, the correct option for this question is A.

To learn more about Glycolysis, refer to the link:

https://brainly.com/question/737320

#SPJ2

The opposable thumb is a trait that connects us to other primates; allowing us to grab and use tools and increasing chances for survival. This means it is a(n) __________.

Answers

Answer:

The options to this question are;

A. genotype

B. adaptation

C. selective pressure

D. stabilizing pressure

The answer is B) Adaptation

Explanation:

Adaptation is the process whereby an organism becomes well suited to survive in its natural environment, which is aided by the possession of certain traits called adaptive features. For example, the fins of a fish makes it fit to survive in an aquatic environment, likewise the opposable thumbs of humans make us well suited to survive in our environment.

As stated in the question, the opposable thumb i.e. movement of the thumb independently of the other four fingers, is a characteristics of primates. This unique feature (opposable thumb) allows us to grab things, get a good grasp of tools, use tools effectively, write things, etc. All these ability due to the possession of opposable thumb increases our chances of survival. Hence, the possession of opposable thumb is regarded as an ADAPTATION

How do I work this question out I’m struggling

Answers

I think the best thing to do is use a ruler maybe.

answer answer answer answer

Answers

Answer: C

Explanation: Amoeba use pseudopods to move around and people use feet to move.

Answer:

The answer is C

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

HELP
In humans, ventilation, digestion, and blood flow are important biological processes. Explain the relationship between the structure of tissues or organs and one of these processes.

Answers

Answer:

I am assuming the question is asking how do the processes relate to one another.

Explanation:

Ventilation happens in the lungs, where carbon dioxide and oxygen are exchanged in the alveoli. This is done via cappilaries that surround the alveoli. Cappilaries are small blood vessels, which are collecitelvy part of the blood flow system (circulation) of the body. In reguards to the digestion, there are capillaries in the vili (which are tiny finger-like structures) so that they can pick up the nutrients during digestion. Another way blood flow and digestion are connected is because the stomach is a muscle, thus is moves and requires energy. That energy comes from the oxygen and nutrients that is supplied by the blood. These are just some examples.

Detectives work in three different locations when processing evidence. Which is the correct order for the locations of processing evidence? a. in the forensic lab, analyzing evidence b. in the court, testifying about their findings c. at the crime scene, collecting evidence 1. a, b, c 2. b, c, a 3. c, b, a 4. c, a, b

Answers

Answer:

The correct order is option 4. c, a, b.

Explanation:

Evidence collection and processing involves three different locations and this processing and analyzing is done by the detectives. The first location is the crime scene at which detectives collect the evidences such as photographs, blood traces and samples, fingerprint and other physical evidences without manipulating them.

Second location of processing evidences is at forensic lab at which the evidences are thoroughly tested and analyzed and match with prior records. The final location is in the court house where all the evidences and finding about them are testified.

Thus, the correct order is : option 4. c, a, b.

Protects the cell and controls what enters and leaves the cell

Answers

Answer:

- Endoplastic reticulum

-cell membrane

-ribosomes

-mithocondrion

^ all the ansers

Explanation:

Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

What is Cell Membrane?

The cell membrane is also called the plasma membrane. It is composed of a semipermeable lipid bilayer that regulates the transport of materials into and out of the cell. It protects the cell and provides a stable environment within the cell, and this membrane serves many functions.

The main function of the cell membrane is to transport nutrients into the cell, while another is to remove toxins from the cell. Cellular membranes are composed of glycerophospholipids, which are molecules composed of glycerol, a phosphate group, and two fatty acid chains.

Thus, Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

Learn more about Cell Membrane, here:

https://brainly.com/question/11906743

#SPJ2

Your question is incomplete, most probably complete question is:

_____Protects the cell and controls what enters and leaves the cell

A) cell wall

B) lysosomes

C)cell membrane

D)Vacuole

Other Questions
What factors spurred industrial growth in the late 1800s? Why Bengali are called mixed origin- Explain with your logic This cylinder has a radius of 4 feet and a volume of 2087 cubic feet.What is the height of the cylinder? Transactions that do not involve the original issue of securities take place in _________. A. primary markets B. secondary markets C. over-the-counter markets D. institutional markets find the series in which5th term is 22/16 and 4th term is -4 Which of d earth subsystem would most likely be directly affected by d mining d deep ocean floor for gas hydrates? Choose all that apply. A) atmosphere B) hydrosphere C) all of the above D) biosphere Simplify -(7/x-2)+(2x/x) Simplify your answer as much possible jim buys a calculator that is marked 30% off. If he paid $35, what was the original price? Express in standard form : a) 0.000000056 b) 56780000000 c) 1923.8 (will mark brainly The distance a race car travels is given by the equation, [tex]d=v_{0} t+\frac{1}{2} at^{2}[/tex], where [tex]v_{0}[/tex] is the initial speed of the race car, a is the acceleration and t is the time traveled. Near the beginning of a race, the driver accelerates for 9 seconds at a rate of [tex]4m/s^{2}[/tex]. The driver's initial speed was 75 m/s.Find the driver's average speed during the acceleration. Suppose today you enter a forward contract to buy 1 share of ADM stock in 1 year at a forward price of $30, and today you also buy 1-year Treasury bills with a face value of $30. ADM is not expected to pay a dividend in the next 1 year. Your position has the same payoff in 1 year as: Write a letter to your friend in another school telling him to relocate to your school and give him give reasons why he should come a cone with base radius 7 cm has a volume of 308 cm cube find the vertical height of the cone take 22/7pls now Describe the basic platform of any US political party outside of Democrats and Republicans. Please help me! I will give brainly!Example: To do the answer draw on my screenshot. So then you can make the dots. A man is overweight and wants to improve his cardiovascular endurance.Why is this important to his health?It can help the man raise his LDL cholesterol and lower his cardiac output. It can help the man lose weight and reduce the risk of cardiovascular disease.It can help the man lower his VO2 max and his anaerobic threshold. describe the concept of development in brief One-quarter of the top of a round wedding cake is covered in yellow roses. The top of the wedding cake has a diameter of 12 inches. Each yellow rose covers an area of 0.75 square inch. About how many roses were used to cover this section of the cake?PLZ ANSWER QUICKLY AND ACCURATLY WILL MARK BRAINLIEST imagine ur the secretary of the astronomical society of ur school. as a project you decide to visit the planetarium with the all members in society next week.write a letter to the manager of the planetarium asking for permission to make this visit. QlaWhat are the activities a Database Designer will do if using the SDLC to design a Database [10]Q1bList the five main components of Access Database and state their uses [10]