Glaucoma is a leading cause of blindness. Studies have linked a common form of glaucoma to three genes and more than 20 genetic loci. Which best describes glaucoma? a recessive trait that requires multiple recessive alleles to be expressed a polygenic trait that is influenced by the alleles of several genes a codominant trait that is expressed more often when more dominant alleles are present a dominant trait that depends on the presence of only one of many dominant alleles

Answers

Answer 1

Answer:

Question

Glaucoma is a leading cause of blindness. Studies have linked a common form of glaucoma to three genes and more than 20 genetic loci. Which best describes glaucoma?

Answer

(A) - a recessive trait that requires multiple recessive alleles to be expressed

Explanation:

Answer 2

Glaucoma is a polygenic trait influenced by the alleles of several genes.

Polygenic phenotypic traits are those influenced by many genes, which interact to shape the phenotype.

Polygenic traits exhibit a bell-shaped distribution in a population (i.e. they have a continuous distribution).

Some examples of polygenic traits include, among others, height, body shape, skin color, weight, etc.

A polygenic trait that is also affected by environmental factors is known as a multifactorial trait.

In conclusion, glaucoma is a polygenic trait that is influenced by the alleles of several genes.

Learn more in:

https://brainly.com/question/1430191


Related Questions

Name 2 features/tools in Drive that makes it easy to collaborate on assignments?

Answers

1. Live action
It shows what people are editing on your assignment so that you know what they have changed on it
2. Comments
When people have a suggestion, all they simply do is comment
Hope this helped! If it did, please mark as brainiest!

Why does the land around a once active coal mine remain barren?
A: Toxic nitrous oxides were released into the soil killing all plants.
B: C: Ozone is formed from hydrocarbons which prevent the growth of plants.
Please don't just take points. Thank you and have a good day

Answers

Hello!!

The answer is A. Toxic nitrous oxides were releassed into the soil killing all plants

Answer:

Empty coal mines are flooded with acid rain so no life forms can survive.

Explanation:

If capeland switches from producing 0 watermelons to producing 18 million tons of watermelons, what does it give up?

Answers

Answer:

Attached to this solution is an image of the complete question and data.

The correct answer is:

6 million pairs of shoes

Explanation:

From the diagram attached to this answer, the following data can be gotten:

Watermelons                   shoes

(Millions of tonnes)          (Millions of pairs)

0                                        15

8                                        14

14                                       12

18                                       9

20                                      5

21                                       0

From the pattern of the data shown above, we notice that as the production of one commodity increases, the other is given up (decreases)

Therefore, to find how much shoes are given up if Capeland switches from 0 watermelons to 18 million tons of watermelon, we will find the difference between the number of shoes produced at 0 and at 18 million tons of watermelon

at 0 watermelon; shoes = 15 million pairs

at 18 million tons of watermelon; shoes = 9 million pairs

Therefore, number of shoes given up = 15 - 9 = 6 million pairs

Hence, 6 million pairs of shoes are given up tp increase production of watermelon from 0 to 18 million tons

carbohydrate are store in animal cell in the form of​

Answers

Answer:

molecule glycogen

Plants store carbohydrates in long polysaccharides chains called starch, while animals store carbohydrates as the molecule glycogen.

Glycogen molecule, which is found in the cytosol of the cell

Help!!!
I'll give brainliest the brainliest. ​

Answers

Answer:

resists the turgor  pressure of the cell:  A : cell wall

controls the activities of  the cell : C : nucleus

site of the chemical  reactions of the cell  including synthesis of  proteins:  D : cytoplasm

Answer:

1. A -  Cell Wall

2. C - Nucleus

3. B. Mitochondria

Give brainliest

Which of the following statements is true?

Photosynthesis is a type of homeostasis.
Unicellular organisms have differentiated cells.
Respiration is a type of metabolism.
Multicellular organisms are made of only one cell.

Answers

Answer:

Respiration is a type of metabolism.

Answer:

C. Respiration is a type of metabolism

Explanation:

Both B and D are incorrect because:

Multicelluar organisms have more than one cell; while singlecelled organisims only have one cell.

Also, homeostasis is a natural way an organisms body reacts to different situations, like when you sweat, your body is realising a way to lower the heat in your body. Therfore, A. is also incorrect.

Hope this helped!

latex from _______ is the source of biodiesel
A. Jatropa
B. Tulasi
C. Neem
D. Cactus​

Answers

Latex from cactus is the source of biodiesel.

HELP
In humans, ventilation, digestion, and blood flow are important biological processes. Explain the relationship between the structure of tissues or organs and one of these processes.

Answers

Answer:

I am assuming the question is asking how do the processes relate to one another.

Explanation:

Ventilation happens in the lungs, where carbon dioxide and oxygen are exchanged in the alveoli. This is done via cappilaries that surround the alveoli. Cappilaries are small blood vessels, which are collecitelvy part of the blood flow system (circulation) of the body. In reguards to the digestion, there are capillaries in the vili (which are tiny finger-like structures) so that they can pick up the nutrients during digestion. Another way blood flow and digestion are connected is because the stomach is a muscle, thus is moves and requires energy. That energy comes from the oxygen and nutrients that is supplied by the blood. These are just some examples.

What factor about cellular respiration are you testing? ( what makes the three bottles different?)

Answers

Answer:

Gas.

Explanation:

Gas which is present makes the three bottles different from one another. There are three factors which is used for testing of cellular respiration such as amount of oxygen consumed during this process, amount of glucose used and amount of carbondioxide produced during cellular respiration. During cellular respiration, oxygen used in order to break down glucose and releases high amount of energy with the waste materials such as carbondioxide gas.

3.
Read this sentence from the passage.
The tortoises which live on those
islands where there is no water,
or in the lower, arid parts of
the others, feed mainly on the
succulent cactus.
The word succulent MOST LIKELY
means
A. dried out.
B. chunky.
C. moist.
D. tough.

Answers

i think it’s C because cactuses store water in them, and also it mentions that the tortoises live in dry areas so it makes sense that they’re feeding on cactuses to get some water

how can new stuff be made from old stuff

Answers

Answer:

BUY A NEW ONE

clean it

or sell it , with the money you sold the item use that money to buy a new one

Explanation:

Answer:

That is called upcycling. IKEA has started doing that with their products

Explanation:

Which of the following are all examples of pollution
Pesticide Run-off
Desertification
Global Warming
Poaching
Burning of Fossil Fuels

Answers

Burning fossil fuels

A possible answer to a scientific question that can be tested is a

Answers

The key to a good and manageable investigation is to choose a topic of interest, then ask what is called a “testable question.” Testable questions are those that can be answered through hands-on investigation by the student.

The opposable thumb is a trait that connects us to other primates; allowing us to grab and use tools and increasing chances for survival. This means it is a(n) __________.

Answers

Answer:

The options to this question are;

A. genotype

B. adaptation

C. selective pressure

D. stabilizing pressure

The answer is B) Adaptation

Explanation:

Adaptation is the process whereby an organism becomes well suited to survive in its natural environment, which is aided by the possession of certain traits called adaptive features. For example, the fins of a fish makes it fit to survive in an aquatic environment, likewise the opposable thumbs of humans make us well suited to survive in our environment.

As stated in the question, the opposable thumb i.e. movement of the thumb independently of the other four fingers, is a characteristics of primates. This unique feature (opposable thumb) allows us to grab things, get a good grasp of tools, use tools effectively, write things, etc. All these ability due to the possession of opposable thumb increases our chances of survival. Hence, the possession of opposable thumb is regarded as an ADAPTATION

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

1. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. A phylogenetic tree containing two main branches for evolutionary relationships among the animals.
B. The first branch leads to Drosophila.
C. The second branch divides into two branches, 2a and 2b. Branch 2a leads to Lancelet.
D. Branch 2b divides into two branches: 3a and 3b. Branch 3a leads to Zebrafish.
E. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Frog.
F. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Chicken.
G. Branch 5b divides into two branches leading to Human and Mouse, respectively.
2. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.
B. The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.
C. A frog is the ancestor of both a mouse and a chicken.

Answers

The figure shows a tree diagram with two main branches. The first branch leads to Drosophila. The second branch divides into two branches 3a and 3b. Branch 3a leads to Lancelet. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Zebrafish. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Frog. Branch 5b divides into two branches: 6a and 6b. Branch 6a leads to Chicken. Branch 6b divides into two branches leading to Human and Mouse, respectively.

This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.

The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

A frog is the ancestor of both a mouse and a chicken.

The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.

Answer:

The answer is below

Explanation:

Given the information above, and from the available pictures which showed the detailed analysis of the information presented in the question. It can be concluded that, the nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

Hence, the right answer is option B.

answer answer answer answer

Answers

Answer: C

Explanation: Amoeba use pseudopods to move around and people use feet to move.

Answer:

The answer is C

Which best describes food when it reaches the stomach?

Answers

Explanation:

The polysaccharides have been broken down.

How do I work this question out I’m struggling

Answers

I think the best thing to do is use a ruler maybe.

Adequate food safety practices lead to less: A:Food waste B:Insurance costs C:Hospitalizations D:Training

Answers

The answer to this question is HOSPITALIZATIONS

Food is very important as it is contains the source of energy. However, food can easily be contaminated majorly by MICROORGANISMS, hence, the reason they must be well kept and preserved. Every individual should oblige by the safety rules that guide handling of food (cooked or raw).

Some of the safety rules include;

* Proper washing of hands before and after cooking* Cook food thoroughly* Separate cooked and raw food* Keep food at safe temperatures etc.

Therefore, adequate food safety practices will help reduce HOSPITALIZATIONS caused by disease causing agents.

Learn more at: https://brainly.com/question/14608053

Hospitalizations will be less if adequate food safety practices are adopted.

Adequate food safety practices lead to less hospitalizations in the society because most people hospitalize due to bad food habits and food poisoning. If we implement safety measures related to food then we can save ourselves from various diseases as well as prevent ourselves from going to the hospital so in my opinion hospitalizations will be less if sufficient food safety measures are adopted by the people.

Learn more: https://brainly.com/question/17155329

When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. glycolysis; dihydroxyacetone phosphate the electron transport system; coenzyme Q glycolysis; fructose-6-phosphate the citric acid cycle; pyruvate the citric acid cycle; acetyl CoA

Answers

Answer:

 glycolysis; dihydroxyacetone phosphate

When fats are used as an energy source, the glycerol portion enters the glycolysis when it has been converted to dihydroxyacetone phosphate. Thus, the correct option is A.

What is the Glycolysis?

Glycolysis may be defined as the process in which glucose (sugar) is partially broken down by cells in enzyme reactions that do not need oxygen.

In order to obtain energy from fats, triglycerides must be broken down into fatty acids and glycerol through hydrolysis. The fatty acids enter to Krebs cycle and are converted into acetyl CoA.

While the glycerol portion enters into glycolysis and is converted into dihydroxyacetone phosphate.

Therefore, the correct option for this question is A.

To learn more about Glycolysis, refer to the link:

https://brainly.com/question/737320

#SPJ2

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

Protects the cell and controls what enters and leaves the cell

Answers

Answer:

- Endoplastic reticulum

-cell membrane

-ribosomes

-mithocondrion

^ all the ansers

Explanation:

Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

What is Cell Membrane?

The cell membrane is also called the plasma membrane. It is composed of a semipermeable lipid bilayer that regulates the transport of materials into and out of the cell. It protects the cell and provides a stable environment within the cell, and this membrane serves many functions.

The main function of the cell membrane is to transport nutrients into the cell, while another is to remove toxins from the cell. Cellular membranes are composed of glycerophospholipids, which are molecules composed of glycerol, a phosphate group, and two fatty acid chains.

Thus, Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

Learn more about Cell Membrane, here:

https://brainly.com/question/11906743

#SPJ2

Your question is incomplete, most probably complete question is:

_____Protects the cell and controls what enters and leaves the cell

A) cell wall

B) lysosomes

C)cell membrane

D)Vacuole

When you centrifuge the DNA isolated from the bacteria, the DNA separates into two classes. One class of labeled DNA includes very large molecules (thousands or even millions of nucleotides long), and the other includes short stretches of DNA (several hundred to a few thousand nucleotides in length). Which two classes of DNA do these different samples represent

Answers

Answer:

Leading strand and Okazaki fragments

Explanation:

The two classes of DNA that the different samples represent include the leading strand and the Okazaki fragments.

The large molecules DNA with thousands/millions of nucleotides constitutes the leading strand of the DNA while the short stretches of DNA with just a few thousand nucleotides in light constitute the Okazaki fragments.

This is because, during replication, the leading strands of DNAs are usually synthesized in a continuous manner and end up forming a long, continuous daughter strand while the lagging strands are usually synthesized in short, discontinuous fragments known as the Okazaki fragments.

The continuous/discontinuous replication of the leading/lagging strands of the DNA is due to the characteristics of the enzyme responsible for adding bases to the growing daughter strands. The DNA polymerase enzyme can only add nucleotides in the 5' to ' direction.

Detectives work in three different locations when processing evidence. Which is the correct order for the locations of processing evidence? a. in the forensic lab, analyzing evidence b. in the court, testifying about their findings c. at the crime scene, collecting evidence 1. a, b, c 2. b, c, a 3. c, b, a 4. c, a, b

Answers

Answer:

The correct order is option 4. c, a, b.

Explanation:

Evidence collection and processing involves three different locations and this processing and analyzing is done by the detectives. The first location is the crime scene at which detectives collect the evidences such as photographs, blood traces and samples, fingerprint and other physical evidences without manipulating them.

Second location of processing evidences is at forensic lab at which the evidences are thoroughly tested and analyzed and match with prior records. The final location is in the court house where all the evidences and finding about them are testified.

Thus, the correct order is : option 4. c, a, b.

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the likelihood that an organism could become extinct. Which of the following could also increase an organism's chances of extinction? A. an increase in predation, competition, and/or disease B. a lack of genetic diversity in an organism's species C. the inability to reproduce D. all of these

Answers

Answer:

D

Explanation:

all of those are likely to increase an organisms chances of extinction

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA


Mention the types of bees​

Answers

Answer:

ok thus very good percent few Mohammad khan

how does the cell wall contributes towards maintaining homeostasis in the cell​

Answers

Answer:

The water wants to flow from the higher concentration, which is outside of the cell, to the lower concentration, which is inside of the cell. The cell membrane helps to regulate and slow down the flow of water into the cell. This is yet another way that the cell membrane helps maintain homeostasis.

I hope it helps ❤️

Other Questions
Mt thang my chuyn ng thng ng hng xung di chm dn u vi gia tc a= -4m/s2. Trn thang my treo mt vt nh bng mt si dy mnh, khong cch t vt ti sn thang my h= 2m. Thang my ang chuyn ng th dy t. Tnh thi gian t lc dy t n khi vt chm sn thang my ? Ly g= 10m/s2 You recently purchased a stock that is expected to earn 19 percent in a booming economy, 14 percent in a normal economy, and lose 3 percent in a recessionary economy. There is 21 percent probability of a boom, 70 percent chance of a normal economy, and 9 percent chance of a recession. What is your expected rate of return on this stock? Simple geometry please helpFind KL. Round to the nearest hundredth. Bonita Industries budgeted manufacturing costs for 65000 tons of steel are: Fixed manufacturing costs$50000 per month Variable manufacturing costs$12 per ton of steel Bonita produced 50000 tons of steel during March. How much is the flexible budget for total manufacturing costs for March Choose three organizations that you believe have had the greatest impact on the current state of safety and health programs in the United States. Summarize the purpose of each organization, and discuss how you believe you can use these organizations to improve your ability to perform your duties as a safety and health professional. how many are 1 raised to 2 ??? Help me figure this out, I dont understand Can I have your number? given m||n find the value of x Ok people listen.........We are just like tacos......We all fall apart every now and then. Which drawing material do you need to fix with varnish to avold smearing once your drawing is complete?pencilO charcoalpen and Inksilverpoint Choose the letter that represents the correct diagram for this sentence. What is your favourite food and Who makes it? The marketing department at Quality Home Improvement Center (QHIC) uses simple linear regression analysis to predict home upkeep expenditure on the basis of home value. Predictions of home upkeep expenditures are used to help determine which homes should be sent advertising brochures promoting QHIC's products and services. Imagine that Eveready has developed solar rechargeable batteries that cost only slightly more to produce than the rechargeable batteries currently available. These solar batteries can be recharged by sunlight up to five times, after which they are to be discarded. Unfortunately, the production process cannot be patented, so competitors could enter the market within a year. Which of the following is the best description of the product life cycle of this product?a. Long, level beginning, and rapid ascentb. High initial sales followed by slow declinec. High introductory sales followed by rapid declined. Rapid growth followed by rapid declinee. Moderately slow introduction, followed by modest growth, gradually leveling off What is the valence of an atom with six electrons in its outer electron shell?A)1B) 2C) 3D) 4E) 5 The graph below shows how solubility changes with temperature.A graph with the horizontal axis showing temperature ranging from 0 to 10 in units of 10 and the vertical axis solubility in grams of salt per 100 grams of water. Several compounds are shown. All data are approximate. The substances and their coordinates are as follows: upper N a upper C l: 0, 38; 10, 38; 20, 38; 30, 38; 40, 39; 50, 39; 60, 39; 70, 40; 80, 40; 90, 40; 100, 40. Upper N a subscript 2 upper H upper A s upper O subscript 4: 0, 5; 10, 18; 20, 28; 30, 39; 40, 49; 60, 65; 80, 82. Upper B a (upper N upper O subscript 3) subscript 2: 0, 5; 10, 8; 30, 12; 40, 15; 50, 18; 60, 20; 80, 28; 100, 33. Upper N a subscript 2 upper S upper O subscript 4: 0, 5; 5, 8; 10, 10; 15, 15; 20, 20; 25, 20; 28, 35; 30, 40; 32, 49; 33, 50; 35, 50; 40, 48; 50, 47; 60, 46; 70, 45; 80, 43; 90, 32; 100, 40. Upper C 3 subscript 2 (upper S upper O subscript 4) subscript 3 dot 9 upper H subscript 2 upper O: 0, 18; 20, 10; 30, 8; 50, 5; 60, 3; 80, 1; 100, 0.How many grams of NaCl will be needed to form 600 mL of a saturated solution at 100C?15 g24 g40 g240 g answer 240g Reaching for your coffee cup is accomplished by the _____ subdivision of the peripheral nervous system. . Which of the following statements is CORRECT? a. It is generally more expensive to form a proprietorship than a corporation because, with a proprietorship, extensive legal documents are required. b. Corporations face fewer regulations than sole proprietorships. c. One disadvantage of operating a business as a sole proprietorship is that the firm is subject to double taxation, at both the firm level and the owner level. d. One advantage of forming a corporation is that equity investors are usually exposed to less liability than in a regular partnership. Which expression is equivalent to x+y+x+y+3(y+5)