how to minimize flood​

Answers

Answer 1

Answer:

some of the ways are...

Explanation:

establishing strong damavoiding construction around water resources properly utilizing and storing rain water for future useflood cannot be stopped totally as it is the effect of nature but its effects can be minimized by using our scientific knowledge and methods

Related Questions

1. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. A phylogenetic tree containing two main branches for evolutionary relationships among the animals.
B. The first branch leads to Drosophila.
C. The second branch divides into two branches, 2a and 2b. Branch 2a leads to Lancelet.
D. Branch 2b divides into two branches: 3a and 3b. Branch 3a leads to Zebrafish.
E. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Frog.
F. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Chicken.
G. Branch 5b divides into two branches leading to Human and Mouse, respectively.
2. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.
B. The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.
C. A frog is the ancestor of both a mouse and a chicken.

Answers

The figure shows a tree diagram with two main branches. The first branch leads to Drosophila. The second branch divides into two branches 3a and 3b. Branch 3a leads to Lancelet. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Zebrafish. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Frog. Branch 5b divides into two branches: 6a and 6b. Branch 6a leads to Chicken. Branch 6b divides into two branches leading to Human and Mouse, respectively.

This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.

The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

A frog is the ancestor of both a mouse and a chicken.

The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.

Answer:

The answer is below

Explanation:

Given the information above, and from the available pictures which showed the detailed analysis of the information presented in the question. It can be concluded that, the nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

Hence, the right answer is option B.

Which of the following are all examples of pollution
Pesticide Run-off
Desertification
Global Warming
Poaching
Burning of Fossil Fuels

Answers

Burning fossil fuels

The opposable thumb is a trait that connects us to other primates; allowing us to grab and use tools and increasing chances for survival. This means it is a(n) __________.

Answers

Answer:

The options to this question are;

A. genotype

B. adaptation

C. selective pressure

D. stabilizing pressure

The answer is B) Adaptation

Explanation:

Adaptation is the process whereby an organism becomes well suited to survive in its natural environment, which is aided by the possession of certain traits called adaptive features. For example, the fins of a fish makes it fit to survive in an aquatic environment, likewise the opposable thumbs of humans make us well suited to survive in our environment.

As stated in the question, the opposable thumb i.e. movement of the thumb independently of the other four fingers, is a characteristics of primates. This unique feature (opposable thumb) allows us to grab things, get a good grasp of tools, use tools effectively, write things, etc. All these ability due to the possession of opposable thumb increases our chances of survival. Hence, the possession of opposable thumb is regarded as an ADAPTATION

Which of the following statements is true?

Photosynthesis is a type of homeostasis.
Unicellular organisms have differentiated cells.
Respiration is a type of metabolism.
Multicellular organisms are made of only one cell.

Answers

Answer:

Respiration is a type of metabolism.

Answer:

C. Respiration is a type of metabolism

Explanation:

Both B and D are incorrect because:

Multicelluar organisms have more than one cell; while singlecelled organisims only have one cell.

Also, homeostasis is a natural way an organisms body reacts to different situations, like when you sweat, your body is realising a way to lower the heat in your body. Therfore, A. is also incorrect.

Hope this helped!

If capeland switches from producing 0 watermelons to producing 18 million tons of watermelons, what does it give up?

Answers

Answer:

Attached to this solution is an image of the complete question and data.

The correct answer is:

6 million pairs of shoes

Explanation:

From the diagram attached to this answer, the following data can be gotten:

Watermelons                   shoes

(Millions of tonnes)          (Millions of pairs)

0                                        15

8                                        14

14                                       12

18                                       9

20                                      5

21                                       0

From the pattern of the data shown above, we notice that as the production of one commodity increases, the other is given up (decreases)

Therefore, to find how much shoes are given up if Capeland switches from 0 watermelons to 18 million tons of watermelon, we will find the difference between the number of shoes produced at 0 and at 18 million tons of watermelon

at 0 watermelon; shoes = 15 million pairs

at 18 million tons of watermelon; shoes = 9 million pairs

Therefore, number of shoes given up = 15 - 9 = 6 million pairs

Hence, 6 million pairs of shoes are given up tp increase production of watermelon from 0 to 18 million tons

3.
Read this sentence from the passage.
The tortoises which live on those
islands where there is no water,
or in the lower, arid parts of
the others, feed mainly on the
succulent cactus.
The word succulent MOST LIKELY
means
A. dried out.
B. chunky.
C. moist.
D. tough.

Answers

i think it’s C because cactuses store water in them, and also it mentions that the tortoises live in dry areas so it makes sense that they’re feeding on cactuses to get some water

how does the cell wall contributes towards maintaining homeostasis in the cell​

Answers

Answer:

The water wants to flow from the higher concentration, which is outside of the cell, to the lower concentration, which is inside of the cell. The cell membrane helps to regulate and slow down the flow of water into the cell. This is yet another way that the cell membrane helps maintain homeostasis.

I hope it helps ❤️

When you centrifuge the DNA isolated from the bacteria, the DNA separates into two classes. One class of labeled DNA includes very large molecules (thousands or even millions of nucleotides long), and the other includes short stretches of DNA (several hundred to a few thousand nucleotides in length). Which two classes of DNA do these different samples represent

Answers

Answer:

Leading strand and Okazaki fragments

Explanation:

The two classes of DNA that the different samples represent include the leading strand and the Okazaki fragments.

The large molecules DNA with thousands/millions of nucleotides constitutes the leading strand of the DNA while the short stretches of DNA with just a few thousand nucleotides in light constitute the Okazaki fragments.

This is because, during replication, the leading strands of DNAs are usually synthesized in a continuous manner and end up forming a long, continuous daughter strand while the lagging strands are usually synthesized in short, discontinuous fragments known as the Okazaki fragments.

The continuous/discontinuous replication of the leading/lagging strands of the DNA is due to the characteristics of the enzyme responsible for adding bases to the growing daughter strands. The DNA polymerase enzyme can only add nucleotides in the 5' to ' direction.

why is it necessary yo separate oxgynated and deoxgynated blood in livng oranisum

Answers

Explanation:

it is necessary in mammals and birds to separate oxygenated and deoxygenated blood because this makes their circulatory system more efficient and helps in maintaining a constant body temperature

1. Viruses such as avian (bird) flu and swine flu that mutate and can spread from animals to human populations are known as what?
O A. Vectors
O B. Transmuting viruses
O C. Epidemics
O D. Zoonoses

Answers

Answer:

B

Explanation:

they are transmuting viruses

B. Transmuting viruses is the answer

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

What factor about cellular respiration are you testing? ( what makes the three bottles different?)

Answers

Answer:

Gas.

Explanation:

Gas which is present makes the three bottles different from one another. There are three factors which is used for testing of cellular respiration such as amount of oxygen consumed during this process, amount of glucose used and amount of carbondioxide produced during cellular respiration. During cellular respiration, oxygen used in order to break down glucose and releases high amount of energy with the waste materials such as carbondioxide gas.

Protects the cell and controls what enters and leaves the cell

Answers

Answer:

- Endoplastic reticulum

-cell membrane

-ribosomes

-mithocondrion

^ all the ansers

Explanation:

Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

What is Cell Membrane?

The cell membrane is also called the plasma membrane. It is composed of a semipermeable lipid bilayer that regulates the transport of materials into and out of the cell. It protects the cell and provides a stable environment within the cell, and this membrane serves many functions.

The main function of the cell membrane is to transport nutrients into the cell, while another is to remove toxins from the cell. Cellular membranes are composed of glycerophospholipids, which are molecules composed of glycerol, a phosphate group, and two fatty acid chains.

Thus, Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

Learn more about Cell Membrane, here:

https://brainly.com/question/11906743

#SPJ2

Your question is incomplete, most probably complete question is:

_____Protects the cell and controls what enters and leaves the cell

A) cell wall

B) lysosomes

C)cell membrane

D)Vacuole

A possible answer to a scientific question that can be tested is a

Answers

The key to a good and manageable investigation is to choose a topic of interest, then ask what is called a “testable question.” Testable questions are those that can be answered through hands-on investigation by the student.

Why does the land around a once active coal mine remain barren?
A: Toxic nitrous oxides were released into the soil killing all plants.
B: C: Ozone is formed from hydrocarbons which prevent the growth of plants.
Please don't just take points. Thank you and have a good day

Answers

Hello!!

The answer is A. Toxic nitrous oxides were releassed into the soil killing all plants

Answer:

Empty coal mines are flooded with acid rain so no life forms can survive.

Explanation:

Name 2 features/tools in Drive that makes it easy to collaborate on assignments?

Answers

1. Live action
It shows what people are editing on your assignment so that you know what they have changed on it
2. Comments
When people have a suggestion, all they simply do is comment
Hope this helped! If it did, please mark as brainiest!

Adequate food safety practices lead to less: A:Food waste B:Insurance costs C:Hospitalizations D:Training

Answers

The answer to this question is HOSPITALIZATIONS

Food is very important as it is contains the source of energy. However, food can easily be contaminated majorly by MICROORGANISMS, hence, the reason they must be well kept and preserved. Every individual should oblige by the safety rules that guide handling of food (cooked or raw).

Some of the safety rules include;

* Proper washing of hands before and after cooking* Cook food thoroughly* Separate cooked and raw food* Keep food at safe temperatures etc.

Therefore, adequate food safety practices will help reduce HOSPITALIZATIONS caused by disease causing agents.

Learn more at: https://brainly.com/question/14608053

Hospitalizations will be less if adequate food safety practices are adopted.

Adequate food safety practices lead to less hospitalizations in the society because most people hospitalize due to bad food habits and food poisoning. If we implement safety measures related to food then we can save ourselves from various diseases as well as prevent ourselves from going to the hospital so in my opinion hospitalizations will be less if sufficient food safety measures are adopted by the people.

Learn more: https://brainly.com/question/17155329

How do I work this question out I’m struggling

Answers

I think the best thing to do is use a ruler maybe.

What can you learn about by studying DNA?

Answers

Answer:

Explanation:

                  The study of human DNA and genetics can be intellectually fascinating, but it also has plenty of practical applications. From the use of DNA in court cases to the discovery of new therapies for genetic diseases, a thorough understanding of the human genome can have important medical, social and legal impacts.

When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. glycolysis; dihydroxyacetone phosphate the electron transport system; coenzyme Q glycolysis; fructose-6-phosphate the citric acid cycle; pyruvate the citric acid cycle; acetyl CoA

Answers

Answer:

 glycolysis; dihydroxyacetone phosphate

When fats are used as an energy source, the glycerol portion enters the glycolysis when it has been converted to dihydroxyacetone phosphate. Thus, the correct option is A.

What is the Glycolysis?

Glycolysis may be defined as the process in which glucose (sugar) is partially broken down by cells in enzyme reactions that do not need oxygen.

In order to obtain energy from fats, triglycerides must be broken down into fatty acids and glycerol through hydrolysis. The fatty acids enter to Krebs cycle and are converted into acetyl CoA.

While the glycerol portion enters into glycolysis and is converted into dihydroxyacetone phosphate.

Therefore, the correct option for this question is A.

To learn more about Glycolysis, refer to the link:

https://brainly.com/question/737320

#SPJ2

Why is it necessary to separate oxgynated blood and deoxgynated blood in living organisums?

Answers

Answer:

For efficient transportation of blood.

Explanation:

john is testing the effect of temperature on the solubility of sugar in water

Answers

Answer:

As John is testing the effect of temperature on the solubility of sugar in water. To test this, he will measure the amount of sugar dissolved at different temperature level.


Mention the types of bees​

Answers

Answer:

ok thus very good percent few Mohammad khan

Help!!!
I'll give brainliest the brainliest. ​

Answers

Answer:

resists the turgor  pressure of the cell:  A : cell wall

controls the activities of  the cell : C : nucleus

site of the chemical  reactions of the cell  including synthesis of  proteins:  D : cytoplasm

Answer:

1. A -  Cell Wall

2. C - Nucleus

3. B. Mitochondria

Give brainliest

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

carbohydrate are store in animal cell in the form of​

Answers

Answer:

molecule glycogen

Plants store carbohydrates in long polysaccharides chains called starch, while animals store carbohydrates as the molecule glycogen.

Glycogen molecule, which is found in the cytosol of the cell

HELP
In humans, ventilation, digestion, and blood flow are important biological processes. Explain the relationship between the structure of tissues or organs and one of these processes.

Answers

Answer:

I am assuming the question is asking how do the processes relate to one another.

Explanation:

Ventilation happens in the lungs, where carbon dioxide and oxygen are exchanged in the alveoli. This is done via cappilaries that surround the alveoli. Cappilaries are small blood vessels, which are collecitelvy part of the blood flow system (circulation) of the body. In reguards to the digestion, there are capillaries in the vili (which are tiny finger-like structures) so that they can pick up the nutrients during digestion. Another way blood flow and digestion are connected is because the stomach is a muscle, thus is moves and requires energy. That energy comes from the oxygen and nutrients that is supplied by the blood. These are just some examples.

The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the likelihood that an organism could become extinct. Which of the following could also increase an organism's chances of extinction? A. an increase in predation, competition, and/or disease B. a lack of genetic diversity in an organism's species C. the inability to reproduce D. all of these

Answers

Answer:

D

Explanation:

all of those are likely to increase an organisms chances of extinction

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

Other Questions
Stine Co. is a retail store operating in a state with a 6% retail sales tax. The retailer may keep 2% of the sales tax collected. Stine Co. records the sales tax in the Sales account. The amount recorded in the Sales account during May was $148,400. Function of mitosis in plant growth and development What are the standard temperature and pressure conditions enthalpy is usually measured under Which system of linear inequalities has the point (3, 2) in its solution set? A historian is researching daily life in Ancient Egypt under a variety of ruling families over hundreds of years. This historian is using which of the following ways to study the past? cause and effect changes over time sequence of events similarities and differences 295 feet = _____ meters ? If 6x +3= 2x+ 19, then x = What is the equation for the line of symmetry in this figure? Enclosing the Largest Area The owner of the Rancho Grande has 3,052 yd of fencing with which to enclose a rectangular piece of grazing land situated along the straight portion of a river. If fencing is not required along the river, what are the dimensions (in yd) of the largest area he can enclose For a recent year, TechMart reported sales of $36,241 million. Its gross profit was $9,785 million. What was the amount of TechMart's cost of goods sold? (Enter answer in millions.) If the area of the figure is 16 square centimeters, what is the height of the triangle? The estimated product of 20.7 and 9.18, after rounding both factors to the nearest whole number, is . The exact product of 20.7 and 9.18 has decimal places. 5 men working 6 hours a day can dig a trench 180m long in 4 days. How many days would 8 men working 3 hrs a day take to dig a trench 220m long Write an equation perpendicular to the line y=3/2x-2 that goes through (-4,3) Can someone help me solve parts (a) and (c) please? Thank you! the part of cytoplasm other than cell organelles is called Alexander bought a box of crackers at the store. He ate half of the crackers in the box on Monday, and he ate 1/2 of what was left on Tuesday. On Wednesday, he ate 1/3 of what was left after he was finished eating the crackers on Tuesday. 1) What fractional part of the total crackers originally in the box did Alexandereat on Wednesday?2) what fractional part of the total crackers originally in the box are left. 3) if there are 4 crackers left in the box after Alexander finished eating crackers on wensday, how many crackers were in the box before it was opened. (Please help!) is badlion safe and how ? PLEASE HELP ME I DONT HAVE THAT MANY POINTS AND ITS DUE TODAY I NEED HELP ASAP The table contains the data for your first weeks sales. Complete the table by calculating your commission and earnings for each day of the week Explain the structure and language of the two love poems and how the lyrical language allowed the poet to descritheir sexuality in a way that was never discussed in their culture.