Answer:
organic selection
Explanation:
Which indicates a heterozygous genotype for smooth pods?
A. ss
B. SS
C. Ss
Answer:
C. Ss
Explanation:
One dominant allele (S) and one recessive allele (s) indicates a heterozygous trait.
current definition
please help
Answer: now or like presently
Explanation:
I dont know
1.How do speices interact in nature?
2.How do energy and nutrients move through communities?
3. How do communities respond to a disturbance?
Plants gather the sun's energy using molecules called
Answer:
Plants gather the sun's energy with light-absorbing molecules called pigments.
help please asap!!!!!!!!!!!!!!!!!!!
Answer:
Basidiomycotes
the second one
Explanation:
4. What is the molecule used by cells to store energy?
Answer:
What is the molecule used by cells to store energy?
Explanation:
Adenosine 5'-triphosphate, or ATP, is the principal molecule for storing and transferring energy in cells. It is often referred to as the energy currency of the cell and can be compared to storing money in a bank.
An area that has been sampled to have a large population of organisms. Does this represent high biodiversity? Why or why not?
An area that has been sampled to have a large population of organisms is
regarded as having a high biodiversity.
Biodiversity is defined as the condition in which areas have a high amount
of plant and animal species present there. Any place with a large population
of organisms is said to have a high biodiversity while places with low
population of organisms have low biodiversity.
The stated facts therefore makes an area that has been sampled to have a
large population of organisms represents high biodiversity.
Read more on https://brainly.com/question/18727662
My dad scolded me i don’t wanna live with him I hate him
What does fat become after the chemical process?
Answer:
uR mOtHeR
Explanation:
dUnno im sorry and very bored
Answer it correctly please
g The hormone __________ induces is lipolysis, whereas the hormone __________ inhibits the process. insulin; norepinephrine glucagon; insulin insulin; glucagon epinephrine; adrenocorticotropic hormone epinephrine; glucagon
What causes STI's & how are they transmitted?
Answer
I think the cause would be unprotected sex and well that would also be how its transmitted.
Explanation:
in this investigation the independent (or tested) variable is a. the speed of the rat b. letting the rat 10 times c. adding the rat's favorite treat at the end d. using the same maze
7. In an ecosystem, which is the most likely reason for an increase in the producer
population if there is an increase in the carnivore population?
Which phrase best describes what a soil horizon is?
A the bottom layer of a soil profile
B each layer of a soil profile
C the place where two soil profiles meet
D the place where a soil profile meets bedrock
Answer:
I suppose the answer is C
Each layer of a soil profile best describes a soil horizon.
What is a soil horizon?A soil horizon is a layer of soil within a soil profile. A soil profile is a vertical section through the soil, showing the different layers, or horizons, of soil that make up the soil. Soil horizons are typically classified based on their physical, chemical, and biological properties, and they can vary in thickness and composition depending on factors such as climate, vegetation, and the underlying geology.
Some common soil horizons include the surface horizon, the subsoil, and the parent material.
Learn more about soil horizon, here:
https://brainly.com/question/2416348
#SPJ5
Which type of cloud is made up of both liquid water droplets and ice crystals?
Answer:
Altostratus clouds are gray or blue-gray mid-level clouds composed of ice crystals and water droplets. The clouds usually cover the entire sky.
Explanation:
complete the crossword puzzle below.
down
1. a fat molecule is composed of _____ And 3 fatty acids.
2. means that hydrogen has been added to unsaturated fats
4 a large molecule whose main function is energy storage
6. unsaturated fats have move _____ bonds than saturated
UP
3. lipids are water-avoiding or _____
5. female and male hormones are example of ____
7. animal fats are said to be ____
pa help Po plss
Answer:
1 down hydroxyl
2 down Hydrogenation
4 down lipids
6 down
3 up
5 across androgen
7 up
Explanation:
that is all ik
What Is Chemogeny ( Chemical Evolution ) ? And Explain The Steps Of Chemogeny [Both Answer In Simple Word/ Simple Answer Which Is Easy To Concept Or Read]
Answer:
Chemogeny may be a theory of chemical evolution that depends on the chemical reactions and formation of drugs on the bases of chemical reactions. This theory says that “Life occurs as a results of evolution of inorganic matter”.
In the 1920's Scientists Oparin and Haldane, developed this hypothesis of the chemical origin of life from the primitive atmosphere of the world having matter like methane, ammonia and water. there have been very low concentrations of oxygen thanks to the presence of high temperatures like 5000-60000C. So, these conditions weren't suitable for the free existence of organic compounds, so reactions started happening .
Under conditions like high sunlight and warmth , inorganic matter gets converted to inorganic compounds. And this might end in the storage of organic compounds, which gets more and more concentrated with the passage of many years.
These compounds interact with one another and end in “life”.
So, chemogeny is that the process of chemical evolution of earth and formation of life from pre-existing matter with the assistance of chemical reactions.
Explanation:
Hopefully I was able to help you with the concept. Good luck!
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
Answer:
look at explanation
Explanation:
basically in order to go from mrna to trna just replace
a becomes u
g becomes c
u becomes a
c becomes g
Select all of the following that correctly describe the Streptococcus genus
- Gram Negative
- Gram Positive
- Cocci
- Bacilli
- Tetrads
- Sarcinae
- Strepto
- Staphylo
- Fastidious
- Can grow in salt
- Can grow in acid
- Normal flora of the skin
Please explain if possible!
Streptococcus is a genus of spheroidal bacteria that belongs to the Streptococcaceae family.
The bacteria's distinctive clustering in chains that resemble a string of beads is referred to as streptococcus ("twisted berry"). Microbiologically, streptococci are classified as gram-positive and nonmotile. Cocci :Streptococcus is a genus of gram-positive coccus (plural cocci) or spherical bacteria belonging to the Streptococcaceae family, which is part of the Lactobacillales (lactic acid bacteria) order in the Firmicutes phylum.
Gram-positive cocci are a diverse collection of bacteria that have a similar shape. Sarcina cells, for example, are grouped in cubical pockets. Streptococcus spp. resemble a string of pearls. Staphylococcus species do not divide on a regular plane.Bacilli :Streptococcus bacteria subdivide into Strep. pyogenes (Group A), Strep. agalactiae (Group B), enterococci (Group D), Strep viridans, and Strep pneumonia. Gram-positive bacilli (rods) subdivide according to their ability to produce spores.
If complete hemolysis of the blood cells is observed, the streptococci are classified as beta'hemolytic. M protein is considered the most important virulence component of S. pyogenes. Antibodies that react with M protein are produced in response to infection. A prospective antistreptococcus vaccination based on the M protein or a derivative of it is being studied.Tetrads :The tetrad occurs in a subgroup of the cocci where the bacterium divides in two planes to form a square of four bacteria called a tetrad. Some examples of tetrad-forming bacteria are the lactic acid bacilli, Aerococcus, a urinary tract pathogen and Pediococcus and Tetragenococcus, both of which ferment foods.
Tetrads are groups of four cocci that are positioned in the same plane (e.g. Micrococcus sp.). Sarcina is a bacterial genus that consists of eight cocci arranged in a cuboidal pattern (e.g. Sarcina ventriculi).Sarcinae :Sarcina is a Gram-positive cocci bacterium genus belonging to the Clostridiaceae family. After the cuboidal (2x2x2) cellular affiliations they create during division along three planes, the genus gets its name from the Latin word "sarcina," which means "pack or bundle."
Diplococci are pairs of cocci; streptococci are rows or chains of such cells; staphylococci are grapelike clusters of cells; sarcinae are packets of eight or more cells; and tetrads are groups of four cells in a square layout. Variations in the reproductive mechanism of bacteria result in these distinctive groups.Strepto :a combining term that means "twisted" and is used to make composite words: streptococcus
Streptococcus- a spherical or oval bacteria of the genus Streptococcus that occurs in pairs or chains and is harmful for humans, causing scarlet fever, tonsillitis, and other diseases.Fastidious :Streptococcus is a genus of gram-positive cocci that are organized in chains. These are fastidious bacteria that need blood or serum added to their culture medium. They are non-motile and do not produce spores. Most are facultative anaerobes, which means they can grow on enriched media.
Streptococcus pyogenes - it's a nutrient-concious bacteria that ferments glucose to make lactic acid and has stringent growth needs. This section explains the growth and maintenance of S. pyogenes to help in the research of this organism.Can Grow In Salt :On the basis of their salt tolerance, the salt tolerance test is used to identify enterococcal group D Streptococcus. Several bacteria, notably viridians streptococci, have been classified based on their capacity to thrive in the presence of a varying quantity of sodium chloride (NaCl).
The non-beta hemolytic streptococci (viridans, and non-enterococcal group D) do not grow in 6.5% NaCl broth; but some of the beta-hemolytic strains may grow in the broth.Can Grow In Acid :Some streptococci can create acids, grow in acidic surroundings (acidophilia), make acids at low pH levels (aciduric capability), and synthesis intracellular and external polysaccharides.
Dental caries is associated mainly with acid production at pH values below 5 by nongrowing bacteria in dental plaque. Oral streptococci cannot grow at pH above about 5, although they can lower the pH of suspensions or biofilms to values of 4 or lower.Normal Flora of The Skin:Bacteria make up the vast bulk of typical flora. Skin and nasal membranes are typically infected with Staphylococcus epidermidis.
Staphylococcus epidermidis is a Gram-positive bacterium that belongs to the Staphylococcus genus, which has around 40 species. It is found in marine sponges and is part of the normal human flora, most usually the skin flora and less commonly the mucosal flora.Sources: ( https://www.cdc.gov/ )
In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style
Answer:
Anther
Explanation:
Stamen is a male reproductive part in which anther produce male reproductive cells.
Answer:
The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.
Explanation:
Which of these could be a consequence of a mutation in one of an organism's
sex cells?
O A. The loss of the organism's ability to reproduce
B. The disruption of protein synthesis in the organism
O C. The transfer of the mutation to one of the organism's offspring
D. The ultimate death of the organism
Answer:
c
Explanation:
When an egg and a sperm cell unite, the resulting fertilized egg cell receives DNA from both parents.
Calcite is created by combining:
a. calcium, carbon, and nitrogen
b. calcium, carbon, and oxygen
C. calcium, oxygen, and nitrogen
d. calcium, oxygen, and hydrogen
Please select the best answer from the choices provided
Ο Α
O B
O C
O D
Answer:
Calcite is created by B: Calcium, Carbon, and Oxygen
2. In IVF the fertilization is : a) Always External b) Always Internal c) Can be any one of the two d) Fertilisation does not occur
Answer:
option a) is correct.
Explanation:
in IVF the fertilisation is always external.
Most Americans/Canada say they hope to die __________.
i think they hope to die at home
Distinguish between dimorphic, polymorphic, and continuously variable traits.
Dimorphic, polymorphic, and continuously variable traits are distinguished as follows:
Dimorphism is the condition of those species of animals or plants that exhibit two anatomical aspects or two different forms.When talking about polymorphisms in genetics, reference is made to the different variations that may exist on the DNA of the same gene.Continuously variable traits are those that show a continuous distribution of phenotypes.Therefore, we can conclude that dimorphism is a polymorphism with only two forms, the polymorphism is any stable change of the DNA fixed in the population and in continuously variable traits the phenotypes show a continuous series and cannot be easily grouped.
Learn more about polymorphic traits here: https://brainly.com/question/7882029
As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably?
muscle cell labelled diagram
Explanation:
Here is a diagram, let me know if this is what you needed.
1. The burning of fossil fuels contributes to all of the following ecological problems except for:
A. ozone depletion
B. global warming
C. acid rain
D. air pollution
The burning of fossil fuels does not contribute to ozone layer depletion.
The burning of fossil fuels leads to the release of gases such as oxides of nitrogen, sulfur, and carbon as well as particulate matter such as smoke, ashes, etc.
The oxides released from fossil fuel burning can cause global warming (carbon dioxide), acid rain (SO2), and air pollution (particulate matter).
Ozone layer depletion is caused by pollutants such as halocarbons, solvents, etc.
More on ozone layer depletion can be found here: https://brainly.com/question/1285852?referrer=searchResults
4. How does the life of a sperm cell vary among the mosses, ferns, gymnosperms and angiosperms?
Answer:
They evolved on land to begin with from earlier now extinct groups groups so there was no need to adapt to life on land, other than to adapt to different terrestrial environmental pressures. Land can be everything from next to a river to a hot desert to rocks to Antarctica, and plants grow in all those places.
As well, there are thousands of species that are floating aquatics or submerged aquatics, including many ferns, and even some gymnosperms grow as marginals, and many species of angiosperms, mosses, ferns, and even some gmnosperms grow as epiphytes, or as parasites, or other ways.