If a vaccine protects you for most of your life against a particular pathogen, why do you need a new flu shot every year? A. Influenza evolves very quickly and its antigens mutate so that your memory cells from the last vaccine won’t recognize it. B. Influenza is so strong that you need a booster every year to make sure your body can fight it. C. Influenza is a virus, and vaccines only generate memory cells for bacterial infections. D. You don’t need it every year, it is just offered every year for anyone who does not have it yet.

Answers

Answer 1

Answer:

If you got a flu shot this year, next year you'll need it again.

Explanation:

This is because the virus changes, usually rendering the previous year's vaccine partly or totally useless. hope this helps you :)

Answer 2

Answer:

A.

Explanation:

Influenza evolves very quickly and its antigens mutate so that your memory cells from the last vaccine won’t recognize it.

The 2020 influenza vaccine was not as efficient because scientists were scrambling to put out a vaccine for Coronavirus. Consequently, Coronavirus cases skyrocketed during the flu season.
Hope this helped!

also.. i have to put coronavirus and not "c0vid-19" because apparently it's too political. lol.


Related Questions

A molecule will become an ion when which of the following happens?

Answers

Loses or gains a charge

how many different versions of a gene are carried in a single normal cell?

Answers

Answer:

two versions of a gene are carried in a single normal cell called alleles

Select all that apply.
Which conditions relate to the research of van Helmont?
plant mass related only to soil
conclusions partly correct
demonstrated plant food from soil
conducted around 1400 AD.
plant mass related to H 20

Answers

Answer:

I'd say the best Answer is A & C

Explanation:

The opposable thumb is a trait that connects us to other primates; allowing us to grab and use tools and increasing chances for survival. This means it is a(n) __________.

Answers

Answer:

The options to this question are;

A. genotype

B. adaptation

C. selective pressure

D. stabilizing pressure

The answer is B) Adaptation

Explanation:

Adaptation is the process whereby an organism becomes well suited to survive in its natural environment, which is aided by the possession of certain traits called adaptive features. For example, the fins of a fish makes it fit to survive in an aquatic environment, likewise the opposable thumbs of humans make us well suited to survive in our environment.

As stated in the question, the opposable thumb i.e. movement of the thumb independently of the other four fingers, is a characteristics of primates. This unique feature (opposable thumb) allows us to grab things, get a good grasp of tools, use tools effectively, write things, etc. All these ability due to the possession of opposable thumb increases our chances of survival. Hence, the possession of opposable thumb is regarded as an ADAPTATION

Glycolysis and gluconeogenesis are opposing pathways in that they begin or end with the same metabolites and share common intermediates and/or enzymes. Yet, for energetic reasons, the two processes cannot be the exact reverse of each other. How is this possible

Answers

Answer:

Due to difference in their products.

Explanation:

Glycolysis and gluconeogenesis are not exact reverse to each other because in glycolysis, glucose is converted into pyruvate, adenosine triphosphate (ATP), NADH, protons i.e. hydrogen ions and water whereas in gluconeogenesis, pyruvate is converted into glucose and glycogen. So due to  the formation of different products of each process we can say that glycolysis is not exact reverse of gluconeogenesis.

1. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. A phylogenetic tree containing two main branches for evolutionary relationships among the animals.
B. The first branch leads to Drosophila.
C. The second branch divides into two branches, 2a and 2b. Branch 2a leads to Lancelet.
D. Branch 2b divides into two branches: 3a and 3b. Branch 3a leads to Zebrafish.
E. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Frog.
F. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Chicken.
G. Branch 5b divides into two branches leading to Human and Mouse, respectively.
2. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.
B. The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.
C. A frog is the ancestor of both a mouse and a chicken.

Answers

The figure shows a tree diagram with two main branches. The first branch leads to Drosophila. The second branch divides into two branches 3a and 3b. Branch 3a leads to Lancelet. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Zebrafish. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Frog. Branch 5b divides into two branches: 6a and 6b. Branch 6a leads to Chicken. Branch 6b divides into two branches leading to Human and Mouse, respectively.

This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.

The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

A frog is the ancestor of both a mouse and a chicken.

The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.

Answer:

The answer is below

Explanation:

Given the information above, and from the available pictures which showed the detailed analysis of the information presented in the question. It can be concluded that, the nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

Hence, the right answer is option B.

Which of the following are all examples of pollution
Pesticide Run-off
Desertification
Global Warming
Poaching
Burning of Fossil Fuels

Answers

Burning fossil fuels

• How the knowledge of classification be applied to assess the characteristics of different organisms when visit to zoo, herbaria or gardens.(Students may do research on internet to answer this question )
plz correct answer
be quick

Answers

Answer:

Compare two organism on the physical features and mode of nutrition.

Explanation:

Organisms are classified in groups and sub-groups on the basis of similarities and differences. so in order to compare two organisms, start with the similarities that are present between them. If similarities are more so they belong to the same group or if differences are more than both are placed in different groups. for classification, see the physical appearance of organism, mode of nutrition and habitat etc. If organisms are identical, they belong to the same species, if one or two characters are different so their genus will be same but specie is different. In zoo animals are different from the animals which is present in garden so compare the physical features of zoo and garden animals.

Why does the land around a once active coal mine remain barren?
A: Toxic nitrous oxides were released into the soil killing all plants.
B: C: Ozone is formed from hydrocarbons which prevent the growth of plants.
Please don't just take points. Thank you and have a good day

Answers

Hello!!

The answer is A. Toxic nitrous oxides were releassed into the soil killing all plants

Answer:

Empty coal mines are flooded with acid rain so no life forms can survive.

Explanation:

Why is it necessary to separate oxgynated blood and deoxgynated blood in living organisums?

Answers

Answer:

For efficient transportation of blood.

Explanation:

Superficial similarities in structures that have the same function can seem like they are evidence of a common ancestor, but they are not. An example of this is the convergent evolution of wings in insects as well as in birds. What are these types of structures called

Answers

Answer:

Distinguishing between Similar Traits

Similar traits can be either homologous structures that share an embryonic origin or analogous structures that share a function.

LEARNING OBJECTIVES

Explain the difference between homologous and analogous structures

KEY TAKEAWAYSKey PointsOrganisms may be very closely related, even though they look quite different, due to a minor genetic change that caused a major morphological difference.Unrelated organisms may appear very similar because both organisms developed common adaptations that evolved within similar environmental conditions.To determine the phylogeny of an organism, scientists must determine whether a similarity is homologous or analogous.The advancement of DNA technology, the area of molecular systematics, describes the use of information on the molecular level, including DNA analysis.Key Termsanalogous: when similar similar physical features occur in organisms because of environmental constraints and not due to a close evolutionary relationshiphomologous: when similar physical features and genomes stem from developmental similarities that are based on evolutionphylogeny: the evolutionary history of an organismmolecular systematics: molecular phylogenetics is the analysis of hereditary molecular differences, mainly in DNA sequences, to gain information on an organism’s evolutionary relationships

if you think about fat as old stuff,what new stuff can be made from it

Answers

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

Fat is derived from plant and animal sources. They include seeds, fruits, fatty fish.

Fats serve as a source of energy in organisms and also serve as insulation.

If you think about fat as old stuff,what new stuff can be made from it means of the things fats can be made from and they include Paints, Lubricants, Biofuel, Face cream, Soap etc. These products are manufactured in industries on a large scale due to their high demand.

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

john is testing the effect of temperature on the solubility of sugar in water

Answers

Answer:

As John is testing the effect of temperature on the solubility of sugar in water. To test this, he will measure the amount of sugar dissolved at different temperature level.

An ecologist samples the abundance of various species along an environmental gradient and fails to find clusters of species. Instead, peaks of abundance of dominant species are merely randomly spaced segments along a continuum. This distribution of species supports the

Answers

Answer:

This distribution of species supports Gleason´s Individualistic concept of a community.

Explanation:

This theory was proposed by Gleason and it states that plant species respond individually to environmental factors that continuously change at spatial and temporal levels. This means that the combination and distribution of plants in a certain point or area are unique because each vegetable species has a different distribution pattern and a different tolerance and abundance rate. Hence each species´ response curve to a certain gradient has its own shape and size and it different from other species curves.  

Plants assembly growing in an area is the result of environmental conditions and migration rate of species. As every area is continuously getting propagules of different species, the survival success of each plant depends not only in environmental factors, but also depends on the tolerance to other new species and their interactions. This combination along a gradient always results in different composition and abundance of species. This is why a sample can not be confined to a clearly defined vegetable community.

This point of view is known as individualistic or continuum concept of vegetable community. Gleason believed that vegetable species were distributed as a continuum and that communities can not be identified as combinations of associated species that repeat in space.

Help!!!
I'll give brainliest the brainliest. ​

Answers

Answer:

resists the turgor  pressure of the cell:  A : cell wall

controls the activities of  the cell : C : nucleus

site of the chemical  reactions of the cell  including synthesis of  proteins:  D : cytoplasm

Answer:

1. A -  Cell Wall

2. C - Nucleus

3. B. Mitochondria

Give brainliest

1. Viruses such as avian (bird) flu and swine flu that mutate and can spread from animals to human populations are known as what?
O A. Vectors
O B. Transmuting viruses
O C. Epidemics
O D. Zoonoses

Answers

Answer:

B

Explanation:

they are transmuting viruses

B. Transmuting viruses is the answer

How do I work this question out I’m struggling

Answers

I think the best thing to do is use a ruler maybe.

What can you learn about by studying DNA?

Answers

Answer:

Explanation:

                  The study of human DNA and genetics can be intellectually fascinating, but it also has plenty of practical applications. From the use of DNA in court cases to the discovery of new therapies for genetic diseases, a thorough understanding of the human genome can have important medical, social and legal impacts.

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

Which of the following statements is true?

Photosynthesis is a type of homeostasis.
Unicellular organisms have differentiated cells.
Respiration is a type of metabolism.
Multicellular organisms are made of only one cell.

Answers

Answer:

Respiration is a type of metabolism.

Answer:

C. Respiration is a type of metabolism

Explanation:

Both B and D are incorrect because:

Multicelluar organisms have more than one cell; while singlecelled organisims only have one cell.

Also, homeostasis is a natural way an organisms body reacts to different situations, like when you sweat, your body is realising a way to lower the heat in your body. Therfore, A. is also incorrect.

Hope this helped!

-gene 1
-gene 2
-gene 3
How are these three genes related?

Answers

Answer:

Depends on the locations of these gene segment on the chromosome whether it be found on the same or different.

It can either be linked or unlinked.

The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the likelihood that an organism could become extinct. Which of the following could also increase an organism's chances of extinction? A. an increase in predation, competition, and/or disease B. a lack of genetic diversity in an organism's species C. the inability to reproduce D. all of these

Answers

Answer:

D

Explanation:

all of those are likely to increase an organisms chances of extinction

Which of the traits below are completely influenced by the expression of genes? (Choose all that apply)
weight
attached or unattached earlobes
hair texture
eye color

Answers

Eye color bjfijdjsuddjjdcnvnfjd

Answer:

attached or unattached ear lobes

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

What is the role of Langerhans cells? prevent pathogens from entering the body using antibacterial agents destroy pathogens that enter the body using white blood cells identify pathogens that enter the body and carry them to lymph nodes for destruction

Answers

The role of Langerhans cells is that they prevent pathogens from entering the body using antibacterial agents.

What are Langerhans cells?

Langerhans cell is a dendritic cell of the skin and mucosa, containing Birbeck granules, and present in all layers of the epidermis but most prominent in the stratum spinosum.

Langerhans cells play important roles in the immune system by acting as the outermost guard of the cutaneous immune system where they induce the first reactions against pathogens encountered via the skin.

Therefore, the role of Langerhans cells is that they prevent pathogens from entering the body using antibacterial agents.

Learn more about Langerhans cells at: https://brainly.com/question/15660598

#SPJ2

Answer: 3.identify pathogens that enter the body and carry them to lymph nodes for destruction

Explanation:

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

what is a warning safety sign​

Answers

Answer:

Hey there!

A warning safety sign is a sign that warns you that there may be a safety hazard around you.

Let me know if this helps :)

why is it necessary yo separate oxgynated and deoxgynated blood in livng oranisum

Answers

Explanation:

it is necessary in mammals and birds to separate oxygenated and deoxygenated blood because this makes their circulatory system more efficient and helps in maintaining a constant body temperature


Mention the types of bees​

Answers

Answer:

ok thus very good percent few Mohammad khan

Other Questions
Can you find x for me? To the nearest tenth, what is the value of P(C|Y)? 0.4 0.5 0.7 0.8 Find the missing length indicated. The probability that a patient recovers from a disease is 0.3.If 6 people are known to have contacted the disease, what is the probability that at least 4 survive? When the Constitution entitles all citizens to due process of law, what does this phrase mean?It is C) Every citizen has the right to a trial Prove: The square of the sum oftwo consecutive integers is odd. What are the zeros of this function?A. X= 2 and x = -6B. x= 0 and x = -6C. X= 0 and x = 5D. X = 0 and x= -5 Two metal spheres of diameter 2.3cm and 3.86cm are melted. The molten material is used to cast equal cylindrical slabs of radius 8mm and length 70mm. If 1/2 of the metal is lost during casting. Calculate the number of complete slabs casted. A Gallup poll asked 1200 randomly chosen adults what they think the ideal number of children for a family is. Of this sample, 53% stated that they thought 2 children is the ideal number. how many eighth rests are in a half rest? PLS HELP ME ON THIS QUESTION I WILL MARK YOU AS BRAINLIEST IF YOU KNOW THE ANSWER PLS GIVE ME A STEP BY STEP EXPLANATION!!Of the following points, name all that lie on the same vertical line?(0,8) (-5,0) (-1,0) (0,7)A. (0,8) (-5,0) (-1,0) (0,7)B. noneC. (-5,0) (-1,0)D. (0,8) (0,7) (a) A survey of the adults in a town shows that 8% have liver problems. Of these, it is also found that 25% are heavy drinkers, 35% are social drinkers and 40% are non-drinkers. Of those that did not suffer from liver problems, 5% are heavy drinkers, 65% are social drinkers and 30% do not drink at all. An adult is chosen at random, what is the probability that this person i. Has a liver problems? i came........her (use appropriate preposition 1. A cone is 8cm high and has a base diameter of 12cm.its slant height is a.6cm b.8cm c.10cm d.12cm Solve the equation for y. Identify the slope and y-intercept then graph the equation. Y=-3x+1Y=M=B=Please Include a picture of the graph and show your work if you can HELP ME I NEED IT [100 POINTS ]Match each Southeast Asian nation to its description. Sri Lanka The Philippines Myanmar ruled by a military government called a junta arrowRight elected Corazon Aquino as its president in 1986 after the dictatorship of Ferdinand Marcos arrowRight experienced a civil war between the Sinhalese and the Tamil after independence Greatest to least just need some help will help ty(please dont give wrong answer) A rectangular paperboard measuring 29in long and 20in wide has a semicircle cut out of it, as shown below.Find the area of the paperboard that remains. Use the value 3.14 for , and do not round your answer. Be sure to include the correct unit in your answer. I need with a question 3(2+7) - 9 x 7 = 3+8 x 2 x 2 - 4 = 16 2 x 5 x 3 6 = Please answer!