Answer: Talc is a nonrenewable resource.
Explanation:
Talc is a mineral, which counts as a nonrenewable resource. Minerals, fossil fuels, and ores are nonrenewable resources because they do not regenerate or renew themselves at a quick enough rate and often take long periods of time to replenish.
Apoptosis differs from necrosis in that necrosis:_______ a. requires the reception of an extracellular signal. b. causes DNA to fragment. c. causes cells to swell and burst, whereas apoptotic cells shrink and condense.d. involves a caspase cascade
Answer:
c. causes cells to swell and burst, whereas apoptotic cells shrink and condense
Explanation:
These two mechanism are responsible for death of cells in multi cellular organisms.Apoptosis is naturally occurring process which is well organised and programmed.It is ensures the automatic death of old and worn out cells, needed for certain cellular developments. This is demonstrated by DNA fragmentation,cell shrinkage,and the break down of the nuclear walls.It can be initiated through two pathways of intrinsic and extrinsic,The latter leads to death from internal factors,while in the former is when external factor causes the death .
However,when cell death is influenced by external factors(toxins) in the cell environments,which lead to unpredictable or unregulated process leading to cell death ,the process is called Necrosis.it is demonstrated with the swelling and busting of the cell.and characterised with inflammation. It is an accidental death which causes injuries to the cells and tissues.
Saprobic microorganisms are important decomposers of plant litter, animal matter, and dead microbes. This is an example of a(n) ______________.
Answer:
The correct answer would be - heterotrophs (chemoheterotrophs)
Explanation:
Heterotrophs are the living organisms that are directly or indirectly depend on the autotrophs or the organisms that can make their own food for energy and growth.
Saprobic microorganism are free living organisms that get their energy from decomposing rotten or dead organic matter such as plant litter, animal matter and dead microbes. It is performed with the help of enzymes or chemicals they release to decompose such matter. they also known as chemoheterotrophs.
Thus, the correct answer would be - heterotrophs (chemoheterotrophs).
The functions of the oral cavity include all of the following except Select one: A. mechanical processing of food. B. absorption of monosaccharides. C. digestion of carbohydrates. D. lubrication. E. sensory analysis of material before swallowing.
Answer:
C. Digestion of carbohydrates.
Explanation:
The function of the oral cavity that is not performed by the oral cavity is B) absorption of monosaccharides.
What is oral cavity?The oral cavity, also known as the mouth, plays a crucial role in the digestive process. Its main functions include mechanical processing of food by chewing and grinding, sensory analysis of material before swallowing through taste buds, and lubrication of food through the production of saliva.
The oral cavity also begins the process of digestion by breaking down carbohydrates with the help of enzymes in saliva. Additionally, the oral cavity serves as the entry point for air during breathing and speech. Proper oral health, including brushing, flossing, and regular dental check-ups, is important for maintaining overall health and wellness.
Learn more about oral cavity, here:
https://brainly.com/question/4983902
#SPJ6
b) How will you describe any three (3) major components of the environment to a named
class puyil?
Answer:
Hydrosphere, atmosphere and biosphere are the three major components of the environment.
Explanation:
Hydrosphere, atmosphere and biosphere are the three major components of the environment. hydrosphere refers to water bodies such as ocean, sea, ponds and lakes etc that is present in our environment. atmosphere refers to the gaseous layer which is present above the earth surface. in this layer oxygen, nitrogen and carbondioxide etc are present. biosphere refers to all living organisms such as human, animals, plants and microbes etc which are present on earth surface..
You have been assigned a DNA stretch. What is the complementary strand when you replicate the template
Answer:
The complementary strands of a DNA are read in the opposite direction to one another
Explanation:
A DNA strand/stretch can be represented with a number of bases. The bases in a DNA strand are Adenine (A), Thymine (T), Cytosine (C) and Guanine (G). The Adenine can bind to Thymine (and vice-versa) while the Guanine can bind to Cytosine (and vice versa). These bonded bases are called "base pairs".
Complementary DNA strands are read in opposite direction to one another. Each end of a DNA strand is either a 5' end or a 3' end. Hence, if one strand runs from the 5' to 3' end, the complementary strand will run from the 3' to 5'. Thus, they are represented "on paper" the way they run.
For example,
If the DNA strand assigned is AGTCTAG running 5' to 3', the complementary strand will be CTAGACT (starting from the 3' end) and NOT TCAGATC (which starts from the 5' end)
What part of the brain is known as the pleasure center?
A. Brain stem
B. Hypothalamus
C. Thalamus
D. Midbrain
SUBMIT
Answer:
B. Hypothalamus
Explanation:
The hypothalamus contains the pleasure center of the brain, the nucleus accumbens. The hormone dopamine is released from this part of the brain in response to or anticipation of pleasurable activities such as eating good food, monetary rewards as well as when taking psychoactive drugs.
The release of dopamine affects other feelings such as happiness, focus, being alert as well as staying motivated. it also affect some voluntary actions as well.
Constantly seeking out activities that stimulate dopamine release may lead to addiction to such activities as in drug addiction.
Which part of the cell functions to recognize other cells? (1 point)
O nucleus
O cytoplasm
O cell wall
O plasma membrane
Answer:
cell wall maybe it may be wrong also
Plasma membrane of the cell functions to recognize other cells. Thus option D is correct.
What is Plasma membrane?The plasma membrane which is an outer covering of cell present in both prokaryotic and eukaryotic cell.
It is a thin selectively semi-permeable membrane which enclose the cytoplasm along with other organelle.
Proteins and lipids are the major components of membrane, beside this carbohydrate are also present in cell membrane.
The most common lipid in membrane is phospholipid, other lipids are glycolipid, sphingolipid.
The function of cell membrane is to provide protection and maintain the integrity of the internal environment of the cell,
It act as a base of attachment for the cytoskeleton for cell-cell communication.
It involve in transport of materials like nutrients, toxic substances.
Thus option D is correct.
Learn more about plasma membrane, here:
https://brainly.com/question/14727404
#SPJ2
Which is NOT a function of magnesium in the body?
znutritio acting as a cofactor for enzyme systems in the Irody
regulating bone and mineral status
protecting teeth from acid-forming bacteria
making up one component in bone mineral
Answer: I think it is the third one which states, "Protecting teeth from acid-forming bacteria".
Explanation:
use the numbers 12345 to place the protien creations steps below in the correct order
Use the numbers 1, 2, 3, 4, and 5 to place the protein creation steps below in the correct order. Ribosome attaches to the mRNA. Information is transcribed in DNA to mRNA. tRNA anticodon carries an amino acid that compliments the mRNA codon. mRNA leaves the nucleus. The chain of amino acids forms a protein.
if it is helpfull please mark as brainlist
Answer:
please list numbers 12345 and then i will
Explanation:
write a poem about culture
give expiation for your answer
and describe how to write poem
and don't forget to write poem about culture?
please please answer this question
Explanation:my culture is pakistan and it's tradition and colours are well , most people decorate the buses on 14th august people do face painting and make delicious food in world there are many types of cultures and tradition, which people celebrate once in a year
I HOPE WHOEVER YOU ARE LOVE THE POEM AND PLEASE LIKE YOUR CULTURE IN WHATEVER COUNTRY YOU ARE BORN BECUASE IT'S YOUR COUNTRY WHICH IS BEAUTIFUL LIKE MY COUNTRY.
Butterflies can produce hundreds of offspring per cross. In a certain variety of butterflies, a maternally-imprintable gene is responsible for wing phenotype. Two possible alleles for this gene are w for normal wings and wc for crinkled wings. Which of the following pieces of information would be helpful in predicting the wing phenotype of a male offspring from a cross?
a. look at the father's phenotype
b. know the mother's genotype
c. look at the mother's phenotype
d. know the father's genotype
Answer: d. know the father's genotype
Explanation: Butterflies can produce hundreds of offspring per cross. In a certain variety of butterflies, a maternally-imprintable gene is responsible for wing phenotype.
The option that would be helpful in predicting the wing phenotype of a male offspring from such a cross would be to look at the father's phenotype.
Imprinted genes can simply be defined as genes that are expressed in parent-of-origin specific manner and result from a chemical modification of DNAs. Such genes are differentially expressed depending on which of the two parents they are inherited from. Hence:
maternally-imprintable genes are only expressed when they are inherited from the father. paternally-imprintable genes are only expressed when inherited from the mother.Phenotype refers to the physical appearance or expression of a gene. Therefore, if a gene is maternally imprintable, looking at the phenotype of the father would be helpful in predicting the phenotype of the male child in case a cross happens.
Applying the same principle to the butterfly, it will, therefore, be helpful to look at the father's phenotype in order to predict the wing phenotype of a male offspring from a cross.
The correct option is A.
More about imprinted genes can be found here: https://brainly.com/question/7207412
ASAP When ______ is hydrolyzed, it forms _______. A. protein, amino acids B. ATP, ADP C. polysaccharide, monosaccharide D. lipid, triglyceride
Answer:
The answer is ATP, ADP
Explanation:
When protein is hydrolyzed, it forms amino acids. Thus, the correct option is A.
What is Hydrolysis?Hydrolysis may be defined as a chemical process that utilizes the molecules of water that involve the chemical breakdown of a compound.
Amino acids are the monomers of protein. These amino acids are linked together by peptide bonds. But the process of hydrolysis breaks the peptide bond between the amino acid sequences and released them significantly in free form.
Therefore, when protein is hydrolyzed, it forms amino acids. Thus, the correct option is A.
To learn more about Hydrolysis, refer to the link:
https://brainly.com/question/4352413
#SPJ5
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG
Answer:
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
Explanation:
The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20 nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:
Schematically:
The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:
5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'
The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:
3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'
Which of the following small GTPases are NOT involved in vesicle budding or docking? A. ARF B. Rab1 C. Ras D. Sar1p
Answer:
option c is correct that is Ras
Explanation:
The correct sequence for western blotting is:
1. Proteins are denatured by sodium dodecyl sulfate (SDS), and by boiling.
2.Transfer proteins to the nitrocellulose membrane.
3. Performing the polyacrylamide gel electrophoresis (PAGE).
4. Incubate the nitrocellulose membrane to primary antibodies and secondary antibodies subsequently.
a. 1,2,3,4
b. 4,1,3,2
c. 1,3,2,4
d. 1,3,2,4
Answer:
3.page is this that answer
Explanation:
a.1,2,3,4
The correct sequence for western blotting is: C. 1,3,2,4
Blotting can be defined as an analytical technique that is designed for the analysis of biological macromolecules such as:
Lipids.Nucleic acid.Proteins.Carbohydrates.For western blotting, the correct sequence of analyzing biological macromolecules such as proteins is:
1. The denaturation of protein through the use of sodium dodecyl sulfate (SDS) and by boiling.
2. The performance of polyacrylamide gel electrophoresis (PAGE).
2.The transfer of proteins to the nitrocellulose membrane.
4. Lastly, the incubation of the nitrocellulose membrane to subsequently form primary antibodies and secondary antibodies.
Read more: https://brainly.com/question/14681125
The diagram shows a phase of mitosis. A phase of mitosis is shown. The chromosomes lined up at the center. Letter A represents long strings inside of the cell. Which does the letter A represent in the diagram?
I wish you added the diagram but I can tell that the long strings are the spindle fibres.
Answer:
the long string things are the fiber spindle thing
( sorry i'm not good at reading passages and citing from them... )
In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.
1. The phenotype of the heterozygous plant is_________.
2. The genotype of the heterozygous plant is_________.
3. The genotype of the plant with yellow pods is________.
4. The genotypes of gametes produced by a heterozigous plant is______.
5. The genotypes of gametes produced by a yellow plant is_______.
A. Green pods
B. 75% AA and 25% Aa
C. AA
D. 100% A
E. Yellow pods
F. 50%
G. 25%
H. 100% a
I. 50% A and 50% a
J. Aa
K. 0%
L. 75%
M. 75% A and 25% a
Answer:
1. Green
2. Aa
3. aa
4. A and a
5. a and a
Explanation:
1. The phenotype of the heterozygous plant (Aa) would be green since the allele responsible for green color (A) is dominant over the allele responsible for yellow color (a).
2. The genotype of a heterozygous plant would be Aa. Heterozygous individuals have different alleles for the same gene.
3. The genotype of the plant with a yellow pod would be aa. Since the allele for green color (A) is dominant over the allele for yellow color (a), the yellow color can be expressed only in the absence of the (A) allele. Hence, the genotype fo yellow color has to be aa.
4. The genotypes of gametes produced by a heterozygous plant would be (A) and (a) because heterozygous individuals have two different alleles for a gene.
5. The genotypes of gametes produced by a yellow plant would be (a) and (a) because a yellow plant has the genotype (aa).
Vị trí các cacbon trong cấu trúc của đường đềôxyribô trong 1 nuclêôtit được thêm dấu phẩy vì:
Answer:
hi please answer my questions.
Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin. What kind of a cell is this?
Answer:
An animal cell in the telophase
Explanation:
Telophase is one of the stages of cell division in animal cell .
In the animal cell during telophase, Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin because the nuclear membrane and nucleoli reform, cytokinesis is almost coming to completion and the chromosomes eventually uncoil to chromatin. Usually cytokinesis occurs during telophase.
Importances of bacteria to humans
Answer:
Bacteria are very important to humans, both for good and for bad, due to their chemical effects and the role they play in spreading disease. In their beneficial effect, some bact
If E is the allele for brown eyes and e is the allele for blue eyes, which of these genotypes will allow the individual yo have the phenotype of blue eyes
Answer:
Since blue eyes are a recessive gene, the genotype will need to be ee.
If E is the allele for brown eyes and e is the allele for blue eyes, the genotype that will allow the individual to have the phenotype of blue eyes is ee.
What is genotype?Genotype is the part of the genetic makeup of an organism that determines a specific characteristic (phenotype) of that organism.
According to this question, E is the allele for brown eyes and e is the allele for blue eyes. This suggests that E is the dominant allele while e is the recessive allele.
Therefore, the genotype that will allow the individual to have the phenotype of blue eyes is ee.
Learn more about genotype at: https://brainly.com/question/12116830
#SPJ6
Help anyone please????!
Formula, name, and Group number of element needed for: (i) hypothyroidism - (ii) hypertension (iii) kidneys (iv) bones
Answer:
I) Hypothyroidism involves the insufficient production of thyroid in the thyroid gland which helps in the development of individuals. The element Iodine enhances the production of the thyroid.
I2- Iodine - Group number 17
Hypertension - Too much Salt which contains sodium in foods causes hypertension.
Na- Sodium- Group number 1
Bones require Calcium for its proper development and also helps to strengthen it.
Calcium - Ca- Group number 2
Kidney - Excess sodium in kidneys could result to kidney diseases which is why plenty of water should be taken to help the kidney from this element.
Na- Sodium- Group number 1
After buying a new house by the lake, a family wanted a better view of the water so they could watch the sailboats. They hired a company to cut down the small trees and shrubs that were blocking the view.
Which type of water pollution is most likely
1 . Nutrient
2.sediment
3.toxic
4. Bacterial
The water pollution that is most likely to occur is Nutrient pollution
Pollution can be defined as the addition of materials or energy (pollutants) to the environment that damages it, making it undesirable or unfit for life. There are different types of pollution which includes:
--> Air pollution
--> Radiation pollution
--> soil pollution and
--> water pollution.
WATER POLLUTION is defined as the type of pollution that occurs when pollutants are being released into water bodies such as streams, lakes, ocean, beaches making it unsafe to use for both human and aquatic life activities. Depending on the type of pollutants, there are also different types of water pollution, these include:
chemical pollution Groundwater pollutionsediment pollutionmicrobiological pollutionnutrient pollutionsurface water pollution and Oxygen-depletion pollution.NUTRIENT pollution occurs when there is EXCESS of it in the water bodies through organic fertilizer or compost manure from the leaves of the cut down trees and shrubs. When nitrates from the agricultural waste gets into the water body(lake) it can cause a drastic increase in aquatic plant growth, especially algal growth. This excessive growth can lead to a decrease in oxygen level of water they by affecting the aquatic life of the lake.
Therefore the CORRECT OPTION is A Nutrient pollution.
Option B is wrong because sediment pollution is a type that involves loose sand, clay, silt, and other soil particles that are carried from a site by runoff water not from cut down trees.
Option C is wrong because toxic or chemical pollution is caused by chemicals from industrial wastes.
Option D is wrong because it is caused by natural existing bacteria in the water bodies and are capable of causing disease when ingested. Example Vibro cholera bacteria.
Learn more about water pollution here
https://brainly.com/question/23597651
which climate does sparrow live hot or cold
Answer:
Hot ok please give me brilliance
Explanation:
please
what is the key to the recognition of a trait whose expression is determined by the effects of two or more genes
Answer:
Explanation:
Polygenic inheritance occurs when many loci of a gene contributes to it genetic make up.
No particular allele can be selected for contributing to a particular traits all the allele are equally expressed.
Over expressitivity example is pleiotrophy effect have more than 5 fingers or toes
The offspring express more dominant traits that the normal mendelian principle
This signs indicate polygenic inheritance.
from
In order to perform Photosynthesis, a plant needs to obtain
the air and from the soil.
O A. carbon dioxide, nitrogen
B. carbon dioxide, water
C. oxygen, water
D. oxygen, nitrogen
Answer:
The answer is B not c
Explanation:
If a cell membrane were completely permeable to all substances, could the cell continue to live? Explain your answer in depth.
Which scientist was responsible for coining the phrase "Big Bang"? *
O Fred Hoyle
O Albert Einstein
O Sir Isaac Newton
O Edwin Hubble
Answer:
Fred Hoyle
Explanation:
Sir Fred Hoyle FRS was an English astronomer who formulated the theory of stellar nucleosynthesis. He also held controversial stances on other scientific matters—in particular his rejection of the "Big Bang" theory, a term coined by him on BBC radio, and his promotion of panspermia as the origin of life on Earth
Describe how scent and taste work in conjunction. Are the tastes of below mention foods that were tested heightened by the sense of smell, or only some of the foods?
a. Salt
b. Sugar
c. Lemon Juice
d. Coffe grounds
Answer:
Scent and Taste work in conjunction because when your brain smells food, it pulls up a picture or memory of that food in your head, and you remember what it tasted like and if you enjoyed it.
Only some of the food. Salt does not really have a smell, so it does not do anything, but all the others do and are heightened
Explanation:
Take cotton candy for example. When you smell cotton candy, you smell SUGAR and lots of it. You know that sugar tastes good and as such you now want to eat the cotton candy.
For this example, we will use lemonade. Lemonade is commonly a drink that most love on a hot summer day at the beach. When you smell the lemonade, it reminds your brain of how good it tasted and pulls up the memory at the back of your mind, making you feel happy and relaxed. It then ends up tasting better
(This is my first answer, it won't be perfect)
Smell and taste go hand in hand because when you smell food, your brain conjures up an image or recollection of that food in your head, allowing you to recall how it tasted and if you liked it.
What is Conjuction?Since salt doesn't truly have a fragrance, it has no effect; nevertheless, all the others do and their intensity is increased.
You can definitely smell a lot of sugar when you smell cotton candy. You want to eat the cotton candy because you are aware that sugar tastes delicious.
On a hot summer day at the beach, most people enjoy drinking lemonade.
Therefore, Smell and taste go hand in hand because when you smell food, your brain conjures up an image or recollection of that food in your head, allowing you to recall how it tasted and if you liked it.
To learn more about conjuction, refer to the link:
https://brainly.com/question/25713213
#SPJ2