Mr. Carpenter built a wooden gate as shown: which is the closest to the length in feet of the diagonal board that Mr. Carpenter used to brace the wooden gate?

Mr. Carpenter Built A Wooden Gate As Shown: Which Is The Closest To The Length In Feet Of The Diagonal

Answers

Answer 1

The diagonal board that Mr. Carpenter used to reinforce the wooden gate measures 5.3 feet long in feet.

what is Pythagoras theorem ?

According to Pythagoras's Theorem, the square of the hypotenuse side in a right-angled triangle is equal to the sum of the squares of the other two sides.  The area of the square on the hypotenuse is equal to the product of the areas of the two squares on the legs (a and b) (c). Pythagoras, a Greek philosopher who was born around 570 BC, is honored in the name of the theorem. Perhaps more than any other mathematical theorem, the theorem has been demonstrated several times using a variety of techniques. A right-angled triangle's unidentified side can be discovered using Pythagoras' theorem.

given figure

width of gate = 3.5ft

length of gate = 6 ft

we have to find the length of diagonal board to brace the wooden plate

Length of gate after removing the 1ft margin = ( 6-2)ft = 4 ft

let the length of brace be x

x2= (3.5)2 + (4)2

x2 = 12.25 + 16

x2 = 28.25

x = 5.3

The diagonal board that Mr. Carpenter used to reinforce the wooden gate measures 5.3 feet long in feet.

To know more about Pythagoras theorem visit :-

https://brainly.com/question/14461977

#SPJ1


Related Questions

rewrite 24/7 as a mixed number

Answers

What is a fraction?

A fraction is a fragment of a whole number, used to define parts of a whole. The whole can be a whole object, or many different objects. The number at the top of the line is called the numerator, whereas the bottom is called the denominator.

To solve this, we would first need to see how many times 7 can fit into 24.

7 + 7 + 7 = 21.

We can see that is fits 3 times into 24, but what about the remaining 3? We can take that 3 and make it into a fraction of 7, making it [tex]\frac{3}{7}[/tex].

Now, putting the 3 and the 3/7 together, we get  [tex]3\frac{3}{7}[/tex].

(Look at picture) ty btw :)!!!!! <3

Answers

Answer:

the answer is in the picture

Determine what system, graph, colution and the slope and y intercept

4x = y - 6
4y = 3x -5

Answers

Answer:

System: A system of two equations that can be written in the form of y = mx + b where m is the slope and b is the y-intercept.

Graph: The graph of these two equations would be two straight lines in a coordinate plane.

Solution: The solution of the system would be the point where the two lines intersect on the coordinate plane, which represents the values of x and y that satisfy both equations.

Slope and y-intercept of 4x = y - 6:

Slope: 4 (m)

y-intercept: -6 (b)

Slope and y-intercept of 4y = 3x -5:

Slope: 3/4 (m)

y-intercept: -5/4 (b)

Note that the slope is the coefficient of x in the equation, and the y-intercept is the constant term in the equation. The solution can be found by equating the two equations and solving for x and y.

1/8 of a clockwise rotation is how many degrees?

Answers

Answer: 45 degrees

Step-by-step explanation:

1 clockwise rotation = 360 degrees

1/8 a clockwise rotation = 360/8 = 45 degrees

Will give brainliest!

Answers

Answer:

1. x = 10.46

2. y = 5.2

Step-by-step explanation:

1.

[tex]cos17^{0} =\frac{10}{x}[/tex]

[tex]x=\frac{10}{cos17^{0} }[/tex]

[tex]x=10.46[/tex]

2.

Angle F = 180 - 42 - 48 = 90° (is a right triangle)

[tex]sin48^{0} =\frac{y}{7}[/tex]

[tex]y=7sin48^{0}[/tex]

[tex]y=5.2[/tex]

Hope this helps

You roll a six-sided die.
Event A: Roll an odd number.
Event B: Roll a number less than 5.
Find P(A or B). Express you answer as a fraction in simplest form.

Answers

P(A or B) =

Formula: P(AUB)=P(A)+P(B)-P(A n B)

We roll six-sided die.

Then sample space ={1,2,3,4,5,6}

And

Event A: Roll an odd number.

Odd numbers are {1,3,5}

Event B: Roll a number less than 5

Number less than 5 are {1,2,3,4}

So, Probability P(A)=

Probability P(B)=

Now, the odd number which is less than 5 are {1,3}

So, P(A n B)=

Since P(AUB)=P(A)+P(B)-P(A n B)

Therefore, P(A or B) = 1/6

Scores on the MCAT exam are normally distributed with a mean
and standard deviation
. Use the 68-95-99.7% Rule to determine between which two values approximately 95% of MCAT scores fall?

Answers

95% of the scores fall within (mean - 2 * standard deviation) and (mean + 2 * standard deviation)

What is an empirical rule?

The empirical rule (68-95-99.7% Rule) states that for a normal distribution, 68% of the values are within one standard deviation from the mean, 95% of the values are within two standard deviation from the mean and 99.7% of the values are within three standard deviation from the mean

95% of the values are within two standard deviation from the mean = mean ± 2 * standard deviation = (mean - 2 * standard deviation, mean + 2 * standard deviation)

Find out more on empirical rule at: https://brainly.com/question/13859784

#SPJ1

The angles t the right are complementary angles determine the measures of 1 and 2

Answers

Can you give a clearer picture ?

What is the independent variable?





a) The number of cookies sold


b) The total number of money made at the bake sell

Answers

Answer:

A is what I think is a independent variable

Step-by-step explanation:

Well a independent variable is something that stands alone and does not change by the other variables you are trying to measure. So for example b would not be since it relies on the number of cookies sold to figure out the total of money made.

If q;2q+2;5q+3 form an arithmetic sequence, determine the value of q

Answers

The value of q in the arithmetic sequence is 1/2

What is arithmetic sequence?

An arithmetic sequence is a sequence where each term increases by adding/subtracting some constant k. This is in contrast to a geometric sequence where each term increases by dividing/multiplying some constant k. Example: a1 = 25. a(n) = a(n-1) + 5.

The common difference of arithmetic sequence is found by subtract subtracting the first from the second term. This means

d = 2q+2 - q = q+2

the sum of term is a(n) = a +( n-1)d

for third term it will be a(3) = q+ (3-1) q+2

a(3) = q +2(q+2)

the third term = 5q+ 3

5q+3 = q+ 2q+4 = 3q+4

5q+3 = 3q+4

collect like terms

5q-3q = 4-3

2q = 1

q = 1/2

therefore the value of q = 1/2

learn more about arithmetic sequence from

https://brainly.com/question/6561461

#SPJ1

It takes Alexa 40 minutes to get to school (14.4 km). What is her speed in km/min?

Answers

Answer:

0.36km/

Step-by-step explanation:

speed= distance/time

14.4km/40min

= 0.36km/min

Write 944 as a percent.

(Round to 3 decimal places if necessary.)

Answers

944 as a percent would be 94400%

G(x) is a piecewise function defined by: -3x x < 2. 12 x > = 2

G(0) =
G(2) =
G(4)=

Answers

The values of G(x), At x = 0, 2, 4 are G(0) = 0, G(2) = 12 and G(4) = 12.

What is a piecewise function?

A function that is piecewise defined by numerous subfunctions, each of which has a separate domain interval for which it is applicable.

Piecewise definition is more of an expression of the function than it is a property of the function.

Given, A piecewise function G(x) defined by,

- 3x, x < 2 and 12, x ≥ 2.

Therefore, The value of G(x), At x = 0 is,

G(0) = - 3(0).

G(0) = 0.

At x = 2 the function G(x) is,

G(2) = 12.

At x = 4, the function G(x) is,

G(4) = 12.

learn more about piecewise functions here :

https://brainly.com/question/12561612

#SPJ1

Look at picture <3 ty btw

Answers

Answer:

5, -2

Step-by-step explanation:

Determine if the triangles in each pair are similar. If so, write a similarity statement and state whether AAA, SAS, Or SSS

Answers

the triangle are congruent by AAA

What is congruent by AAA?

It can also be stated as the AAA (angle-angle-angle) similarity theorem, which states that two triangles have identical corresponding angles if and only if their corresponding sides are proportionate.given, ABC and XYZ, are congruent according to the AAA rule by looking at the image provided below. According to the AAA congruence rule, two triangles are said to be congruent if two of their respective sides and angles are equal to those of two other triangles and their respective sides and angles, respectively.

In the given two triangles,

The ratio of the sides are similar

And hence the angles are similar.

Hence the triangle are congruent by AAA

Learn more about congruent by AAA, by the following link.

brainly.com/question/9513034

#SPJ1

341.12 to 1 decimal place i did it but I'm not sure 50 points pls full explanation heres pic​

Answers

The approximation of 341.12 to 1 decimal place is 341.1.

How to Approximate a Number to 1 Decimal Place?

To approximate 341.12 to 1 decimal place, you can follow these steps:

Multiply the number by 10 to move the decimal point one place to the right.Round the resulting number to the nearest whole number.Divide the rounded number by 10 to move the decimal point one place to the left.

For example, if you want to approximate the number 341.12 to 1 decimal place, follow these steps:

341.12 * 10 = 3411.2

Round 3411.2 to the nearest whole number, which is 3411.

3411 / 10 = 341.1

Learn more about 1 decimal place on:

https://brainly.com/question/141857

#SPJ1

Answer:

341.1

Step-by-step explanation:

When you round to the first decimal place, or to the nearest tenth, the number in the hundredth point place will determine whether you round up or down. If the hundredths digit is a number between 5 and 9, round up to the nearest whole number. If it's a number between 0 and 4, you would "round down" by keeping the tenths place the same.

341.12

The number in the hundredths place is 2, which means that we would round down the first decimal place by keeping it the same:

341.1

Solve for a. 5(a – b) = 3(a + c)

Answers

Answer:

a=3c/2+5b/2

Step-by-step explanation:

First open parenthesis

5a-5b=3a+3c

Than subtract A's and add b and c's

2a=3c+5b

Divide by two

a=3c/2+5b/2

This question has two parts. First, answer Part A. Then, answer Part B. The question is below

Answers

Both relation (year, percent of men) and (year, percent of women) are functions.

What is a function?

A function is a relation between a set of inputs and a set of permissible outputs with the property that each input is related to exactly one output. Let A & B be any two non-empty sets; mapping from A to B will be a function only when every element in set A has one end, only one image in set B.

Now,

In given data

For every input (i.e. year) there is a unique output (i.e. percent of men/ percent of women)

Hence, Given relation (year, percent of men) and (year, percent of women) are functions.

To know more about functions visit the link

https://brainly.com/question/12431044?referrer=searchResults

#SPJ1

Jeremy has a gift card to use to buy comic books. Each comic book costs $5.25. The function f(x)=−5.25x+80 f ( x ) = - 5.25 x + 80 represents the remaining value of the gift card, in dollars, after purchasing x x books. Based on the function, determine All the true statements.

Answers

Jeremy needs an amount of $7.75 cash to buy 3 comic books.

What is the function?

The function is defined as a mathematical expression that defines a relationship between one variable and another variable.

The function f(x) = 5.25x − 8 represents the amount of cash required to purchase x comic books after using his gift card.

To determine the amount of cash Jeremy needs to buy 3 comic books, we can substitute 3 for x in the function f(x) = 5.25x − 8.

So, f(3) = 5.25(3) − 8 = 15.75 − 8 = 7.75

Therefore, he needs $7.75 cash to buy 3 comic books.

Learn more about the function here:

brainly.com/question/12431044

#SPJ1

The question seems to be incomplete the correct question would be:

Jeremy has an $8 gift card to use to buy comic books. Each comic book costs $5.25. The function f(x) = 5.25x − 8 represents the amount of cash required to purchase x comic books after using his gift card. How much cash does Jeremy need to buy 3 comic books?

for her average speed in km/h.
11 A train travels from Newcastle to Edinburgh at an average speed of 68 mph, correct
to the nearest whole number. The journey is 80 miles, to the nearest 10 miles.
Bryn says that the journey will definitely take less than an hour and a quarter.
a Show working to explain why Bryn is wrong.
b Calculate the shortest possible time it could take to complete the journey to the
nearest minute.

Answers

Bryn is wrong as he says that the journey will definitely take less than an hour and a quarter

time = 1.17 hours = 1 hour 42 minutes

What is speed?

The definition of speed is. a measurement of how quickly an object's location changes in any direction. Speed is defined as the ratio of distance to the amount of time it took to cover that distance.

Average speed= distance / time

time= distance /Average speed = 80/68  hours

time = 1.17 hours = 1 hour 42 minutes

So, Bryn is wrong as he says that the journey will definitely take less than an hour and a quarter.

To learn more about speed from the link

https://brainly.com/question/13943409

#SPJ1

Iris has 120 songs on her playlist. Each week, she downloads 4 new songs. How do I write an expression to show the total number of songs on Iris's playlist after w weeks

Answers

The expression to show the total number of songs on Iris's playlist after {w} weeks is → y = 120 + 4w.

What are algebraic expressions?

In mathematics, an expression or mathematical expression is a finite combination of symbols that is well-formed according to rules that depend on the context.

Mathematical symbols can designate numbers (constants), variables, operations, functions, brackets, punctuation, and grouping to help determine order of operations and other aspects of logical syntax.

Given is that Iris has 120 songs on her playlist. Each week, she downloads 4 new songs.

We can write the expression to show the total number of songs on Iris's playlist after {w} weeks as -

y = 120 + 4w

Therefore, the expression to show the total number of songs on Iris's playlist after {w} weeks is → y = 120 + 4w.

To solve more questions on algebraic expressions, visit the link below -

brainly.com/question/1041084

#SPJ1

Please help me asap!!

Answers

The two transformation that would map triangle ABC onto triangle A'B'C' include the following:

Dilation by a scale factor of 1/2 centered at the origin.A reflection over the y-axis.

What is dilation?

In Geometry, dilation is a type of transformation which typically changes the size of a geometric object, but not its shape.

Next, we would have TO apply a dilation to the coordinates of the preimage by using a scale factor of 1/2 centered at the origin as follows:

Ordered pair A (-2, 2) → Ordered pair A' (-2 × 1/2, 2 × 1/2) = Ordered pair A' (-1, 1).

Ordered pair B (-4, 2) → Ordered pair B' (-4 × 1/2, 2 × 1/2) = Ordered pair B' (-2, 1).

Ordered pair C (-4, 4) → Ordered pair C' (-4 × 1/2, 4 × 1/2) = Ordered pair C' (-2, 2).

Furthermore, by applying a reflection over the y-axis to the coordinates of triangle A'B'C', the image coordinates include the following:

(x, y)                               →              (-x, y)

Ordered pair A' (-1, 1)    →    Ordered pair A'  (-(-1), 1) = (1, 1).

Ordered pair B' (-2, 1)    →    Ordered pair B' (-(-2), 1) = (2, 1).

Ordered pair C' (-2, 2)    →    Ordered pair C' (-(-2), 2) = (2, 2).

Read more on dilation here: brainly.com/question/20482938

#SPJ1

The temperature at 1 am was 40 degrees. The temperature dropped steadily for the next 6 hours to reach the daytime low of 20 degrees. Create an equation for the relationship between temperature and the time.

Answers

The equation relating temperature and time is given by 3y = -10x + 130

What is an Equation of a line?

The equation of a line is expressed as y = mx + b where m is the slope and b is the y-intercept

And y - y₁ = m ( x - x₁ )

y = y-coordinate of second point

y₁ = y-coordinate of point one

m = slope

x = x-coordinate of second point

x₁ = x-coordinate of point one

The slope m = ( y₂ - y₁ ) / ( x₂ - x₁ )

Given data ,

Let the temperature be represented as y

Let the time be represented as x

Now , let the first point be P = P ( 1 , 40 )

Let the second point be represented as Q = Q ( 7 , 20 )

The slope of the line between the points m = ( y₂ - y₁ ) / ( x₂ - x₁ )

Substituting the values in the equation , we get

Slope m = ( 40 - 20 ) / ( 1 - 7 )

On simplifying the equation , we get

Slope m = -20/6

Slope m = -10/3

Now , the equation of line is y - y₁ = m ( x - x₁ )

Substituting the values in the equation , we get

y - 40 = ( -10/3 ) ( x - 1 )

On simplifying the equation , we get

y - 40 = ( -10/3 )x + 10/3

Adding 40 on both sides of the equation , we get

y = ( -10/3 )x + 130/3

Multiply by 3 on both sides of the equation , we get

3y = -10x + 130

when x = 1 am

3y = -10 + 130

3y = 120

y = 40 degrees

when x = 7am

3y = -70 + 130

3y = 60

y = 20 degrees

Hence , equation representing temperature and time is 3y = -10x + 130

To learn more about equation of line click :

https://brainly.com/question/14200719

#SPJ1

Amal, Brian, and Cami help clean Ms. Rivers’s house is she gives and $42.00 to share equally. Cami decides to save half her money and spend the other half. How much does Cami have to spend?

Answers

Answer:

Each of them will get 42/3 = $14.00

Cami saves half of her money which is 14/2 = $7.00

Cami has 14 - 7 = $7.00 to spend.

Cami has 7$ to spend
42/3=14
14/2=7

After solving the algebraic equation 10(y-13) = 10(y+13), you end up with -130= 130. What does
this mean?

Answers

Adding, Substracting, multiplication and division. If we add the same number to both sides of an equation, both sides will remain equal. That would make this equation algebra.

What is meant by algebra?With the use of mathematical expressions, algebra is the area of mathematics that helps to depict situations or problems. We employ integers that have a fixed or definite value in algebra, such as 2, 7, 0.068, etc. In addition to using numbers, algebra also makes use of variables like x, y, and z. mathematical signsElementary algebra, advanced algebra, abstract algebra, linear algebra, and commutative algebra are some of the sub-branches of algebra that are classified into.Basic algebraic ideas are covered by elementary algebra. Since algebra includes variables, it is sometimes compared to arithmetic, which works with predetermined numbers (quantities without fixed values).

Given data :

10(y-13) = 10(y+13)

y = 10*-13 = y = 10 * 13

-130 = 130

both sides will remain equal

Learn more about Algebra refer to :

https://brainly.com/question/4344214

#SPJ1

Please help me immediately I need this FAST

Answers

Step-by-step explanation:

Move the decimal point one place to the right

check my work pls im failing math and this paper needs to be right

Answers

Answer:

Step-by-step explanation:

1.

[tex]\displaystyle\\\frac{1}{5}x+15=-5 \\\\\frac{1}{5}x+15-15=-5-15\\\\\frac{1}{5}x=-20[/tex]

Multiply both parts of the equation by 5:

[tex]x=-100[/tex]

2.

[tex]4-3x=5\\\\4-3x-4=5-4\\\\-3x=1[/tex]

Divide both parts of the equation by (-3):

[tex]\displaystyle\\x=-\frac{1}{3}[/tex]

3.

[tex](3x)^0+(8x+70)^0=180^0\\\\(3x)^0+(8x)^0+70^0=180^0\\\\(11x)^0+70^0-70^0=180^0-70^0\\\\(11x)^0=110^0[/tex]

Divide both parts of the equation by 11:

[tex]x=10[/tex]

[tex]m\angle TRS=(8(10)+70)^0\\\\m\angle TRS=(80+70)^0\\\\m\angle TRS=150^0[/tex]

4.

[tex]\$ 25(5)+\$250=\\\\\$125+\$250=\\\\\$375[/tex]

5.

[tex]\displaystyle\\\frac{x}{15}=\frac{30}{18}[/tex]

Multiply both parts of the equation by 15:

[tex]\displaystyle\\x=\frac{30(15)}{18} \\\\x=\frac{450}{18}\\\\x=25[/tex]

5.1 mathematics for business

Answers

The inverse function would be x = (y + 3) / -3 and the domain of the inverse function would be (-infinity, -1/3].

What is the inverse function?

An inverse function is a function that "undoes" another function. The inverse function, denoted as f^-1, reverses the direction of the original function, so that if the original function maps x to y, the inverse function maps y to x.

To find the inverse function of a given function, you can switch the x and y variables and solve for y. The inverse function will also have a different domain and range than the original function.

For example, for the function y = 1 - 3x, where x belongs to the interval [-2, 2],

First, we need to switch the x and y variables to get x = 1 - 3y.

Now we need to solve for y,

y = (x + 3) / -3

So the inverse function of y = 1 - 3x, where x belongs to the interval [-2, 2], is

x = (y + 3) / -3

The domain of the original function is [-2, 2] and the range is (-infinity, -1/3], whereas the domain of the inverse function is (-infinity, -1/3] and the range is [-2, 2].

Hence, The inverse function would be x = (y + 3) / -3 and the domain of the inverse function would be (-infinity, -1/3].

To learn more about the inverse function, visit:

https://brainly.com/question/3831584

#SPJ1

Need REAL ANSWER WITH SOLUTION so i can study it please help me math experts.

Answers

3(2-1/2)^2(1+1/2^2)=3(3/2)^2(1+1/4)= 3(9/4)(5/4)=3(9)(5)/16

Solution

135/16

Option A


Brainly would be nice

Tyrell is traveling to Chicago, Illinois. He takes a cab service from the airport to his hotel. The table shows the linear relationship between the number of miles the cab travels, x, and the total fee, y.

Cab Fare
Number of Miles ---- Total Fee

2 Miles ---------------- $17.00

5 Miles ---------------- $21.50

7 Miles ---------------- $24.50

10 Miles ----------------$29.00

15 Miles ---------------- $36.50

What does the y-intercept mean in this situation?
A) When the cab travels 0 miles, the total fee will be $14.00.
B) When the cab travels 0 miles, the total fee will be $1.50.
C) For every additional mile the cab travels, the total fee increases by $14.00.
D) For every additional mile the cab travels, the total fee increases by $1.50.

Answers

The meaning of the y-intercept in this situation is that: A) When the cab travels 0 miles, the total fee will be $14.00.

What is the point-slope form?

Mathematically, the point-slope form of a straight line can be calculated by using this mathematical expression:

y - y₁ = m(x - x₁) or y - y₁ = (y₂ - y₁)/(x₂ - x₁)(x - x₁)

Where:

m represents the slope.x and y are the points.

Next, we would determine the linear equation representing the line and passes through the points (2, 17) and (5, 21.5) by using the point-slope form as follows:

y - y₁ = m(x - x₁)

y - y₁ = (y₂ - y₁)/(x₂ - x₁)(x - x₁)

y - 17 = (21.5 - 17)/(5 - 2)(x - 2)

y - 17 = 4.5/3(x - 2)

y - 17 = 1.5(x - 2)

y = 1.5x - 3 + 17

y = 1.5x + 14

Therefore, the y-intercept is equal to 14.

Read more on slope here: brainly.com/question/23086745

#SPJ1

Other Questions
What professional can help you prepare your income tax return? Read Voluntourism: an opportunity too good to be true and The Opportunity of a Lifetime and answer the questions.How are points developed? What is the claim? Is there a counterclaim? If so, what is it? How is it refuted or weakened? What is the effect of the identified devices or appeals? How does this device or appeal help achieve the purpose of the speech or text? What is the authors attitude toward the topic? How does the tone affect the audience? How does the tone help achieve the authors purpose? Which details are emphasized in each medium? What does the different emphasis reveal about the authors position and purpose? What is the effect of the different elements emphasized? a co-worker is to employee as a (n) is to a (n) What are the benefits brought by technology and explain why is it beneficial in the field of healthcare? A computer is performing a binary search on a sorted list of 20 items. What is the maximum number of steps it needs to find the item? the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25 Work out the equation of the line shownbelow.Give your answer in the form y = mx + c,where m and c are integers or fractions intheir simplest forms.Y-160-140--120--100-80-60-40-20--80 -70 -60 -50 -40 -30 -20 -10 0-20--40--60-80--100-120--140---160-10 20 30 40 50 60 70 80 x A 2kg block is attached to a spring for which k=200N/m, it is hold at an extension of 5cm and then released at t=0. Find the displacement as a function of time. The velocity , acceleration and total energy when x=+_ A/2. the lowest prices. the most product options. the fewest product options. superior value for the price. the bloch sphere geometric representation of a quantum state is parameterized by two angles and such that . what are the values of the angles and for the state Evaluate the expression for x = -8.x = 16, and x = 4.X 4 which nursing action is appropriate when providing care to a patient who experiences apiration because of enteral feedings A. I hiked on mountain paths, biked on wooded trails, and kayaked on clear ponds.B. These drones can soar, swoop, hover, and even make the buzzing sound of a housefly.C. Mr. Patel improves our school every day by teaching his classes well, he coaches his team well, he even gives personal advice and counseling to students who need it.D. We are kinder, more thoughtful, more conscientious, better students. The first category of evaluation and management codes is? Which of these is a new form of payment that has been recently accepted in some companies?A. CashB. CheckC. Credit CardD. Cryptocurrency 9800 workers in Arizona retired in 2010 as compared to 23,430 in 2009. What is the absolutechange in the number of workers that retired? evaluating a company's performance not only by its ability to generate economic profits but also by its impact on people and the planet. Triple bottom line T/F tatagcgtagctagct repeated in tandem over and over is a gene sequence that codes for a protein.