Please help ,
EXTRA POINTS‼️‼️‼️

Please Help , EXTRA POINTS

Answers

Answer 1

The answers for the given cell cycle and check point:

DHFCLBJEGKAIWhat are the answers for the given questions?The chromosomes are all lined up at the center of the cell by the spindle during metaphase, ready to divide.Telophase is the fifth and final phase of mitosis, the process that separates the duplicated genetic material carried in the nucleus of a parent cell into two identical daughter cells.Nuclear envelope collapse, or the disintegration of the nuclear envelope, takes place during prophase in higher eukaryotic cells.DNA replication causes the development of two identical sister chromatids for each chromosome, which are firmly connected at the centromere region during the S phase.A process known as DNA replication is used by a cell to copy its chromosomal DNA after every cell division. In the S phase, DNA is replicated, and in the M phase, the replicated DNA strands are precisely distributed to the two daughter cells.At the G2 checkpoint, the cell checksThe G1 checkpoint is situated just before the changeover to S phase, at the conclusion of G1 phase.Because of its spatial arrangement into tightly packed higher-order structures, chromatin condenses to a smaller volume.The centromere separates during anaphase, allowing the sister chromatids to divide.In the event that there were mistakes in the DNA replication during the S phase, the G2 checkpoint is employed to stop the cell from initiating mitosis.As a result of cytokinesis, animal cells develop cleavage furrows.

To know more about chromosomes, visit:

https://brainly.com/question/11912112

#SPJ1


Related Questions

During what stage does a cell 's nucleus divide to form two identical nuclei ?

Answers

Mitosis is the process through which a cell's nucleus divides into two new nuclei. During mitosis, one copy of the DNA is transferred to each of the two daughter cells.

Mitosis is a cell cycle step in which replicated chromosomes separate into two new nuclei. Mitosis produces genetically identical cells with the same number of chromosomes.

As a consequence, mitosis is also known as equational division. Mitosis is usually preceded by the S phase of interphase (during which DNA replication occurs) and is frequently followed by telophase and cytokinesis, which divides the cytoplasm, organelles, and cell membrane of one cell into two new cells with nearly equal proportions of these cellular components.

Learn more about Mitosis

https://brainly.com/question/29776367

#SPJ4

An electron occupies the lowest energy orbital that can receive it *

Answers

The lowest energy orbital that can receive an electron is the ground state orbital, which is the lowest energy state an electron can occupy.

This occurs when the electron is in its most stable configuration, meaning that it has the lowest possible energy and is in the lowest possible energy level. To reach the ground state, the electron must release any potential energy it has and move to the lowest energy level. In an atom, this is the closest orbital to the nucleus.

The ground state orbital is also known as the "fundamental state" because it is the most basic and fundamental state of an electron. The properties of the ground state orbital depend on the atom in question and its size. In general, the ground state orbital is the closest orbital to the nucleus and has the lowest energy level of the atom.

Learn more about electron visit:

https://brainly.com/question/25886015

#SPJ4

describe how the multiplication rule can be used to solve trihybrid crosses and other complex genetics problems

Answers

The probability of inheriting numerous, independently occurring genetic features simultaneously is determined by the product (or multiplication rule). By multiplying the odds for each genotype together, this likelihood is determined.

The results of genetic crossings can be predicted using the probabilistic concepts. Drawing a Punnett square can help identify the gene combinations that might emerge from a genetic cross. The dominant allele for tall is represented by a capital letter.

The product rule, which asserts that the likelihood of two (or more) independent occurrences occurring together may be determined by multiplying the individual probabilities of the events, is one probability rule that is highly helpful in genetics.

The product rule is often referred to as the "and" rule because it allows you to multiply the probabilities of two events to determine the likelihood of an outcome if both events X and Y are necessary for a specific outcome to occur and if they are independent of one another (i.e., their likelihoods are unaffected by one another).

The product rule can be used to forecast the frequency of fertilization occurrences.

To learn more about multiplication rule in genetics from given link

https://brainly.com/question/14933381

#SPJ1

fruit fly body cells have six chromosomes. how many chromosomes do fruit fly egg cells have?

Answers

Fruit fly eggs cells have four chromosomes.

a world without mosquitoes: eradicating any organism would have serious consequences for ecosystems--wouldn't it? not when it comes to mosquitoes

Answers

If mosquitoes are eradicated from the world, the consequences for ecosystems will be as follows:

Some species will experience food deficiency due to the lack of prey.Some plant will lose their pollinator.

What is the mosquito's role in the ecosystem?

Despite having negative impacts on humans by carrying dozens of diseases, mosquitoes have a quite major role in the food chain. They are relatively easy to catch, so they become the primary food source of many predators. Many species of spiders, salamanders, frogs, lizards, insects, fish, and others will lose their primary prey if mosquitoes go extinct. Some species of plant will also lose a significant number of pollinators.

Learn more about mosquitoes here https://brainly.com/question/27488225

#SPJ4

Which is a key difference between the glucose polysaccharides cellulose and amylopectin?

Answers

The kind of connections that hold the glucose molecules together in starch and cellulose are the main distinction between them.

Amylopectin is a branching molecule made up of alpha 1,4 and alpha 1,6-glycosidic connections, whereas amylose is a linear molecule made up of alpha 1,4-glycosidic linkages. Two different categories of branched polysaccharides are amylopectin and glucogen. Amylopectin and glycogen differ primarily in that amylopectin is an insoluble form while glycogen is a soluble form.

One of the two forms of starch, which is the primary structure of storage polysaccharides in plants, is amylopectin. The main distinction between starch and cellulose is this. In contrast to cellulose, where each succeeding glucose unit is rotated 180 degrees, starch repeat units are situated in the same direction.

Learn more about glucose Visit: brainly.com/question/9024243

#SPJ4

Correct Question:

What is the key difference between the glucose polysaccharides cellulose and amylopectin?

Which of the following organelles is responsible for the packaging of proteins for secretion?

A. Rough Endoplasmic Reticulum

B. Bound Ribosome

C. Smooth Endoplasmic Reticulum

D. Golgi Complex

Answers

Golgi Complex is responsible for the packaging of proteins for secretion.

Proteins obtained from the ER are further processed and sorted in the Golgi apparatus, or Golgi complex, where they are eventually transported to lysosomes, the plasma membrane, or secretion.

Proteins are sorted into the trans-Golgi network's controlled secretory pathway, where they are put together into specialised secretory vesicles. Larger than typical transport vesicles, these secretory vesicles hold their contents until particular signals cause them to fuse with the plasma membrane.

Proteins and lipids are moved, altered, and packaged into vesicles by the Golgi apparatus and delivered to specific locations. The secretory proteins may undergo a variety of chemical alterations as they pass through the Golgi apparatus.

Learn more about plasma membrane from:

https://brainly.com/question/14727404

#SPJ4

T/F batteries can be stacked as long as they are no more than two high.

Answers

The given statement 'Batteries can be stacked as long as they are no more than two high' is referred to as a false statement because it has no effect on the amount of voltage supplied.

What is a Battery?

This is referred to as a device which acts as a charge pump that stores chemical energy and converts it to electrical energy.

Batteries can be arranged in any way and stacked as high as as an individual wants without much effect in the performance as long as there is flow of charges. This is therefore the reason why stacking them as long as they are no more than two high can be referred to as a false statement in this type of scenario.

Read more about Battery here https://brainly.com/question/5059264

#SPJ1

The production of fsh by the anterior pituitary is reduced by which hormone?

Answers

The production of FSH (follicle-stimulating hormone) by the anterior pituitary is reduced by the hormone inhibin.

Inhibin is produced by the granulosa cells of the ovary in females and the Sertoli cells of the testes in males. It travels to the anterior pituitary and signals to reduce the production and release of FSH. This helps to regulate the balance of hormones in the body and prevent overstimulation of the ovaries or testes. Inhibin also plays a role in the regulation of the menstrual cycle in females, helping to prevent overstimulation of the ovaries and the formation of multiple follicles.

A protein called inhibin is secreted by the granulosa cells in women and the Sertoli cells in men. It decreases the amount of LH-releasing hormone in the hypothalamus and prevents the pituitary gland from producing and releasing follicle-stimulating hormone.

To learn more about inhibin, refer:-

https://brainly.com/question/13047026

#SPJ4

most fungi are capable of reproducing both asexually and sexually. what occurs during sexual reproduction?

Answers

During sexual reproduction in fungi, two compatible mating strains come into contact and exchange genetic material through the formation of specialized structures called mating hyphae.

These hyphae contain nuclei, and the exchange of genetic material occurs when the nuclei from two different hyphae fuse, forming a zygote. This zygote can then divide and give rise to a new individual with a unique combination of genetic information from both parents.

Sexual reproduction in fungi allows for the exchange and recombination of genetic material, increasing genetic diversity and providing a mechanism for adaptation to changing environments. The process of sexual reproduction can also help to repair damaged DNA and remove harmful mutations.

To learn more about sexual reproduction

https://brainly.com/question/7464705

#SPJ4

By what set of processes could water and carbon can be moved from the atmosphere to deep underground, and then back to the atmosphere again?

Answers

Answer:

Explanation:

For example, in the food chain, plants move carbon from the atmosphere into the biosphere through photosynthesis. They use energy from the sun to chemically combine carbon dioxide with hydrogen and oxygen from water to create sugar molecules.Feb 1, 2019

What is a polysaccharide made of?

Answers

Polysaccharides are produced by the glycosidic bond joining a large number of monosaccharides.

Polysaccharides are important types of biomolecules. They are lengthy chains of carbohydrate molecules made up of several smaller monosaccharides. These intricate bio-macromolecules serve as a major energy source in animal cells and as a structural component in plant cells. Depending on the kind of monosaccharide, it might be a homopolysaccharide or even a heteropolysaccharide. Polysaccharides can be either a straight chain of monosaccharides referred to as linear polysaccharides or a branched polysaccharide.

Polysaccharides serve as energy storage in organisms. Water cannot enter the molecules due to the existence of numerous hydrogen bonds, making them hydrophobic. They allow for variations in the concentration gradient, which regulates food and water intake by cells. Many polysaccharides generate glycolip.

To know more about the Polysaccharides, here

https://brainly.com/question/14826787

#SPJ4

What is the central idea of natural selection?

Answers

The central idea of natural selection is to help organisms adapt to their environment.

Natural Selection is the total change in the qualities of a living being or a populace over the course of the following ages. It is now and again summed up as plunge with change. Normal choice is one of the instruments that drives advancement.

To be a functioning trademark or quality making regular determination happen, the characteristic must have the accompanying elements:

Heritability. A quality can impact development through regular determination on the off chance that it is given from guardians to relatives.Usefulness. The characteristic high priority a capability. Qualities should work on something for regular determination to occur.Advantage. To be chosen for giving to relatives, the quality should present a benefit on the creature that has it, or make the organic entity more fit for endurance in its current circumstance.Beginning. The attribute probably made the creatures develop on the grounds that it made the organic entities that had it more fit for endurance. In the event that the life forms changed because of another system, for example, hereditary transformation, it was not because of regular determination.

To know more about natural selection, visit here:

https://brainly.com/question/2725702

#SPJ4

what happens if a cell divides with damaged present in its dna

Answers

If a cell has a mistakes in its DNA that can not be repaired, it could go through self-destruction (apoptosis ).

Apoptosis is a not a common technique for the duration of existence that facilitates the frame remove cells that now no longer paintings or that it would not need. Most DNA harm receives repaired right away due to those proteins. But if the DNA harm takes place to a gene that makes a DNA restore protein, a mobile has much less cap potential to restore itself. So mistakes will increase in different genes over the years and permit a most cancers to form. The cell cycle will now no longer continue to the following stage. Due to which the following department will now no longer happen. This will result in cell death. DNA harm can have an effect on everyday mobile replicative characteristic and effect fees of apoptosis (programmed mobile death, regularly stated as 'cellular senescence').

To learn more about cell check the link below:

https://brainly.com/question/3717876

#SPJ4

the portions of the nervous system outside the central nervous system.

Answers

The peripheral nervous system (PNS) is the portion of the nervous system that exists outside of the central nervous system (CNS). It is composed of all the nerves and ganglia that connect the CNS to the rest of the body.

This system is responsible for sending sensory information to the CNS, such as pain, temperature, and pressure, and for sending motor commands from the CNS to the muscles and glands.

The PNS is also involved in controlling reflexes, which are involuntary reactions to stimuli. It is divided into the somatic nervous system, which is responsible for voluntary control of skeletal muscles, and the autonomic nervous system, which is responsible for involuntary control of organs and glands.

The sympathetic nervous system and the parasympathetic nervous system are subsets of the autonomic nervous system. The enteric nervous system, which controls the digestive system, is also a part of the PNS.

Learn more about parasympathetic visit:

https://brainly.com/question/15190731

#SPJ4

A calorie is a _____________________.

Answers

Answer: b: measure of the amount of energy that a food provides.

Explanation: The body needs calories as to perform its functions, such as breathing, circulating the blood, and physical activity.

Answer:

B

Explanation:

because it measures the amount of energy you ate the amount of food provides

Your Best Friend

s183960

What type of mutation is point?

Answers

Answer on the explanation part

A point metamorphosis is a type of metamorphosis in Gene or Deoxyribonucleic acid, the cell’s hereditary material, at which point an individual distinct nucleotide base is added, removed, or changed. Chromosomes and Deoxyribonucleic acid are containing many nucleotides. Five various fragments can reconcile nitrogenous bases on nucleotides: cytosine, guanine, adenine, thymine (in DNA), and uracil (in Deoxyribonucleic acid), shortened C, G, A, T, and U. The distinguishing order of nucleotides encodes all the facts for completing activity all cell processes. Usually, a metamorphosis is when a deoxyribonucleic acid is changed through a change in Deoxyribonucleic acid makeup; this may apply even to complete portions of chromosomes. A point metamorphosis is particularly when alone nucleotide base is changed by some means, even though diversified point mutations can happen in an individual string of DNA or Deoxyribonucleic acid.

read more on point mutation

https://brainly.com/question/30280453

#SPJ4

How does marsh rabbit survival and cause of death differ in areas with and without pythons?​​


(PLEASE ANSWER CORRECTLY)

THANKS <3

Answers

Pythons compete with native wildlife for food, which includes mammals, birds, and other reptiles. Severe mammal declines in Everglades National Park have been linked to Burmese pythons.

What are the characteristics of pythons?

Python is a genus of constricting snakes in the Pythonidae family native to the tropics and subtropics of the Eastern Hemisphere. The name Python was proposed by François Marie Daudin in 1803 for non-venomous flecked snakes.

According to the pressure reading, the snake generated almost 300 millimeters of mercury or just under 6 pounds of pressure per square inch (psi) during constriction. “There's a myth that they squeeze their prey until they can't breathe anymore, but that's not accurate.

Pythons can't move very fast though—only about 1 mile per hour (1.6 kilometers per hour) on open ground. But since they don't have to chase their food, they don't really need to move quickly.

Learn more about pythons:

https://brainly.com/question/18502436

#SPJ1

1) At 15-C, a cell with a Y, of -7.0 bars and V, of -3.0 bars is placed in a beaker of 0.50 M sucrose. Calculate
the water potential for cell AND the solution in the beaker. Explain in which direction will the net water flow
and include a diagram to support your explanation.

Answers

In a beaker containing 0.50 M sucrose, a cell is inserted with a Y of -7.0 bars and a V of -3.0 bars. One of the elements of water potential is the solute potential, also referred to as osmotic potential.

How do you know which direction the net flow of water will be?

The equation s = -iCRT can be used to compute the potential of the solute. While there are solutes in solution, the solute potential always has a negative value. I denotes how many ions the solute dissociates (or fragments) into. The solute potential decreases with the number of ions the solute can separate into.

Net solvent flow is always in the direction of solute concentration, moving from the side with the lower concentration to the side with the higher concentration. The solution to the left of the membrane, thus, has a greater negative water potential than the solution to the right of the membrane. Water will therefore pass through the membrane from the right side to the left. Water always gravitates toward a lower water potential.

To learn more about solute potential refer to :

https://brainly.com/question/28691287

#SPJ1

according to video 4.4 the truth about hymens, what should the hymen be thought of?

Answers

The hymen can rupture for reasons unrelated to coital conduct, which is the truth about the hymen in a woman's coital anatomy.

At the base of your glans is a thin, fleshy membrane called the hymen. Like other parts of our body, hymens are particular to each person. Not all females possess a hymen. The right answer is therefore D, the hymen can rupture by something other than coital action. Most hymens contain at least one entrance for menstrual blood to travel through. Hymen: The hymen is a piece of tissue that remains inside the vaginal opening in females. It is a piece of the female reproductive system's vulva. The menstrual blood can leak out of the vagina through a hole in the hymens. The hymen can rupture for reasons unrelated to coital conduct, which is the truth about the hymen in a woman's coital anatomy.

Learn more about The hymen here:

https://brainly.com/question/13943311

#SPJ4

Some people refer to water as a renewable natural resource and others warn that it can be non-renewable. Use your understanding of the water cycle to defend both arguments.

Answers

Answer:

Explanation:

renewable: With careful management and responsible usage, water is a renewable resource.

Nonrenewable:

Non-renewable water resources are not replenished at all or for a very long time by nature. This includes the so-called fossil waters. Renewable water resources are rechargeable due to the hydrological cycle unless they are overexploited, comprising groundwater aquifers and surface water like rivers and lakes.

Based on the water cycle: Water as a renewable resource is depicted in this 18×24 inch poster. Water is renewed again and again by the natural hydrologic cycle where water evaporates, transpires from plants, rises to form clouds, and returns to the earth as precipitation

How can I increase gum in my knees?

Answers

You may have less joint fluid if you have a condition like arthritis. Regular exercise, a healthy diet, nutritional supplements, and joint injections may all help to improve or increase synovial fluid and reduce joint pain and inflammation.

The knee is one of the body's biggest and most complex joints. The knee joint connects the femur (thigh bone) to the shin bone (tibia).The smaller bone that runs alongside the tibia (fibula) and the kneecap are the extra bones that make up the knee joint (patella).

Tendons are fibrous bands that connect the bones of the knee to the leg muscles that move the knee joint. Ligaments connect the bones of the knee and offer support to the joint

Learn more about  knees to visit this link

https://brainly.com/question/28019830

#SPJ4

What is the key difference between test and negative control groups in an experiment? O The independent variable is not manipulated in a test group. O A negative control group has a known and expected response to manipulation O Subjects in a test group should have different characteristics than subjects in a negative control group. O The independent variable is not manipulated in a negative control group. Previous Next

Answers

The independent variable is not manipulated in a negative control group. this is the key difference between test and negative control groups in an experiment.

In a scientific experiment, a control group is a subset of participants who are kept apart from the other participants so that the results of the independent variable under study are unaffected. As a result, the effects of the independent variable on the experiment are isolated, and it may be possible to rule out other possibilities for the meaning of the results of the experiment. Another distinction that might be made is between positive and negative control groups. The experimental settings in positive control groups are those that ensure a favourable outcome. An experiment that has a positive control group can demonstrate that everything is going according to plan. The conditions of an experiment are set up to produce a negative outcome in groups designated as negative control groups.

learn more about negative control groups here

https://brainly.com/question/30277626

#SPJ4

what are some examples of cell processes that use atp

Answers

ATP (adenosine triphosphate) is the primary energy currency of cells, meaning it is used to power many different processes that are essential for the survival and function of cells.

Some examples of cell processes that use ATP include:

Active transport: The movement of molecules or ions across a cell membrane against a concentration gradient, which requires energy from ATP.Muscle contraction: The movement of muscle fibers, which requires the energy from ATP to power the movement of the myosin and actin.Protein synthesis: The process of building proteins, which requires the energy from ATP to power the chemical reactions that link amino acids together.DNA replication: The process of copying DNA, which requires the energy from ATP to power the chemical reactions that separate the DNA strands and build new onesEnzyme-catalyzed reactions: Many enzymes require the energy from ATP to work properly and catalyze specific reactions within the cell.Cellular respiration: The process of converting glucose and oxygen into carbon dioxide and water, which releases energy and generates ATP for the cell to use.Nucleic acid metabolism: The process of building, breaking down, and modifying nucleic acids.Secretory processes: Many cells secrete molecules, like hormones, neurotransmitters, enzymes, etc. which need energy from ATP to be transported across the cell membrane.Cell division: The process of mitosis and meiosis, which requires the energy from ATP to power the movement of chromosomes and the formation of new cells.

To learn more about ATP, refer:-

https://brainly.com/question/14637256

#SPJ4

Why do viruses need host cells?

Answers

As viruses are intracellular parasites, they depend on the host cell for energy, the macromolecular synthesis machinery, the workbench for genome replication and particle assembly.

Viruses are dependent on infected host cells to replicate. Outside the host cell, viruses exist as protein envelopes or capsids, sometimes enclosed in a membrane. The capsid surrounds DNA or RNA that encodes viral elements.

Viruses require host cells for genome replication. Viruses use host cells to carry out their replication and transcription processes. It is a molecule that contains genetic material and can only replicate within the living cells of another organism.The virus' genetic material controls the host cell and forces it to multiply. Viruses can infect all kinds of life forms, including plants, animals, and bacteria.

For more information on viruses, visit :

https://brainly.com/question/29156932

#SPJ4

Are the cells produced by mitosis genetically identical ?

Answers

Yes the cells produced by mitosis are genetically identical.

what is the importance of fermentation to cellular metabolism?
a. It reduces NADH to NAD+ in the absence of oxygen
b. It oxidizes NADH to NAD+ during electron transport. c. It generates glucose for the cell in the absence of oxygen. d. It oxidizes NADH to NAD+ in the absence of oxygen.

Answers

Answer:

The correct answer is option d): It oxidizes NADH to NAD+ in the absence of oxygen. Fermentation is an important part of cellular metabolism, as it allows cells to generate ATP in the absence of oxygen. During fermentation, NADH is oxidized to NAD+ in the absence of oxygen, which helps to generate ATP. Fermentation is an important part of cellular metabolism, as it helps to maintain energy production in the absence of oxygen.

give me brainiest

Which of the following is TRUE for the RNA polymerase activity? Explanation: RNA polymerase is also known as DNA dependent RNA polymerase enzyme and it involves a synthesis of RNA from DNA.

Answers

RNA polymerase, also referred to as DNA dependent RNA polymerase enzyme, produces RNA from DNA.

Ribosomal RNAs (rRNAs) are produced by RNA polymerase I, mRNAs and short regulatory RNAs are produced by RNA polymerase II, and transfer RNAs are produced by RNA polymerase III (tRNAs). DNA viruses use DNA-dependent DNA polymerases (also known as DNA polymerases) to replicate their genomes and DNA-dependent RNA polymerases to transcribe mRNA (also called RNA polymerases). The RNA polymerase is slower, less effective, and less accurate than the DNA polymerase, according to this definition. Illustration in graphic form of the RNA synthesis process utilizing RNA polymerase without primer.

To know more about  RNA polymerase, click here:

https://brainly.com/question/29664942

#SPJ4

9. Would an object with the most or the least kinetic energy result in the largest
crater volume? Explain.

Answers

Answer:

Because objects with larger mass have a larger potential energy, therefor it would have more kinetic energy compared to a less massive object dropped at the same height, thus creating a larger crater.

Wolves live in a grassland ecosystem with rabbits, their prey. if wolves emigrated, how would this impact the populations in this grassland ecosystem? the wolf population will increase. the producer population will increase. the rabbit population will increase. the rabbit population will decrease.

Answers

The emigration of wolves from a grassland ecosystem that supports rabbits, which are wolves' primary prey, will result in an increase in rabbit population in the ecosystem.

What is emigration?

Emigration occurs when an animal leaves its home because its habitat is no longer suitable for it and it needs to find a new home. Animals that migrate or emigrate do not return to their original habitat. Emigration is the process by which people leave one country to live in another. Emigration is the act of leaving one's home country with the intention of settling somewhere else. It is especially true of migration from one's home country to another. Emigration is the process by which a person leaves their home country to live permanently in another.

Here,

Wolf emigration from a grassland ecosystem that supports rabbits, wolves' primary prey, will result in an increase in rabbit population in the ecosystem.

To know more about emigration,

https://brainly.com/question/26165498

#SPJ4

Answer: the answer is C

Explanation: I took the test and got it right

Other Questions
On a separate sheet of paper, explain how the routeLewis and Clark followed ontheir return trip differed fromthe route they followed asthey set out moving west.Why do you think the twoexplorers split up for part ofthe route? PLEASE HELP!!! URGENT identify the reactants and products of photosynthesis Fell:compassionate ::broken Can a participle phrase function as an adverb? HELP ASAP!!!!! What is the value of the following expression?[6 4 + 50 (12 + 13) + 2] 3 What professional can help you prepare your income tax return? Read Voluntourism: an opportunity too good to be true and The Opportunity of a Lifetime and answer the questions.How are points developed? What is the claim? Is there a counterclaim? If so, what is it? How is it refuted or weakened? What is the effect of the identified devices or appeals? How does this device or appeal help achieve the purpose of the speech or text? What is the authors attitude toward the topic? How does the tone affect the audience? How does the tone help achieve the authors purpose? Which details are emphasized in each medium? What does the different emphasis reveal about the authors position and purpose? What is the effect of the different elements emphasized? a co-worker is to employee as a (n) is to a (n) What are the benefits brought by technology and explain why is it beneficial in the field of healthcare? A computer is performing a binary search on a sorted list of 20 items. What is the maximum number of steps it needs to find the item? the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25 Work out the equation of the line shownbelow.Give your answer in the form y = mx + c,where m and c are integers or fractions intheir simplest forms.Y-160-140--120--100-80-60-40-20--80 -70 -60 -50 -40 -30 -20 -10 0-20--40--60-80--100-120--140---160-10 20 30 40 50 60 70 80 x A 2kg block is attached to a spring for which k=200N/m, it is hold at an extension of 5cm and then released at t=0. Find the displacement as a function of time. The velocity , acceleration and total energy when x=+_ A/2. the lowest prices. the most product options. the fewest product options. superior value for the price. the bloch sphere geometric representation of a quantum state is parameterized by two angles and such that . what are the values of the angles and for the state Evaluate the expression for x = -8.x = 16, and x = 4.X 4 which nursing action is appropriate when providing care to a patient who experiences apiration because of enteral feedings