please help me asap


ty :)

Please Help Me Asapty :)

Answers

Answer 1

Answer:

y= 3x+16

Step-by-step explanation:

y = 3x + 8 ║ y= mx +b

Since lines are parallel, m=3

y= 3x+b

(-3, 7) intersect

7= 3*(-3) + b

b= 7+9

b= 16

y= 3x+16

Answer 2

Step-by-step explanation:

while the other answer is correct, here also the way as the hint suggests :

y - 7 = 3(x - -3) = 3(x + 3) = 3x + 9

y = 3x + 9 + 7 = 3x + 16

and there you have it : the same result just by using the point-slope form first.


Related Questions

a point f(–3, 1) is translated along the vector ⟨5, –1⟩.what are the coordinates of the image f′ ?

Answers

(2.0)

Hope this helped :)

Jamie joined the marching band. To pay for a uniform, he borrowed $120 for 3 months with 6% interest per month. What was the total cost of Jamie’s uniform?

Answers

Answer:

$142.92

Step-by-step explanation:

120 * 1.06^3 = 142.92192

Pointing to a photograph, a man said, "I have no brother, and that man's father is my father's son." Whose photograph was it?

Answers

The man’s son. Since the man has no brothers and the father of the man in the photograph is the man’s father’s son, the father of the man in the photograph must be the man. That means that the man in the photograph is the man’s son.

Set up a proportion and solve for x.
1) If I can make up one test in 30 minutes, how long will it take me to make 11 tests?
Can you please help this is due tomorrow and it’s almost Christmas break:((

Answers

30x11 is 330.

300mins

Sorry i'm a little tired, if you want ask me how i got it and show my work in the comments. Thanks u

For health reasons, Amir wants to drink eight
glasses of water a day. He's already had six
glasses. What fraction of eight glasses does
Amir have left to drink?
A. 1/8
B.1/6
C. 1/4
D.1/3

Answers

Answer is C, 1/4 left to drink. 6/8 reduces to 3/4, so 3/4 + 1/4 = 1 whole, or 8/8

Construct a bar graph for the relative frequencies given

Answers

yes this is not correct br

Find 110% of 80 by writing the percent as a fraction

Answers

Answer:

[tex]\frac{80}{100}[/tex] i think its 80 or 88

Step-by-step explanation:

so sorry if this is wrong

Answer:

88

Step-by-step explanation:

x / 80 = 110 / 100

Cross multiply

80 * 110 = 100x

8800 = 100x

Divide both sides by 100

88 = x

In a sale, a clothes shop reduces its prices by 30%.
A shirt usually costs $24.
How much is it in the sale?

Answers

Answer:

$16.80

Step-by-step explanation:

30% of 24 and the answer is subtracted from $24

a building 270 feet tall casts a 40 foot long shadow. if a person looks down from the top of the building, what is the measure of the angle between the upper end of the shadow and the vertical side of the building to the nearest degree? (assume the person's eyes are level with the top of the building)
A. 81°
B. 8°
C. 9°
D. 82°​

Answers

Answer:

A.

Step-by-step explanation:

Use tangent ratio

Answer:

A.

Step-by-step explanation:

Use tangent ratio

Which problem will have the greater quotient, 376.0 divided by 93 OR 376 divided by 93.01?

Answers

Answer: The first option.

Explanation: 376/93 = 4 4/94, while 376/93.01 = 4.04257606709....., which is less than 4 4/94, therefore the first option has the greatest quotient.

Please answer 1 and 2
Will mark brainliest!!!!

Answers

Answer:

parallelnot perpendicular

Step-by-step explanation:

1) It appears that coordinates of points on line P are (-6, 6) and (-2, 8). The slope formula tells us the slope of line P is ...

  m = (y2 -y1)/(x2 -x1) = (8 -6)/(-2 -(-6)) = 2/4 = 1/2

Coordinates on line O appear to be (0, 6) and (4, 8). Its slope is ...

  m = (8 -6)/(4 -0) = 2/4 = 1/2

The slopes of lines P and O are the same, so the lines are parallel.

__

2) It appears that points on line M are (0, 6) and (2, 2). Its slope is ...

  m = (2 -6)/(2 -0) = -4/2 = -2

Points on line K appear to be (0, 4) and (10, 10). Its slope is ...

  m = (10 -4)/(10 -0) = 6/10 = 3/5

If lines M and K were perpendicular, the product of their slopes would be -1. Here, it is (-2)(3/5) = -6/5 ≠ -1. Lines M and K are not perpendicular.

A shoe sales associate earned $300 in August. In September she earned 8% more than she did in August. How much did she make in September?

Answers

Answer:

she earned $324 in September

Answer:

she earned 240 dollars

Step-by-step explanation:

can you please mark me as brainlyist

Hurry plz!!! graph y= 5/3x - 9

Answers

Answer:

This is what it would look like! Hope this helps!

Help me with this!!! PLEASEEEEEEEEEEEEEEEEEEEE…………

Answers

The answer to this will be -1

i have questions up will mark brainliest

Answers

Answer:

what questions?

Step-by-step explanation:

Byron wants to sell the shells and makr a profit of 125%. What is 125% written as a fraction in lowest terms

Answers

Answer:

5/4

Step-by-step explanation:

125/100

(divide through by 25)

5/4

Arianna and Aryanna went out to lunch over the weekend. They decided to eat at the cheesecake factory in ridge hill. their bill came out to 40$. if they wanted to leave a 20% tip for there waitress how much will the tip be

Answers

Answer:

Step-by-step explanation:

First we need to find 20% of their bill-$40.

So we write a proportion with fractions.

20/100 = x/40

Then we cross multiply. So 40 and 20 will get multiplied, and 100 and x will get multiplied. We will get this:

800 = 100x

Divide both sides by 100 to solve this.

Then we will get:

$8 = x  or  x = $8

Now that we know 20% of the bill this will also represent the tip. Our tip is $8.

if it takes 10 people working at the same rate 5 hours to pick 300 apples, how many hours would it take 1 person to pick 300 apples

Answers

Answer:

50 hours

Step-by-step explanation:

10 times 5 is 50 so the answer is 50 hours

Which is not equivalent to 3/5

Answers

Answer: d.

15/24 is not an equivalent fraction of 3/5.

worth 10 points thankyou

Answers

Answer:

DCBA

Step-by-step explanation:

need help gotta turn in at midnight​

Answers

Answer:

c.

Step-by-step explanation:

If its isoceles, then LM is equal to LN. This means 3x-2 = 2x+1. 3x minus 2x is x. 2 plus 1 is 3. So x = 3. So it needs to be c or d. since LM and LN are the same answers, go to MN and find the answer. If you siubstitute 3 for x in 5x-2, then you get 13.

Two parallel lines are crossed by a
transversal.

Answers

Answer:

h = 60˚

Step-by-step explanation:

Look at where it shows the 120˚, and its verticle angle. Verticle angles are congruent, or the same meaning it's also 120˚.

Then go to its corresponding angle, which is next to the h. Corresponding angles are also congruent, or the same. I'll call this angle m to save time and hopefully confusion.

Now, h and m are supplementary angles, meaning they add up to 180˚.

180˚ - 120˚, or 60˚ is your answer.

h = 60˚

The solution is, the value of h is, h = 60˚

What is an angle?

In Plane Geometry, a figure which is formed by two rays or lines that shares a common endpoint is called an angle. The two rays are called the sides of an angle, and the common endpoint is called the vertex.

here, we have,

from the given figure, we get,

Look at where it shows the 120˚, and its vertical angle.

Vertical angles are congruent, or the same meaning it's also 120˚.

now, we have,

Then go to its corresponding angle, which is next to the h. Corresponding angles are also congruent, or the same.

We call this angle m to save time and hopefully confusion.

Now, h and m are supplementary angles,

meaning they add up to 180˚.

so, we have,

180˚ - 120˚,

or 60˚ is your answer.

i.e.

h = 60˚

Hence, The solution is, the value of h is, h = 60˚

To learn more on angle click:

brainly.com/question/28451077

#SPJ7

DOM
The weight of a car is modeled with the polynomial 3x2 – 25x + 204. The weight of a truck is modeled with the polynomial x² + 17x + 40
What polynomial represents the total weight of the car and truck?

Answers

Answer:

4x^2-8x+244

Step-by-step explanation:

Help me with this please!!!!

Answers

331776 I think sorry if wrong

Answer:

je suis désolé je ne vois pas bien

Step-by-step explanation:

et aussi je ne comprend pas l'anglais

(3x-16) = (6x+7) = (11y-32)

Answers

Answer:

11y = -32  

Step-by-step explanation:

Please help me Find the slope please no links or bots please and thank you please actually help me please

Answers

I got C

To find slope, you have to use Rise over run
For this example, you would go down One and Run 2 so it’s -1/2

what is pls help someone with the problem?2x + 3 = 9

Answers

Answer:

3

Step-by-step explanation:

2x+3=9

2x=9-3

2x=6

2    2

x=3

Answer: x = 3

Step-by-step explanation: 2x+ 3= 9

                                             2x +3 -3 = 9 - 3

                                             2x = 6

                                             2x/2 = 6/2

                                             x = 3

Someone please help me

Answers

the answer for this question is -3

Please help I forgot how to do this completely

Answers

Step-by-step explanation:

9x+79+56=180(sum of angles of triangle)

9x+135=180

9x=180-135

x=45÷9

x=5

Graph the line y= 2/3x +1

Answers

Step-by-step explanation:

Given the linear equation, y = ⅔x + 1, where the slope, m = ⅔, and the y-intercept, (0, 1) where b = 1.

Start at the y-intercept:

In order to graph the given linear equation, start by plotting the coordinates of the y-intercept, (0, 1). As we know, the y-intercept is the point on the graph where it crosses the y-axis. It coordinates are (0, b), for which the value of b represents the value of the y-intercept in slope-intercept form, y = mx + b.

Plot other points using the slope:

From the y-intercept, (0, 1), we must use the slope, m =  ⅔ (rise 2, run 3) to plot the other points on the graph. Continue the process until you have sufficient amount of plotted points on the graph that you could connect a line with.

Attached is a screenshot of the graphed linear equestion, which demonstrates how I plotted the other points on the graph using the "rise/run" techniques" discussed in the previous section of this post.    

[tex]\huge\boxed{Hello,\:hope\:you\:are\:having\:a\:wonderful\:day.}[/tex]We are asked to graph the line y=2/3x+1.

2/3 is the slope of this line (Rise/Run)

The rise is how many units we move up; the run is how many units we move left or right.

For this line, 2 is the rise, and 3 is the run.

Now, 1 is the y-intercept. (where the graph touches the y-axis)

First, plot this point: (0,1)

Then, move 2 units up and 3 to the left (Up 2, over 3, up 2, over 3)

When you have a line, take a ruler and connect these points, and you will have the graph of y=2/3x+1.

[tex]\huge\bold{Hope\:it\:helps!}[/tex]

[tex]\huge\mathfrak{LoveLastsAllEternity}[/tex]

[tex]\huge\sf{Good\:luck}[/tex]

Other Questions
Why do regions/places have different types of climates? Try to give an example in your answer (PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What does the narrators description of the wallpaper reveal about the context of the story? The narrator feels imprisoned by her life. The narrator wants everyone to study the wallpaper. The narrator thinks that the wallpaper hides a secret room. The narrator prefers to do her writing work at night. Which phrase best describes the harlem renaissance?. Which graph could potentially have a correlation coeffiecient (r value) of 0.95? According to his running log, Baldwin averaged 4 miles per week last month and 25% more this month. How much did he average this month? can hellp me with this plzzzzzzz no links plz how are continental climates different from temperate climates Which word from Juliet's conversation with her mother is understood oneway by Lady Capulet and another way by the audience?A. CousinB. HeartC. TemperD. Love When corn is to be planted by the Indians, it is the work of the women folk to see to the sorting and cleaning of the best seed. It is also the women's work to see to the planting. (This was in olden times.)After the best seed has been selected, the planter measures the corn, lays down a layer of hay, then a layer of corn. Over this corn they sprinkle warm water and cover it with another layer of hay, then bind hay about the bundle and hang it up in a spot where the warm rays of the sun can strike it. While the corn is hanging in the sun, the ground is being prepared to receive it. Having finished the task of preparing the ground, the woman takes down her seed corn, which has by this time sprouted. Then she proceeds to plant the corn. Before she plants the first hill, she extends her heavenwards and asks the Great Spirit to bless her work, that she may have a good yield. After her prayer she takes four kernels and plants one at the north, one at the south, one at the east and one at the west sides of the first hill. This is asking the Great Spirit to give summer rain and sunshine to bring forth a good crop. For different growths of the corn, the women have an interpretation as to the character of the one who planted it.1st. Where the corn grows in straight rows and the cob is full of kernels to the end, this signifies that the planter of this corn is of an exemplary character, and is very truthful and thoughtful.2nd. If the rows on the ears of corn are irregular and broken, the planter is considered careless and unthoughtful. Also disorderly and slovenly about her house and person.3rd. When an ear of corn bears a few scattering kernels with spaces producing no corn, it is said that is a good sign that the planter will live to a ripe old age. So old will they be that like the corn, their teeth will be few and far between.4th. When a stalk bears a great many nubbins, or small ears growing around the large one, it is a sign that the planter is from a large and respectable family.After the corn is gathered, it is boiled into sweet corn and made into hominy; parched and mixed with buffalo tallow and rolled into round balls, and used at feasts, or carried by the warriors on the warpath as food. When there has been a good crop of corn, an ear is always tied at the top of the medicine pole, of the sun dance, in thanks to the Great Spirit for his goodness to them in sending a bountiful crop.Required:In one to two sentences, explain what the reaction of the Sioux to a good crop shows about the Sioux people. 1) 0.52 + 1.6 + 8.26 =2) 1.4 + 5.98 + 9 + 0.39 =3) 4.45 + 7 + 0.049 =4) 12.54 1. 054 =5) 0. 685 0. 5903 =6) (34. 89) (0.875) =7) (840) (0.625) =8) 28.5 0.87 =9) 104 6.4 = how does one make a plush design for a character with floating limbs metabolism is the chemical process your body uses to breakdown and transform food Help help help help help A number is chosen uniformly at random from among the positive integers less than $10^8$. Given that the sum of the digits of the number is 9, what is the probability that the number is prime Plays tell stories and have characters with conflict. They are written:to be performed on stageto be read silentlyto be ignoredall of the above