Please help me.
We talked about 2 examples of chronological order. Pick one and explain why chronological order is important:

Answers

Answer 1

Answer:

I believe Chroniclogical order is important to organize history and to track recent events. Without Chroniclogical order we wouldn't know Monday comes before Tuesday.

Explanation:


Related Questions

Who was the first African American to be a lawyer in Florida?

James Weldon Johnson
Lue Gim Gong
Mary McLeod Bethune
Vicente Martinez Ybor

Answers

Explanation:

Joseph E. Lee. He was the first black lawyer in florida to practice with an actual law degree

You can go j góōgle and it will tell you everything

Analyze the following chart to answer question 38.

38. Which court system is established between the federal and state courts?
a. a dual court system
b. a federal court system
c. an independent court system
d. a supreme court system

Answers

I am pretty sure it is d
The answer is D, a Supreme Court system

can someone help me with the last part please ;-;

Answers

Answer:

Explanation:

I HAVE EDITED THIS TO HAVE NAMES.

For New York City, it is the birthplace of salsa music.

Marc Anthony

Atlanta's music is hip-hop.

OutKast

The Mid-west music is the blues.

Muddy Waters

The West's music is rock- think Seattle's grunge

Soundgarden

The person above is corrected

Which of the following is filed when a Supreme Court asks to review a decision of a lower court?

a. summary judgment
b. court order
c. petition for writ of certiorari
d. judicial review

Answers

i think it is c. petition for writ of certiorari

Answer:

c

Explanation:

Writ Petition is an order by a higher court to lower court or courts directing them to act or stop them from doing an activity.

How will you promote proper functioning of the human body systems?

Answers

Answer:

eating healthy staying active and getting enough rest

Eating healthy Working out getting enough water and getting the proper amount of sleep.

Read and analyze the excerpt below to answer the question.

President Gerald Ford made this observation about the presidency:

“You know, the President of the United States is not a magician who can wave a wand or sign a paper that will instantly end a war, cure a recession, or make bureaucracy disappear.”

What point was President Ford making in this remark?

a. No one can do a good job of being President.
b. The President’s power is limited.
c. The federal bureaucracy is too big.
d. The President should have more power.

Answers

Answer:

B. The author makes multiple references on how the President cant do alot of things. This lead me to believe that it is B

B the conusition was made to limit power which still stands for reasons

(HELP FAST) How can a state law such as the parent rights law in Florida, affect other levels of government?

Answers

Answer:

If more than one city agrees to something, then that makes the government pay attention to it.

Explanation:

If more than one city agrees on some thing the government will start to pay attention to them

What do traditional scientists accept as the age of the Grand Canyon, and what new age is being proposed?

Answers

Answer:    A new study, detailed in the journal Geology, argues that geological evidence still supports the long-standing age of 6 million years. Some scientists believe that the Grand Canyon is 70 million years old.

Explanation:

Research. 6 million years is for the first question and 70 million years is for the second guestion.

70 million years hope this helps

Can you guys please help me answer this question please
Compare cytoplasm to open land

Answers

A pool
Bc water filled just the same as a cell

please match the year to the event. WILL GIVE BRAINLESTS

Answers

1665: Robert Hooke coined the word Cell
1855: Virchow says all cels come from pre existing ones
1835: Schwann and Schlieden collaborated
1670’s: Leeuwhenok worked with microscopes

Answer:

1839- Schwann and schleiden collaberated on the cell theory. The cell is the basic building of block for life. All living things are made up of one or more cells.

1855-Virchow says all cells come from pre-exciting cells.

1670’s-Leeuwenhoek worked with higher-powered microscopes too see many more details of the cell.

1665- Robert Hooke coined the term “cell”.

hope This helps!✌️

I NEED THE ANSWER WILL MARK BRAINLIEST!!!! DON'T ANSWER FOR POINTS PLEASE! Why do humans seem to need the belief of a god/gods?

Answers

Well humans are born into culture then they believe what they are told as kids and alot of times adults are haveing a pretty rough time then belive into god because they think it will make them feel better
To get into a place called heaven. Also because their parents might have converted them into believing in god.

Can someone pls write a dairy entry from John Gower about writing one of his poems or books pls

PLS help this is due in 2 hours and I have no idea how to do it

Answers

Answer:

[tex] \huge{ \mathrm{question \hookleftarrow}}[/tex]

John Gower is an English poet, He is remembered primarily for three major works, the Mirour de l'Omme, Vox Clamantis, and Confessio Amantis, three long poems written in French, Latin, and English respectively, which are united by common moral and political themes. Geoffrey Chaucer respected and admired Gower and his work so much that he gave him a medieval version of a modern day shout out in his poem Troilus and Criseyde, which he dedicated in part to 'moral Gower. ' Details about Gower's life are a bit murky.

Read and analyze the following excerpt from the Constitution of the United States to answer questions 23-24.

Article II: Section 2.

Clause 1: The President shall be Commander in Chief of the Army and Navy of the United States, and of the Militia of the several States, when called into the actual Service of the United States; he may require the Opinion, in writing, of the principal Officer in each of the executive Departments, upon any Subject relating to the Duties of their respective Offices, and he shall have Power to grant Reprieves and Pardons for Offences against the United States, except in Cases of Impeachment.
Clause 2: He shall have Power, by and with the Advice and Consent of the Senate, to make Treaties, provided two thirds of the Senators present concur; and he shall nominate, and by and with the Advice and Consent of the Senate, shall appoint Ambassadors, other public Ministers and Consuls, Judges of the supreme Court, and all other Officers of the United States, whose Appointments are not herein otherwise provided for, and which shall be established by Law: but the Congress may by Law vest the Appointment of such inferior Officers, as they think proper, in the President alone, in the Courts of Law, or in the Heads of Departments.
Clause 3: The President shall have Power to fill up all Vacancies that may happen during the Recess of the Senate, by granting Commissions which shall expire at the End of their next Session.
——————————————————————————————————————————————
23. The Constitution gives the President the power over the Army and Navy, which implies which of the following?

a. he also has power over the rest of the armed forces created since
b. he can declare war when he deems it necessary
c. he has to serve in the armed forces
d. he has power over money spent on the armed forces
——————————————————————————————————————————————
24. The roles of the Presidency of the United States are not all listed in the Constitution of the United States. Which role of the President is not named under Article II?

a. Party Leader
b. Commander in Chief
c. Legislative Leader
d. Chief Executive

Answers

I’m pretty sure 23 is A and 24 is A
I’ll go with 23.D and 24.A

NEED ASAP
which economic system is driven by competition and became popular during the industrial revolution
A. socialism
B. communism
C. democracy
D.capitalism

Answers

Answer:

B. Communism

Explanation:

hopefully this is correct!

It’s D Capitalism because capitalists began to dominate the economies of many countries during the Industrial Revolution.

Compare and Contrast the Middle East and Africa.
Make connections using prior knowledge.

Answers

Answer: The Middle East and North Africa are two regions that are often grouped together because they have many things in common. Islam is the dominant religion in the area and almost everyone speaks Arabic. Most of the Middle East and North Africa is composed of desert land where very little rain falls.

Explanation:

Answer:

Common thing is The Middle East and North Africa are two regions that are often grouped together because they have many things in common. Islam is the dominant religion in the area and almost everyone speaks Arabic. Most of the Middle East and North Africa is composed of desert land where very little rain falls. Difference is The usual line taken to divide Africa from Asia today is at the Isthmus of Suez, the narrowest gap between the Mediterranean Sea and the Gulf of Suez, the route today followed by the Suez Canal.The usual line taken to divide Africa from Asia today is at the Isthmus of Suez.

Explanation:

What did author Marjorie Kinnan Rawlings write about?

Answers

Her best known work, The Yearling, about a boy who adopts an orphaned fawn, won a Pulitzer Prize for fiction in 1939 and was later made into a movie of the same name. The book was written long before the concept of young adult fiction, but is now commonly included in teen-reading lists.

Match the pairs of equivalent expressions.

Answers

Answer:

7t-22 and 3(3t-4) - 2(t+10)

5(2t+1) + (-7t+28) and 3t+33

(-9/2t + 3) + (7/4t +33) and -11/4t +35

and then the last two left!

I conquer with the other answer

based on this excerpt from fredrick lugard,identify his point of view concerning british colonialism in Africa

Answers

Answer:

Can you add a picture of the excerpt?

Explanation:

Write a paragraph stating the difference between the position of Indian President and
American President.(H.O.T.S)

Answers

The President of India is head of the state. He is indirectly elected by the MPs and the MLAs. He is appointed for 5 years, while American Presidents are appointed for 4. The President of America is elected by the people. He usually chooses and appoints his ministers. This is called Presidential form of government.

The office of president was created when India became a republic on 26 January 1950, when its constitution came into force. The president is indirectly elected by an electoral college comprising both houses of the Parliament of India and the legislative assemblies of each of India's states and territories, who themselves are all directly elected.

The Constitution succinctly defines presidential functions, powers, and responsibilities. The president’s chief duty is to make sure that the laws are faithfully executed, and this duty is performed through an elaborate system of executive agencies that includes cabinet-level departments. Presidents appoint all cabinet heads and most other high-ranking officials of the executive branch of the federal government. They also nominate all judges of the federal judiciary, including the members of the Supreme Court. Their appointments to executive and judicial posts must be approved by a majority of the Senate (one of the two chambers of Congress, the legislative branch of the federal government, the other being the House of Representatives). The Senate usually confirms these appointments, though it occasionally rejects a nominee to whom a majority of members have strong objections. The president is also the commander in chief of the country’s military and has unlimited authority to direct the movements of land, sea, and air forces. The president has the power to make treaties with foreign governments, though the Senate must approve such treaties by a two-thirds majority. Finally, the president has the power to approve or reject (veto) bills passed by Congress, though Congress can override the president’s veto by summoning a two-thirds majority in favour of the measure.

A graphic which has a box in the middle that says Branches of U.S. Government. There are three boxes surrounding the middle box. Box one upper left hand corner contains the following: Legislative Branch, Facts followed by the letter A, Responsibilities followed by the letter B. Box two upper right hand corner contains the following: Letter C followed by the word Branch, Facts followed by the letter D, Responsibilities followed by the letter E and Leads the military. Box three below the middle box contains the following: Letter F followed by the word Branch, Facts followed by the letter G and Members serve for life, Responsibilities followed by the letter H. © 2011 FLVS Study the image above. Which of the following should you place on the line labeled "F"? Judicial Congress Executive Legislative

Answers

Answer: federal Judges

Explanation:

Rationale: Let’s talk about the president. The leader of the executive branch has lots of responsibilities. One of those responsibilities is to appoint federal judges.

Analyze the following excerpt to answer question 37.

First Congress. Sess I. Ch. 20. 1789.
Chap. XX. – An Act to establish the Judicial Courts of the United States.(a)
Sec 2. And be it further enacted, That the United States shall be, and they hereby are divided into thirteen districts, to be limited and called as follows, to wit. one to consist of that part of the State of Massachusetts which lies easterly of the State of New Hampshire, and to be called Maine District; one to consist of the State of New Hampshire, and to be called New Hampshire District; (c) one to consist of the remaining part of the State of Massachusetts, and to be called Massachusetts district...
Sec 3. And it be further enacted, That there be a court called a District Court, in each of the afore mentioned districts, to consist of one judge, who shall reside in the district for which he is appointed, and shall be called a
District Judge, and shall hold annually four...

What was the main reason for the enactment of the Judiciary Act of 1789?

Source: constitution.org

a. state borders
b. appointment of judges
c. district levels
d. lower courts system

Answers

Answer:

D

Explanation:

George Washington signed the bill that created and provided the laws having to do with the Supreme court.

Congress was left with the job of creating the lower courts in the districts (like Massachusetts in this example). The answer is D

A. State borders
Definitely not lower court systems

What are the main similarities and differences in how Muslims and Christians view Jesus? Provide your answer in one paragraph. ( For my SS/History Finall)

Answers

Muslims believe that Jesus was not the son of god while Christian’s believed this (tell me if you need more information
Both Muslims and most Christians believe Mary was a virgin and that Jesus was born miraculously. Islam and Christianity both ascribe that Jesus Christ was the promised Messiah and did perform miracles. Both Muslims and Christians believe Satan is real and evil and that he tries to make people follow him instead of God. Muslims believe Jesus is a prophet; whereas Christians worship Jesus as the son of god . Muslims believe Jesus ascended into heaven, but did not die on the cross. Christians believe in both the resurrection and ascension of Jesus. Muslims believe in the sin of Adam and Eve, but not the idea of inherited sins for all.



Sorry this is a lot more than one paragraph
Happy holidays hope this helped

Explain why you think the problem you ranked as number
1 was the main reason the empire fell. Give specific
examples from the lesson to support your reasoning.

Answers

what is the lesson plan for the assignment ? attach it

Who were the Conquistadors?

Answers

Answer:

Conquistadors or conquistadores were the invaders, knights, soldiers, and explorers of the Spanish and the Portuguese Empires.

The article “Saving the Ganges” contains both facts and opinions. Facts are statements that can be proved or verified to be true. Opinions are statements of belief or judgment that cannot be proved and that differ among people.

List five facts the article tells you about the Ganges. For each fact, suggest some possible sources where the information might be found and verified.

Answers

Answer:

Geography and the Early

Settlement of India

INTERACTIVE STUDENT NOTEBOOK

How did geography affect early settlement in India?

You are part of a group of people living in ancient times. Your group needs to move,

and you have been chosen to find a new location for resettlement. You travel until

you find the perfect spot. No one lives there, and it has everything your group

needs. What a location! Now you have to convince the others that this is the right

place for your group’s new home.

In the space below, draw and label a picture of the place you have chosen. Show the

types of features and characteristics that make this an ideal place to settle

Explanation:

can someone help me with this document based question 7th grade

Answers

Answers :

2A. The Stamp Act

2B. Parliament believed they had the right to tax the colonies.

2C. They decided to require several kinds of taxes from the colonists to help pay for the French and Indian War.

Answer:

just answer the question its not that hard

Explanation:

Listed in the Item Bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into the correct column. Order does not matter.

Answers

Answer: the first 4 go to the first one the second row the second word

Explanation:

i took this class 2 years ago

Conduction example are grabbing a warm mug to warm your hands, warm water rising over an ocean, convection examples are an oven that cooks by cycling warm air to the bottom and radiation examples are putting ice on injury.

What is conduction convection and radiation ?

Conduction, convection and radiation all deals with transfer of heat / thermal energy i.e. Conduction is by direct contract, convection is with movement of matter and radiation through electromagnetic waves.

These fall under conduction-grabbing a warm mug to warm your hands, warm water rising over the ocean and cooler water sinking, the handle of a pot becoming hot to grab when on the stove, popcorn in a microwave.

These fall under convection-oven that cooks by cycling warm air through the bottom and out the top, Heat from the sun hitting a solar panel, warm air rising off the pavements.

These fall under radiation-putting ice on an injury, burning yourself by touching boiling water, heat from fire warming your hands,

Therefore, option 2,4,7,8 option fall under conduction, option 1,9,10 fall under convection and option 3,5,6 fall under radiation.

Learn more about conduction, convection and radiation here:

https://brainly.com/question/7123951

please fill out each blank spots with the words
Subject: Science/Cell Theory

Answers

Answer:

1. Rober Hooke

2. Microscope

3. I think it's ''He''

4. cells

5. life but not too sure

Who were the Boston Associates?
Businessmen who recruited factory workers
Slave traders
Anti-slavery publishers
Politicians

Answers

Answer:Businessmen who recruited factory workers

Explanation:

which country has the most revolutionary history ?

Answers

Answer:

[tex]\huge\purple{\overline{\quad\quad\quad\quad\quad\quad\quad\quad\quad \ \ \ }}[/tex]

Which country has the most revolutionary history?

The American country has the most revolutionry history.

#CarryOnLearning

Other Questions
Understand how to work with negative bases and negative exponents.5^2 = 5^-2 = (-5)^2 = - 5^2 = (Remember to find the base, then multiply.) Does anyone know the answer for this question? I really need it. ______ is an example of a TCS food.A whole watermelonChickenBreadUncooked (dry) rice A piecewise function is represented by the graph below.On a coordinate plane, a piecewise function has 2 lines. The first line is made up of 2 lines. One line goes from (negative 5, 3) to (negative 1, negative 1) and then goes up to a closed circle at (1, 1). The second line has an open circle at (1, 2) and then continues up through (3, 4).What is the domain for the piece of the function represented by f(x) = x + 1?x < 11 x 11 x < 2x > 1 Termina cada conversacin para indicar que la segunda persona est de acuerdo con la primera. 8. Carolina: A m no me gusta limpiar (to clean) la casa. Miguel: A m ____________________________. Immersive Reader(1 Point)tambientampoco Exam GuidelinesExam InstructionsQuestion 4 of 20:Select the best answer for the question.4. Which of the following statements about writing introductions and conclusions is true?O A. Always write the body paragraphs and the conclusion before going back to write the introduction.B. If you have trouble beginning with the introduction, write the body paragraphs first.C. If you're writing a research paper, you don't need an introduction or a conclusion.D. Always write the introduction first and the conclusion last.Mark for review (Will be highlighted on the review page)> Is this statement true or false?Impressionist paintings by John Twachtman depict a moment in time.truefalse What happend when matter condenses??Plzz Answer??? Is this table proportional?XY1 3 34 125 157 21 Your engineering department is asked to evaluate the performance of a new 370-hp sports car. You know that 27% of the engine's power can be converted to mechanical energy of the 1200-kg car, and that the power delivered is independent of the car's velocity. What do you report for the time it will take to accelerate from rest to 60 mi/h on a level road? A geriatric team wants to involve the patients family in his or her care. When is the best time to invite the family to become part of the team?not at allbefore the patients procedureafter the patients dischargeat the very beginning 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Which one is correct Which of the following lines of a dialogue is most appropriate for a naturalist play A. Where are we going? What's happening? B. Does thou require a repast this morn?C. Hark, what light younder window breaks?D. Whither are we bond? At optimum light intensity, which atmospheric gas most directly influences the rate of photosynthesis? * Jamal has a plan to save money for a trip. Today, Jamal deposits $8.00 into the savings account. Each week, Jamal will add $5.00 to the amount that is deposited into the savings account. The table below shows the relationship between the number of weeks and how much money, in dollars, Jamal deposits into the savings account. Week 0 1 2 3 4 Deposit (Dollars) 8 13 18 23 28 Let f(x) represent the amount of money Jamal deposits into saving account at the end of x weeks. Based on the table, what is f(8)? Which details should you look for in determining the setting of a story? Check all that apply. the storys time period where the author lives the characters environment how long the story is where the story takes place As a missionary, where did you spend most of your time?A) at a churchB) in the fieldsC) in CaliforniaD) at a mission Por que tenen que dar el motivo de viaje?Los agentes quieren visitar los pasajeros en su hotelLos agentes can la informacin a los pasajerosLos pasajeros necesitan poner el motivo en el pasaporteLos pasajeros no pueden pasar por la aduana sin la informacin When Hugo puts a book and a candle on a scale, the scale reads 8.705 lbs. When he removes the book, the scale reads 4.93 lbs. How much does the book weigh?