Please I need help with this

Please I Need Help With This

Answers

Answer 1
TAAGCCGATAAATGCTAACGGTA

Related Questions

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

what is the main reason for using a data table to collect data?​

Answers

Answer:

the correct awnser is a to understand better

Answer:

the correct answer is a because tables make data easier to understand

(05.05 MC) Exposing human subjects to experimental manipulations such as high levels of toxins is unethical. We often use model organisms for this reason. What attributes would you look for in selecting a good model organism for investigating the impact of toxins in humans? A good model organism should be able to be easily maintain in the laboratory, be fast growing, with a fast generation time and be as closely related to humans as possible. Cost is the only consideration in selecting a model organism, since all living things are made of cells anything found will apply to humans. The best choice will must be the very closely related to humans, such as chimps, since anything found in other species will not apply to humans. The most important consideration in selecting a model organism is how the public will feel about doing experiments on that species, so the best choice would generally be a very simple organism like bacteria that people don't care very much about.

Answers

Answer:

A good model organism should be able to be easily maintain in the laboratory, be fast growing, with a fast generation time and be as closely related to humans as possible.

Explanation:

The attributes that should be looked for in the selection of good model organism for investigating the impact of toxins in humans include:

Easy maintenance: The easier the maintenance of the organism, the better for both the research and the researcher. More can be achieved with less effort as opposed to high maintenance animals.Fast generation time: They should be able to grow and reproduce quickly so as not to prolong the experiment for too long. The lower the regeneration time, the shorter the time required to obtain adequate data for the research.Genetical similarity to humans: A good model organism for humans related study must share some similarities with humans at the genetic level. The more the genetic similarity, the more applicable the outcome of the research on humans.

Hence, a good model organism should be able to be easily maintained in the laboratory, be fast-growing with a fast generation time, and be as closely related to humans as possible.

(c) State two differences between this mesophyll cell and a root hair cell. (2 marks)

Answers

Answer:

Root hairs are where most water absorption happens. ... The function of root hairs is to collect water and mineral nutrients that are present in the soil and take this solution up through the roots to the rest of the plant. As root hair cells do not carry out photosynthesis they do not contain chloroplasts.

Explanation:

When does puberty occur? What causes the changes that occur during puberty?

Answers

Answer:

When does puberty start? Puberty starts when changes in your child's brain cause sex hormones to start being released from the gonads, which are the ovaries and testes. This typically happens around 10-11 years for girls and around 11-12 years for boys.Skip

Skip

Toggle

Raising Children Network

Toggle

Pregnancy

Newborns

Babies

Toddlers

Preschoolers

School age

Pre-teens

Teens

Grown-ups

Autism

Disability

What is puberty?

Puberty is the time when your child moves through a series of significant, natural and healthy changes. These physical, psychological and emotional changes are a sign that your child is moving from childhood towards adulthood.

Changes in puberty include:

physical growth and development inside and outside children’s bodies

changes to children’s sexual organs

brain changes

social and emotional changes.

When does puberty start?

Puberty starts when changes in your child’s brain cause sex hormones to start being released from the gonads, which are the ovaries and testes.

This typically happens around 10-11 years for girls and around 11-12 years for boys.

But it’s normal for the start of puberty to range from 8-13 years in girls and 9-14 years in boys.

There’s no way of knowing exactly when your child will start puberty. Early changes in your child’s brain and hormone levels can’t be seen from the outside, so it’s easy to think that puberty hasn’t started.

Puberty can be completed in about 18 months, or it can take up to 5 years. This range is also completely normal.

Girls: key physical changes in puberty

In girls, these are the main external physical changes in puberty that you can expect.

Around 10-11 years

Breasts will start developing. This is the first visible sign that puberty is starting. It’s normal for the left and right breasts to grow at different speeds. It’s also common for the breasts to be a bit tender as they develop. If your child wants a bra, a soft crop top or sports bra can be a good first choice.

A growth spurt occurs. Some parts of the body – like the head, face and hands – might grow faster than limbs and torso. This might result in your child looking out of proportion for a while. On average, girls grow 5-20 cm. They usually stop growing at around 16-17 years.

The body shape will change. For example, a girl’s hips will widen.

The external genitals (vulva) and pubic hair will start to grow. Pubic hair will get darker and thicker over time.

Around 12-14 years (about two years after breast development starts)

Hair will start growing under the arms.

A clear or white discharge from the vagina starts several months before periods start. If the discharge bothers your child, you could suggest your child uses a panty liner. If your child says it’s itchy, painful or smelly, consult your GP.

Periods will usually start within 2 years of breast growth starting, but can take up to 4 years.

Boys: key physical changes in puberty

In boys, these are the main external physical changes in puberty that you can expect.

Around 11-12 years

The external genitals (penis, testes and scrotum) will start to grow. It’s normal for one testis to grow faster than the other. You can reassure your child that men’s testes usually aren’t the same size.

Pubic hair will start to grow. It will get darker and thicker over time.

Around 12-14 years

Your child will have a growth spurt. Your child will get taller and their chest and shoulders will get broader. Some parts of your child’s body – like their head, face and hands – might grow faster than their limbs and torso. This might result in your child looking out of proportion for a while. On average, boys grow 10-30 cm. They usually stop growing at around 18-20 years.

It’s common for boys to have minor breast development. If your child is worried by this, it might help your child to know it’s normal and usually goes away by itself. If it doesn’t go away or if the breasts seem to be growing a lot, consult your GP.

Around 13-15 years

Hair will start growing on other parts of your child’s body – under the arms, on the face and on the rest of the body. Leg and arm hair will thicken. Some young men will grow more body hair into their early 20s.

The hormone testosterone is produced, which stimulates the testes to produce sperm.

Your child might start having erections and ejaculating (releasing sperm). During this period, erections often happen for no reason at all. Just let your child know that this is normal and that people don’t usually notice. Ejaculation during sleep is often called a ‘wet dream’.

Around 14-15 years

The larynx (‘Adam’s apple’ or voice box) will become more obvious. Your child’s larynx will get larger and their voice will ‘break’, eventually becoming deeper. Some boys’ voices move from high to low and back again, even in one sentence.

Answer:

For girls, puberty typically occurs between the ages of nine and thirteen

For boys, puberty typically occurs between the ages of ten and fifteen.

An increase in hormones – estrogen and progesterone in girls and testosterone in boys – causes the changes that happen during puberty.

Explanation:


What was the experimental variable we tested in the lodine Clock Reaction?

Answers

Answer:Experiment 1084-04: lodine Clock Reaction Purpose Determine the rate law for an iodine clock reaction and study the influence of st on that reaction abruptly that it can be as startling as the sudden sound of an alarm clock, hence the clock reaction Background Information chemical equations can be written for chemical reactions, only some will proceed while others do not. Among the ones that do proceed some reactions occur as soon as reactants are mixed, while others occur over minutes, hours, or n over several years. What are the controlling in predicting if a reaction will take place and the speed at which it will? Thermodynamics can answer the question, "Will the reaction take place?" Once the reaction is capable of proceeding kinetics can answer the other question, "How fast You will study the rate of the reduction of potassium persulfate, KoS Os, with sodium iodide, Nal. The net ionic equation for the reaction is eve The rate law for this reaction is in the form of And you will need to determine the reaction orders a and b, as well as the rate constant, k. Keep in mind that exponents can not be determined by jus looking at the chemical equation the reaction will take place? The rate of a reaction is defined as the increase in molar concentration of product of a reaction per unit time or the decrease in molar concentration of reectant per unit time. The usual unit for the rate is moles per liter per sec (mol/L s or M/s). Experimentally, it has been found that a reaction rate depends on the concentrations of the reactants. Usually a higher reactant concentration increases chance of collision among the reactants per unit time causing a faster reaction rate. An equation describing the relationship between the reaction rate and the concentration of the reactants You will need a way to determine how much of the reactants were spent over the given time period. Preferably, the concentrations of the reactants should not change too much; therefore the reaction rate can be represented by the initial concentrations of reactants (the initial-rate method). In this experiment, we will couple another reaction that consumes the product, 12 very quickly. The new reaction is the reduction of is called a rate law. For the elementary reaction Note that l2, which was produced in reaction (1) is consumed as fast as it is produced by reaction (2) to regenerate two l. i.e. [门is kept constant. By keeping [S203-9 much smaller than the initial concentration of S,0, we can assure [S20,1 is also kept nearly constant when S203 is completely consumed. At this point, the 12 is no longer eliminated by the reaction and starts to accumulate. This point is signaled by sudden appearance of the dark color from the interaction of l2 with starch indicator. We can measure the time elapsed till the color appears Rate k [AIB] The proportionality constant, k, is called the ate constant in the relationship between the rate nd concentrations. The rate constant has a fixed alue as long as the reaction temperature is held nstant. The exponents, a and b, are called the action order, and are frequently, but not always, egers. More importantly, they must be termined experimentally In this experiment you will determine the rate an iodine clock reaction, and study the effects of perature and a catalyst to the reaction rate ugh there are several versions of an iodine k reaction, all of them share a common feature: completion of the reaction is signaled by the en appearance of a dark purple color. This is characteristic of the interaction between cular iodine and starch. When the reaction is ed out correctly, this color will appear so According to the reaction stoichiometries of reactions (1) and (2), two molecules of S203 are required to counteract the consumption of one molecule of S20a2. Since S2032 would have been completely consumed when the dark purple color appeared, the Δ[SO ] should be % of the initial concentration of S203 15-08-2] = ½ initial [S,03-21

mention 6 substances secreted by the body​

Answers

Answer:

Saliva

Lipase

Amylase

Trysin

Pepsin

Erepsin

Explanation:

Substances? Just any substances?

The plasma membranes of the __________ bear enzymes referred to as brush border enzymes, which complete the digestion of carbohydrates and proteins in the small intestine."

Answers

Answer:

Microvilli

Explanation:

The microvilli are microscopic in nature, they form projections on cell membranes which helps to increase the surface area of the membrane, which further enables diffusion. Microvilli are mostly found in the small intestine and they work together with villi to increase the absorption of nutrients in the small intestine.

In addition, they also involved in the secretion of enzymes called brush border enzymes that aids the easy and complete digestion of carbohydrates and Protein. One of such enzymes are the glycosidases which digest carbohydrates.

Afferent neurones connect?

A the brain and spinal cord to muscles
B sense organs to muscles.
C one sense organ to another sense organ
D sense organs to brain and spinal cord

Can someone explain to me the answer because I'm confused.

Answers

Answer:

These neurons are located in the central nervous system (the brain and spinal cord). Afferent and efferent neurons have to work together in order to sense and respond to stimulus, but they don't directly connect. Association neurons bridge the gap to relay information between sensory and motor neurons.

Eye color is an example of 1. Transcriptional control 2. gene expression 3. translational control 4. gene regulation

Answers

Answer:

Eye color is an example of Gene expression

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

Define:
(i) parasitism,
(iii) photosynthetic nutrition​

Answers

Answer:

hey there !!!!

According to google your answer's are as follows

I} Parasitism means the relationship between two species of plants or animals in which one benefits at the expense of the other, sometimes without killing the host organism.

II} Photosynthesis is a biological process utilized by all green plants to synthesize their own nutrients. The process of photosynthesis requires solar energy, water and carbon dioxide.

HOPE U GOT ITPLZ MARK ME AS BRAINIEST IF IT HELPS !!!!!!!

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

Question 3
Some globular proteins are water soluble, while all fibrous/membrane proteins are water insoluble.
Which of the following statements BEST explains the reason for these differences?
A
Fibrous proteins have a large number of hydrogen bonds between the amino acids in the polypeptide chains that stabilize their structures, preventing solubility in water. The globular proteins that are water-soluble do not have as many hydrogen bonds between the amino acids in their peptide chains, allowing water solubility.
B
Fibrous proteins are configured in a way that exposes the polar side chains of the amino acids on the surface of the protein, preventing solubility in water. The globular proteins that are water soluble have nonpolar side chains on the surface of the protein, allowing water solubility.
C
Some globular proteins are configured in a way that exposes the polar groups of the amino acids on the surface of the protein, allowing water solubility. Fibrous proteins have nonpolar side chains on the surface of the protein, preventing water solubility.
D
Some globular proteins are composed of more than one polypeptide chain that weakly interacts with one another, allowing water solubility. Fibrous proteins are composed of only one polypeptide chain that tightly folds, preventing water solubility.

Answers

Globular proteins are spherical proteins which are water soluble and forms colloid in water.

The best statement which will explain the reason for difference in globular protein and fibrous proteins is statement C.

C. Some globular proteins are configured in a way that exposes the polar groups of the amino acids in the surface of the protein, allowing water solubility.

Fibrous proteins have non polar side chains on the surface of the proteins, preventing water solubility.

Globular proteins are water soluble. Fibrous proteins are not soluble in water.

Amino acids chain prevents folding up so that the chain is not broken and it remains in elongated form. The correct answer is C.

Learn more at https://brainly.com/question/24374225

The hard outer covering of an animal is a(n) blank

Answers

Answer:

exoskeleton

Explanation: answering spree

Answer:

The hard outer covering of an animal is a(n) exoskeleton.

Explanation:

The definition of exoskeleton is "a rigid external covering for the body in some invertebrate animals, especially arthropods, providing both support and protection."

If Earth’s average surface temperature continues to change over the next 30 years at the same rate it changed between 1980 and 2010, the average temperature will most likely be around

Answers

Answer:

Its B....

Explanation:

Get that 100.

Most fresh water fish are hypertonic, meaning their body cells contain more salt than the surrounding water. Since osmosis should push water into their cells, why don't they explode? They don'­t drink any water because they get so much from osmosis. They have adapted to live with high osmotic pressure. They urinate a lot, so the water does not build up. Their cells have adapted to absorb salt. All of the above

Answers

Answer:

They urinate a lot, so the water does not build up.

Explanation:

Freshwater fishes are fishes that live in freshwater habitat i.e. little or no salt. This means that the fishes are hypertonic (have more salt) to their external environment. Due to their hypertonicity, freshwater fishes tend to take in more water via osmosis.

Freshwater fishes, however, do not explode despite this phenomenon because they pass out the excess water via urine waste. Freshwater fishes urinate a lot, hence, the absorbed water does not build up in their bodies.

What is the Dependent Variable?

Answers

Answer:

pitcher with the same velocity

Can someone please help me!!???

Answers

Explanation:

plant cell only

nucleuscell wallchloroplastgolgi apparatus cell membraneribosome

both plant and animal cells

nucleuscell membraneribosomegolgi apparatus

Which zone of the reef is closest to the shore?
The reef____is a zone closest to the shore or the lagoon where the surrounding water is relatively calmer.

Answers

Answer:

https://www.usclassifiedinfo.com/forum/biology/which-zone-of-the-reef-is-closest-to-the-shore

Explanation:

This is where the answer is for the question

back reef

Explanation:

The back reef is the part of the reef closest to shore, while the fore reef is farther out to sea.

Which is a difference between a compound light microscope and a scanning electron microscope?

Answers

The scanning electron microscope can view the internal part of a cell, while the compound light microscope views the surface of a cell. ... The scanning electron microscope uses an electron beam and a layer of gold to view the surface of the cell, while the compound light microscope uses light and lenses.

Answer:

the answer is D not what other dude said

Explanation:

Multiple Choice: Please select the best answer and UICK
Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

The correct answer is fossils

Explanation:

Because fossils are used in studying extinct animals.

Hope this helps....

Have a nice day!!!!

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

who discovered micro organisms​

Answers

Robert Hooke is the person that discovered Micro organism

Answer:

An English architect, "Robert Hooke" discovered micro organisms in 1665.

Hope this helped!

Have a nice day:)

BRAINLIEST would really help me:)

What is most similar about the alkaline earth metals?

Answers

Answer:

They are beryllium (Be), magnesium (Mg), calcium (Ca), strontium (Sr), barium (Ba), and radium (Ra). The elements have very similar properties: they are all shiny, silvery-white, somewhat reactive metals at standard temperature and pressure

Need help write some for me to put in my book

Answers

Answer:

Users encounter the error message ‘The Third-party INF doesn’t contain Digital Signature Information’ when they are trying to install third-party drivers on their computer. There are usually two types of drivers present i.e. third-party (these are not developed by manufacturers) and official drivers

Which statement explains how a DNA mutation causes sickle-cell anemia?(1 point)

Answers

Answer:

DNA mutation causes a change in the amino acid sequence for hemoglobin, which causes a change in the shape

Explanation:

Sickle cell mutation is a mutation that affect the production of red blood cell that is needed for the transport of oxygen in the bloods stream.

sickle cell mutation is a result of change in the amino acid which are building blocks of the protein hemoglobin.

The protein is what gives red cells their color, it has two subunits. The alpha

and beta subunit. There is a change in the arrangements of amino acid sequence and that is the basis for the sickle cell shape, beta subunit has valine an amino acid at position 6 instead of the glutamic acid. This alteration results in sickle cell problems that occur in people.

Answer:

Explanation:

From the options:

The DNA mutation increases the number of amino acids in hemoglobin, which causes a change in the shape of red blood cells.

The DNA mutation causes a change in the amino acid sequence for hemoglobin, which causes a change in the shape of red blood cells.

The DNA mutation decreases the number of amino acids in hemoglobin, which causes a change in the shape of red blood cells.

O The DNA mutation prevents formation of hemoglobin, the absence of wirich causes a change in the shape of red blood cells.

The correct answer would be that "The DNA mutation causes a change in the amino acid sequence for hemoglobin, which causes a change in the shape of red blood cells. "

The sickle-cell anemia is caused by a change in the amino acid sequence of the hemoglobin - specifically, as a result of the substitution of the sixth amino acid, glutamic acid, by valine in the beta subunit of the proteins that make up the hemoglobin. A single base substitution causes glutamic acid to be changed to valine.

The normal hemoglobin is disc-shaped and is able to effectively carry oxygen in the blood, unlike the sickle-cell hemoglobin which has the sickle shape and is not able to effectively carry oxygen in the blood.

The image shows a food web in an Arctic ecosystem. Rising temperatures in the Arctic Ocean can lead to large die-offs of phytoplankton, which are autotrophs. What would most likely happen in an Arctic ecosystem if the phytoplankton population decreased?

Answers

Answer:

as the population of phytoplankton decreases, the amount of food for zooplancktons decreases

what is homostatis in biology​

Answers

Answer:

Homeostasis, from the Greek words for "same" and "steady," refers to any process that living things use to actively maintain fairly stable conditions necessary for survival. The term was coined in 1930 by the physician Walter Cannon.

Explanation:

Based on your knowledge of our solar
system, how do you think it originally
formed?

Answers

Answer:

Our sun oriented framework shaped almost 4.5 billion a long time back from a thick cloud of interstellar gas and tidy. The cloud collapsed, conceivably due to the shockwave of a adjacent detonating star, called a supernova. When this tidy cloud collapsed, it shaped a sun oriented nebula—a turning, twirling disk of fabric.

Other Questions
simplify (5^0+4^-05)^2 ABCD is a parallelogram. Find the values of x and y. Solve for the value of z, if z = x - y.AB(x+30) (x-30)(y+20)D x = 1, 2, 3 , 4 ,5y = 15, 12, 9, 6, 3Write an equation which describes the rule in the following table: What is the percent composition of chlorine in the compound Ba(ClO3)2? 6 points are placed on the line a , 4 points are placed on the line b . How many triangles is it possible to form such that their vertices will be the given points, if a b ? please help me Find the volume of this shape. verb of complain in english Solve the equation using the square root method. Select all solutions that apply. x^2 = 36 A.-8 B.6 C.-6 D.8 A tsunami a. may be just a broad, gentle swelling out at sea but grows as it approaches shore. b. can get big, but never bigger than 30 feet high. c. is a special kind of tidal wave caused by the gravitational attraction of the Sun, not the Moon. d. is dangerous near its source, but dies out within about 200 miles When Matt has an income of $2,000, he consumes 30 units of good A and 50 units of good B. After Matt's income increases to $3,000, he consumes 25 units of good A and 95 units of good B. Which of the following statements is correct?a. Both goods A and B are normal goods.b. Both goods A and B are inferior goods.c. Good A is a normal good, and good B is an inferior good.d. Good A is an inferior good, and good B is a normal good. PLEASE HELP FAST The object distance for a convex lens is 15.0 cm, and the image distance is 5.0 cm. The height of the object is 9.0 cm. What is the height of the image? . In an extra-curricular club with 15 members,7 people played rugby, 6 people played soccer and 4 people neither play rugby nor soccer. How many people played both rugby and soccer? ac circular runway has a radius of 100 m.Find the distance covered by a person in one complete rotation . A. Determine if a given set ie a well-defined or not.1. the set of all poor people in batangas.2. the set of books well-liked by my classmate.3. the set of handsome teachers in your school.4. the set of whole numbers greater than 8 but less than 20.5. the set of intelligent students. A charge (uniform linear density = 8.8 nC/m) lies on a string that is stretched along an x axis from x = 0 to x = 3.1 m. Determine the magnitude of the electric field at x = 5.2 m on the x axis. A class with n kids lines up for recess. The order in which the kids line up is random with eachordering being equally likely. There are three kids in the class named John, Betty, and Mary. The useof the word "or" in the description of the events, should be interpreted as the inclusive or. That is"A or B" means thatAis true,Bis true, or bothAandBare true.Give an expression for each of the probabilities below as a function ofn. Simplify your final expressionas much as possible so that your answer does not include any expressions of the form (a/b).Requried:a. What is the probability that Betty is first in line or Mary is last in line? b. Explain the method used to calculate probability. Compare and contrast the British in India and China. Describe how the British East India Trading Company was instrumental in taking power in India and attempting to take control in China. Outline the path the British took to ruling India compared with the path they took in China. What prevented them for ruling China? Structure: Describe the British in India - from initial traders to rulers Describe the British in China - from traders to conflict State the major differences between the two countries interaction with the British and the reasons behind the differences. Solve for x. 7^8 = 7^8 * 7^x What effect did barbarian invasions have on the Western Roman Empire? How many equations are thereof: 70 divided by h equals 10?What are those equations?