Restriction digest A:

ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC

How many bases are in the second fragment?

Answers

Answer 1

Answer:

This question seem incomplete

Explanation:

This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51

This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below

A ⇆ T

G ⇆ C

Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).

Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51


Related Questions

What is a peer review? Why is it important?

Answers

Peer review is having other professionals or people with similar skill sets review you work. It is important to help catch any errors.

Answer:

Peer review involves subjecting the author's scholarly work and research to the scrutiny of other experts in the same field to check its validity and evaluate its suitability for publication. A peer review helps the publisher decide whether a work should be accepted.

The total number of organisms an ecosystem can support is its tolerance range.

true or false

Answers

Answer:

false

Explanation:

the total number of organism an ecosystem can support is its trying capacity

Answer:

false

Explanation:

i just took the test.

A change in an organism's body is a(n)
A change in the environment is a(n)
A. instinctive, learned
B. internal stimulus, external stimulus
C. chemical signal, display
D. association, condition

Answers

Answer:

I believe is C. I might be wrong  

Explanation:

¯\_(ツ)_/¯

A change in an organism's body is an internal stimulus, while a change in the environment is an external stimulus. Thus, the correct option is B.

What is the Environment?

An environment may be defined as anything which is present in the surrounding of living entities through which it interacts for various purposes.

There are a lot of alterations in the body of an organism with respect to time. Apart from organisms, a lot of changes have also occurred in an environment gradually and continuously.

Changes in the organism's body are internal so it is called internal stimulus, while alterations in the environment are externally made so they are called external stimulus.

Therefore, the correct option for this question is B.

To learn more about Organisms and the environment, refer to the link:

https://brainly.com/question/13544588

#SPJ5

In the image, the arrow Is pointing to a celestial object. Which attribute disqualifies the object from being a planet?
A. It appears to have no moons.
B. It is spherical in shape.
C. Its neighborhood is not clear.
D. It has horizontal bands on its surface.

Answers

The correct answer is C. Its neighborhood is not clear.

Explanation:

One of the key features of a planet is that it clears its neighborhood; this means the planet gravitational force is strong enough that there are no other celestial bodies on its orbit or next to it except by its moons or satellites. This does not occur in the image presented because there are smaller celestial bodies near to the main or bigger celestial body. This likely occurs if the celestial body is not big enough to clear its neighborhood, and therefore it is not a planet.

All parts of a nonvascular
plant must be near a
because it doesn't have
long roots.

A. water source
B. heat source
C. food source
D. air source

Answers

Answer:

a.water source

Explanation:

Each of two parents has the genotype brown/red​, which consists of the pair of alleles that determine hair color​, and each parent contributes one of those alleles to a child. Assume that if the child has at least one brown ​allele, that color will dominate and the​ child's hair color will be brown. a. List the different possible outcomes. Assume that these outcomes are equally likely. b. What is the probability that a child of these parents will have the red/red ​genotype? c. What is the probability that the child will have brown hair color​? a. List the possible outcomes.

Answers

Answer:

a. In image attached.

b. 25% or a 1 in 4 chance.

c. 75% or a 3 in 4 chance.

Explanation:

B = Dominant (brown gene)

r = Recessive (red gene)

If two parents both have Br genes, they will both have brown hair.

The Punnet square will look like the image attached.

1. A tree root breaking a rock into smaller fragments is an example of both _______ and mechanical weathering.
2. When rocks are exposed to heat, they _______, which can contribute to thermal stress.
3. When harmful gases, such as sulfur dioxide and nitrogen oxide, react with water in the atmosphere, they can produce
4. The agent of erosion involved in stream erosion is
5. When the ground is so saturated that it can't absorb rainfall or when rain falls so quickly that the ground can't absorb the water, _______ forms.
6. A/An _______ is a huge, heavy, moving body of ice that picks up rocks and sand and erodes the ground beneath it as these materials scrape across it.
7. Hot arid climates are prone to erosion by _______.
8. Rows of trees and shrubs planted to protect fields from wind erosion are known as _______.

Answers

Answer:

chemical

expand

acid rain.

rushing water.

runoff

glacier

wind.

windbreaks

Explanation:

The correct terms for the given fill in the blanks are:

1. A tree root breaking a rock into smaller fragments is an example of both chemical and mechanical weathering. Weathering is the breakdown of rock into smaller particles.

2. The rocks when are exposed to heat, expand contributing to thermal stress.

3. Sulfur dioxide and nitrogen oxide are harmful gases, which react with water in the air to form acid rain.

4. The agent of erosion involved in stream erosion is referred to as rushing water.

5. The ground is so saturated that it can't absorb rainfall or heavy and quick rainfall does not allow the ground to absorb the water forming runoffs.

6. Glacier is a huge, heavy, moving body of ice that picks up rocks and sand and erodes the ground beneath it as these materials scrape across it.

7. Hot arid climates are prone to erosion by wind.

8. Windbreaks refer to the rows of trees and shrubs planted to protect fields from wind erosion.

To know more about weathering, refer to the following link:

https://brainly.com/question/14426457

Diatoms are mostly asexual members of the phytoplankton. Diatoms lack any organelles that might have the 9 + 2 pattern. They obtain their nutrition from functional chloroplasts, and each diatom is encased within two porous, glasslike valves. Which question would be most important for one interested in the day-to-day survival of individual diatoms?A) How does carbon dioxide get into these protists with their glasslike valves?B) How do diatoms get transported from one location on the water's surface layers to another location on the surface?C) How do diatoms with their glasslike valves keep from sinking into poorly lit waters?D) How do diatoms with their glasslike valves avoid being shattered by the action of waves?E) How do diatom sperm cells locate diatom egg cells?

Answers

Answer:

Diatoms are mostly asexual members of the phytoplankton. Diatoms lack any organelles that might have the 9 + 2 pattern. They obtain their nutrition from functional chloroplasts, and each diatom is encased within two porous, glasslike valves. Which question would be most important for one interested in the day-to-day survival of individual diatoms?

C) How do diatoms with their glasslike valves keep from sinking into poorly lit waters?

Explanation:

Diatoms are some of the most important organisms living on earth because of its role on the oxygen production in the planet earth. The question "how do diatoms with their glasslike valves keep from sinking into poorly lit waters?" Because of the way their nutrition is obtained from functional chloroplasts and the way them encased within two porous, glasslike valves.

Which structure is found in the cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell?
DNA
ribosomes
nucleus
mitochondria

Answers

Answer:

DNA

Explanation:

cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell.

Answer:

A- DNA

Explanation:

In meiosis, each centromere has a spindle fiber attached only to one side. In mitosis, each centromere has a spindle attached to how many sides?

Answers

Answer:

In mitosis, each centromere has a spindle attached on both side of centromere

Explanation:

In mitosis, each centromere has a spindle attached on both side of centromere because Spindle fibers move chromosomes during cell division by attaching to chromosome arms and centromeres. A centromere is the specific region of a chromosome where replicates are linked together.

Spindle fibers are active in mitosis and also meiosis and they move throughout the cells and also direct chromosomes to move to where they need to move to.

Spindle fibers function in centromere in mitosis and meiosis by pulling homologous chromosomes apart after they might have been replicated to prepare for division.

which enzyme breaks down lipids? which enzyme breaks down fats? which enzyme breaks down proteins?​

Answers

Answer:

lipase enzymes, lipase, proteolytic enzymes

Answer:

for lipids and fat is same enzyme that is lipase enzyme. protease enzyme is for proteins.

What is an example of nature exhibiting zero
waste?
1. Oxygen is a waste product
from plants.
2. Oxygen is a waste product
from animals
3. Animals consume oxygen in
respiration
4. Plants consume oxygen in
photosynthesis
A
1 and 3
B
1 and 4
С
2 and 3
D
2 and 4

Answers

Answer:

idontknow

Explanation:

you are aintelligent nice qiestion

Hibernation enables an animal to save

Answers

Answer:

energy

Explanation:

Which macromolecule forms a double layer as the primary structure of cell membranes?
fats
oils
phospholipids
steroids​

Answers

Answer:

phospholipids

Explanation:

Answer:

C. phospholipids

Explanation:

The other person said it

What is better sexual or asexual? Reproductive

Answers

Answer:

to reproduce sexual is better

Explanation:

i think if your asexual you don't feel attraction so you probably wont have intercourse and not reproduce whereas if your sexual you will

Answer:

tough question

Explanation: asexual is a broad broad broad spectrum some people who are ace are willing to have intercourse just wont find pleasure in it or some people are willing to have intercourse every once in a while or when they feel like it so technically ace people can reproduce just probably more likely that they wont but the question is also probably not the best because not all ace people are the same

When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by

Answers

Question is incomplete, The complete question is as follows:

When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by:

A) increasing its metabolic rate to generate more heat.

B) putting longer-chain fatty acids into its membranes.

C) putting more unsaturated fatty acids into its membranes.

D) shifting from aerobic to anaerobic metabolism.

E) synthesizing thicker membranes to insulate the cell.

Answer:

C) putting more unsaturated fatty acids into its membranes.

Explanation:

Bacteria has the ability to change the composition of fatty acid present in its cell membrane to compensate the change in temperature.

When bacterium E.Coli will shift from hight or warmer temperature to low or cooler temperature, it will put more unsaturated fatty acids into its membranes which will mintain the fluidity in the membrane.

Hence, the correct option is "C".

What is the purpose of a conclusion?
O A. To predict how something will turn out
B. To make an educated guess about a particular question
C. To collect or analyze the experimental data
D. To explain why the data support or reject the hypothesis

Answers

I think it is to D. to explain

Distinguish between the 4 major modes of nutrition of prokaryotes and identify each modes energy source and carbon source as well as giving an example

Answers

The four major modes of nutrition in prokaryotes are photoautotrophic, chemoautotrophic, photoheterotrophic, and chemoheterotrophic. Their differences, energy source and carbon source are explained below:

WHAT ARE PROKARYOTES?

Prokaryotes are a group of organisms that do not have their genetic material enclosed in a membrane bound NUCLEUS. They include bacteria, archeae etc.

METABOLISM IN PROKARYOTES:

All organisms, prokaryotes inclusive, need energy for their metabolic activities. They also need carbon. Hence, based on their carbon and energy source, prokaryotes can be:

Photoautotrophic: These are prokaryotic organisms that use carbon dioxide as their carbon source and light as their energy source. Example is

cyanobacteria.

Chemoautotrophic: These are prokaryotic organisms that act on inorganic substances as energy source and use carbon dioxide as carbon source. Example is Nitrosomonas bacteria.

Photoheterotrophic: These are prokaryotic organisms that use light as source of energy but obtain carbon from other organisms (organic sources). Examples are heliobacteria, sulfur bacteria.

Chemoheterotrophic: These are prokaryotic organisms that act on inorganic substances as energy source but derive their carbon source from organic compounds (other organisms).

Learn more: https://brainly.com/question/6103977

what did Rudolf virchow discovered?

Answers

Answer:

Explanation:

In 1855 Virchow published a statement based on his observations Omnis cellula e cellula, which means that all cells arise from pre-existing cells. This was not a new theory.

an apple and a glass of milk can give you more nutrition as compared to the milk shake
Prepared from apple and milk. Justify it based on the physiology of GIT.

in detail plz

Answers

Answer:

True

Explanation:

because the milk shake is with cold but milk is hot

What is assimilatory power?

Answers

A military, also known collectively as armed forces, is a heavily armed, highly organized force primarily intended for warfare. It is typically officially authorized and maintained by a sovereign state, with its members identifiable by their distinct military uniform. 

YA'LL ARE SMART!!! PLEASE HELP!!!!

Answers

Answer:

not malleable

Explanation:

hope this helps

Answer:

D because it can be transformed into many forms

so is malleable


HELP ASAP PLEASE HELP HELP FAST

Answers

Answer:

it's amylopectin, since it has many ends and also branches that are joined by alpha-1,6- glycosidic bond

Anyone wanna help me ???????

Answers

Answer: Wave height

Which of the following traits are characteristic of all mammals?

Answers

Mammals are air-breathing, warm-blooded, and have a backbone, yet these characteristics do not distinguish them from the rest of the animal kingdom. Mammals have the ability to regulate their body temperature using their metabolism and sweat glands in a way that no other animal can.

please do mark this as brainliest if it helped!

Which of these statements most accurately describes currencies in North America

Answers

Answer:

North American countries have done away with separate currencies. Each country in North America uses its own currency. 2. See ...

Describe how protein functional groups can act as acid and base catalysts. How is it possible for a single amino acid side chain to function as both?

Answers

Answer:

By changing the transition state and pH of the medium

Explanation:

Enzymes are proteins that bind to their corresponding substrates at their active sites in order to form complexes that catalyze specific chemical reactions. A key feature of this process is the fact that both acid and base catalytic activities may be combined in the same reaction. The acceleration in the velocity of the enzymatic reaction due to the addition of acids and bases is known as acid–base catalysis, where the acid or base is not consumed during the reaction. For example, enzymes can partially transfer a proton to the medium, thus changing the transition state of the chemical reaction and also decreasing its pH.

what kind of mutation occurred when the DNA strand changed from AATCGTCCG TO AATAGTCCG?

Answers

Answer:

Missense Mutation

Explanation:

AAT CGT CCG to AAT AGT CCG where CGT has become AGT is a point mutation. If a point mutation changes the amino acid, it’s called a missense mutation. In this case CGT (arginine) has become AGT (serine).

Othologous. are found where?

Answers

Answer:

Explanation:

Science (genetics, molecular biology, genomics) genes or gene products that are homologous (descended from a common ancestor) and are found in separate species due only to the speciation event (not to gene duplication).

Answer:

I think youcan collect the genes from two species and compare each gene to one another and if two genes identify each other. I never really heard of them being found but created srry if this isnt any help you can delete my question if needed

Explanation:

The amount of matter something has is

Answers

Answer:

mass

Explanation:

mass is the amount of matter an object is made up off.

[tex] \LARGE{ \underline{\underline{ \sf{\pink{Required \: answer:}}}}}[/tex]

The amount of matter a substance have is known as Mass. Mass is a fixed everywhere in the universe. Sometimes we get confused between Mass and weight, but we should remember that Weight is the force with which a body is attracted towards earth. And above is the definition of mass. It is measured by common balance.

~ [tex] \large{ \pink{ \sf{FadedElla}}}[/tex]

Other Questions
You are a great student so you know that you answer probability questions correctly with probability 0.8. A friend told you that "NA" is a correct answer with probability 0.01 in general. Let XX be a random variable that takes on the value 1 if you answer a probability question correctly and 0 otherwise, and let YY be a random variable with takes on the value 1 if "NA" is the correct answer to the probability question and 0 otherwise.Required:a. P [X=0]=_______b. P[Y=1]=________ use the word "play " as both noun and verb and make sentences. PLEASE HELP ASAP will give brainliest When simplified completely, the product of a monomial and a binomial is a trinomial. The final step of the decision making model is to make your descion and take action? Fill in the blank with the Spanish word that best completes the following sentence. Para qu usamos ____________? cerrar los discos descargar State 1 difference between 1 way rotary motion and reversible rotary motion Conference committees are established when: Group of answer choices Standing committees are unable to reach agreement on bills The House and Senate pass different versions of the same bill There is a major scandal or crisis that needs to be investigated The president requests Congress to conduct a special study on some problem the nation is facing What is the theme in the book Life of Pi, please include why you think it is the best theme and whoever has the best I will give Brainliest. give me the meaning of hawker A phone company offers two monthly plans. Plan A costs $21 plus an additional $0.11 for each minute of calls. Plan B costs $29 plus an additional $0.09 for each minute of calls. A. For what amount of calling do the two plans cast the same? ____minutes B. What is the cost when the two plans cost the same? $____ Help asap please!!Find the measure of y.A. 43B. 53C. 90D. 47 The length of a rectangle is twice its width. If the perimeter of the rectangle is 30m, find its area. A political party is an organization:__________ a. that falls under section 501(c)(4) of the U.S. tax code. b. established by the Constitution to nominate candidates. c. that tries to influence the government by getting its members elected to office. d. that collects fees from its members in order to pay the salaries of government officials. Help me please One way to punctuate a compound sentence correctly is to join the two independent clauses with a comma. a semicolon. a comma and a subordinating conjunction. a semicolon and a coordinating conjunction.Which contains an independent clause? Because the tragic fumble was scored by the visiting team in the last minute. When the player, in an extraordinary move, went charging down the field. As the uproar from the delirious fans exploded jubilantly through the stadium. While the team made their play, the frenzied crowd cheered them to victory. 1 Select the correct text in the passage. Which lines in this excerpt from Guy de Maupassant's short story "Boule de Suif" suggest that the resistance activities of the civilians were more courageous than those of the armed soldiers? help...help...asap... Point A is located at (0, 4), and point C is located at (3, 5). Find the x value for the point B that is located one-fourth the distance from point A to point C. Select R if the item describes religious conflict. Select I if the item describes ideological conflict. Select E if the item describes economic conflict.Select P if the item describes political conflict. Democrats vs. Republicans E the Cold War Protestants vs. Roman Catholics isolationism vs. internationalism the Crusades free trade vs. trade barriers colonialism vs. nationalism