Someone please help me with this

Someone Please Help Me With This

Answers

Answer 1
Y=-2x-7/ Y=3/4+2 1/2

Related Questions

quick pls!! my math grade is at a B! I need to raise it.

Answers

I don’t know but I think it should be -04 I assume don’t know

4 divided by 3220 pls help me due in 2 hours

Answers

Answer:

1/805

Step-by-step explanation:

4/3220 = 1/805 = 0.00124223....

Alebgra!!

Please help me fast now plzzzzzzzzzzzzzzzzzzzzzzzzzzzzz i will give you alot of my points.

Question:

Find the perimeter of the rectangle with length (2w + 7) feet and width w feet.

Answers

Answer:

I think it's 18

Step-by-step explanation:

P=2(l+w)=2(7+2)=18

it's been awhile I believe this is it

Perimeter is the sum of all the sides
A rectangle has four sides=2L+2W

2(2w+7)+2w
4w+14+2w
=6w+14

Please mark as brainliest if it’s correct

which ratio is equivalent to the ratio 7:6

Answers

Answer:

B. 21:18

Step-by-step explanation:

7/6 x 3 = 21/18

This means they are equivalent.

Answer:

Option B is correct.

Step-by-step explanation:

Let's first turn 7:6 into a fraction:

=> 7:6 = 7/6

Now, let's simplify all the options to see which one is the correct answer.

Option A:

=> 14:18=> 14/18=> 7/9=> 7/9 ≠ 7/6

Therefore, Option A is incorrect.

Option B:

=> 21:18=> 21/18=> 7/6=> 7/6 = 7/6

Therefore, Option B is correct.

Option C:

=> 21:12=> 21/12=> 7/4=> 7/4 ≠ 7/6

Therefore, Option C is incorrect.

Option D:

=> 18:14=> 18/14=> 9/7=> 9/7 ≠ 7/6

Therefore, Option D is incorrect.

We can conclude that Option B is correct.

[tex]BrainiacUser1357[/tex]

Solve please in need of help

Answers

Answer:

not clear and I don't know the answer

Given: AB IS CONGRUENT TO CD
PROVE: CD CONGRUENT TO AB

Answers

Answer:

Because of the definition of congruent

Step-by-step explanation:

This problem may sound tricky, but it's not actually that hard. We now congruent means two things are the same, so for this problem, think of it as an equal sign. (Congruent doesn't mean equal, as an equal sign denotes the relationship that two things are the same if we know the concrete value of it.) So if AB=CD, CD=AB as you can swap two sides of an equation around and get the same answer. It's like saying 2=x ∴ x=2 (The dots mean therefore in math.)

Please consider a brainliest! Thank you!

A= (4,-1)
B= (0,-5)
which one is right ,two answer choices.

Answers

Answer:

A

Step-by-step explanation:

Joe started to save money to purchase a new game console. His savings at the end of the first week included a jar of 468 nickels and dimes. The total value of the coins was $34.40. Which system of equations below would be the best to use to find the number of nickels and dimes Anthony had at the end of the first week?

Answers

Answer:

0.05x + 0.10y = 34.40

x + y = 468

Step-by-step explanation:

Step-by-step explanation:

The The guy above is correct

Solve the quadratic equation 2x2 – x = 15 using the quadratic formula.

Question 6 options:


A)


x = –3, x = –5∕2


B)


x = –3, x = 5∕2


C)


x = 5∕2, x = 3


D)


x = – 5∕2, x = 3


which one is right. keep it simple

Answers

Answer:

B) x = 3 or x = -5/2

Step-by-step explanation:

Solve for x over the real numbers:

2 x^2 - x = 15

Subtract 15 from both sides:

2 x^2 - x - 15 = 0

x = (1 ± sqrt((-1)^2 - 4×2 (-15)))/(2×2) = (1 ± sqrt(1 + 120))/4 = (1 ± sqrt(121))/4:

x = (1 + sqrt(121))/4 or x = (1 - sqrt(121))/4

sqrt(121) = sqrt(11^2) = 11:

x = (1 + 11)/4 or x = (1 - 11)/4

(1 + 11)/4 = 12/4 = 3:

x = 3 or x = (1 - 11)/4

(1 - 11)/4 = -10/4 = -5/2:

Answer:  x = 3 or x = -5/2

The graph of y = x^2 -2x -3
a) Write down the coordinates of the turning point on the graph of y = x² – 2x - 3
(1)
(b) Use the graph to find the roots of the equation r? - 2x - 3 = 0

Answers

Answer:

See below

Step-by-step explanation:

A) Recall that a turning point is where the function changes from increasing to decreasing or vice versa. Since the graph of the function is a parabola, it only has 1 turning point, which is the vertex, or (1,-4). Therefore, the coordinates of the turning point are (1,-4).

B) The roots of the equation can be found by determining where the graph intercepts the x-axis (aka. x-intercepts). In this case, these are points (-1,0) and (3,0).

Mr. Russo had 6.25 cubic feet of potting soil in his raised garden bed. Then he took a bag of soil and poured in enough to completely fill the 9-cubic-foot bed. Let x represent how much soil was in the bag. Which inequality describes the problem?

Answers

Answer:

b

Step-by-step explanation:

What's the percentage multipier for 0.6%?

Answers

Answer:

Solution Given;

0.6%=0.6/100=0.006

So

0.006 is the percentage multipier for 0.6%.

Let's check

We need to convert it into decimals

0.6%0.6×1/1000.6×0.0010.006

0.006 is the answer

The product of double the number four

!!!Translate the following sentence into a variable expression!!!

Answers

Product is the multiplication so doubling 4 will be 8

pls help asap

Twenty-seven minus 3/2 of a number (x) is not more than 36. What is the number? A. x > 42 B. x ≥ -6 C. x < 3 D. x ≤ -6

Answers

Answer: B.) x ≥ -6

Step-by-step explanation:

Which form most quickly reveals the zeros (or "roots") of the function?
Choose 1 answer:
f(2)=3(x+6)2 - 75
B
f(x) = 3x2 + 36x +33
f(x) = 3(x + 1)(x +11)
Write one of the zeros.
T =

Answers

Answer:

c

Step-by-step explanation:

Plz help! I have two parts to this :(

Answers

If I am correct, it is 36 because its b x h x l x 1/2

express the following fractions as the sum or difference of two fractions (x^2+y^2)/x^4

Answers

Answer:

 [tex]\frac{1}{x^2}[/tex] + [tex]\frac{y^2}{x^4}[/tex]

Step-by-step explanation:

[tex]\frac{x^2 + y^2}{x^4}[/tex] = [tex]\frac{x^2}{x^4}[/tex] + [tex]\frac{y^2}{x^4}[/tex] = [tex]\frac{1}{x^2}[/tex] + [tex]\frac{y^2}{x^4}[/tex]

The solution of the expression (x²+y²)/x⁴ is [(1/x² + y²/x⁴)].

What is an expression?

The mathematical expression combines numerical variables and operations denoted by addition, subtraction, multiplication, and division signs.

Mathematical symbols can be used to represent numbers (constants), variables, operations, functions, brackets, punctuation, and grouping. They can also denote the logical syntax's operation order and other properties.

The given expression is  (x²+y²)/x⁴. The expression will be solved as,

E =  (x²+y²)/x⁴

Separate the terms into two fractions,

E =  (x²+y²)/x⁴

E = (x²/x⁴) + ( y² / x⁴)

Divide the divisible terms and solve,

E = (1/x² + y²/x⁴)

To know more about an expression follow

https://brainly.com/question/17581179

#SPJ2

From his eye, which stands 1.61 meters above the ground, Jacob measures the angle
of elevation to the top of a prominent skyscraper to be 25°. If he is standing at a
horizontal distance of 281 meters from the base of the skyscraper, what is the height
of the skyscraper? Round your answer to the nearest tenth of a meter if necessary.

Answers

Step-by-step explanation:

we have a right-angled triangle, that is "hovering" 1.61 m above the ground.

the Hypotenuse (the side opposite of the 90 degree angle) is the line of sight from the eye to the top of the skyscraper.

one leg is the height of the skyscraper (minus the 1.61 m).

the other leg is the ground distance from Jacob to the skyscraper (281 m).

we know already 2 angles : the 90° angle between the ground distance and the skyscraper height. and the 25° between the ground distance and the line of sight.

and as we know that the sum of all angles in a triangle is always 180°, we know that the third angle (between the line of sight and the skyscraper height) is

180 - 90 - 25 = 65°

now we can use the law of sines

a/sin(A) = b/sin(B) = c/sin(C)

(the ratio between a side and its opposing angle)

to get all missing side lengths.

the 25° angle is opposite of the skyscraper height, and the 65° angle is opposite of the ground distance (the only side length we know so far).

so,

height/sin(25) = 281/sin(65)

height = 281 × sin(25)/sin(65) = 131.0324519... m

to get the full height of the skyscraper, we need to add the 1.61 m that the described triangle was "hovering" above ground.

therefore, the height of the skyscraper is

131.0324519... + 1.61 = 132.6424519... ≈ 132.6 m

Find the solutions to x2 = 24.
A. x = 16.2
X
B. X= 14,6
C. X= +6.14
D. X = +216

Answers

I think it’s c, am not shuree tho

Which of the following is NOT a true statement?

pls answer i'll give brainliest ​

Answers

Answer:

C.) AFD measures 30°

Step-by-step explanation:

it is 150 degrees

Answer:

the answer is C

Step-by-step explanation:

A)  angle EFC is 80 degrees so a is a true statement

B) angle BFC is 60 degrees and angle DFE is 30 degrees 60+30=90 so that's a true statement

D) angle AFB is 40 degrees and angle CFD is 50 degrees  40+50=90 so that a true statement

that leaves C and angle AFD is more than 30 degrees its 150 degrees

HELP PLZ I NEED THIS DONE ASAP

Answers

[tex]\text{Given that,}\\\\y^2 +9y +3 \\\\\text{when}~ y = -2,\\\\(-2)^2 +9(-2) +3 = 4-18+3 = 7 -18 = -11,[/tex]

solve the equation (x-4) (x+9) = 0

Answers

Answer:

x = 4,-9

Step-by-step explanation:

This is a quadratic equation in x-intercept pattern. Since this is completely factored, we can simply solve the equation like a linear.

First, separate two equations. Let r be the roots of equation, therefore:

[tex]\displaystyle \large{r=\begin{cases}x-4=0\\ x+9=0 \end{cases}}[/tex]

I use the r-variable to denote the roots of equations (not necessary), simply separate both then solve it like a linear.

[tex]\displaystyle \large{r=\begin{cases}x-4+4=0+4\\ x+9-9=0-9 \end{cases}}\\\displaystyle \large{r=\begin{cases}x=4\\ x=-9 \end{cases}}[/tex]

Therefore, the roots of equation are x = 4 or x = -9. In short, we can write as x = 4,-9.

The reason why we use OR instead of AND because one of x-values satisfy the quadratic equation hence ‘or’ is more suitable than ‘and’. However, you must write all valid solutions instead of writing only one x-value from two.

___________________

Let me know in the comment if you have any questions.

QUICKEST ANSWER GETS BRAINLEIST.

Answers

A is the correct answer

i need help assap

Consider the function g(x) shown below over a domain of [1,∞).

g(x) = 2(x – 1)2 – 3

Part A
Determine g–1(x).


Part B
Identify the domain and range of g(x) and g–1(x). Represent the domains and ranges in inequality, interval, and set notation. Describe the relationship between the domains and ranges of g(x) and g–1(x).


Part C
Graph g(x) and g–1(x). Describe the relationship between the graphs of g(x) and g–1(x).

Answers

It’s 2=x because you have start with 2 then 5

-hello10olleh (hello)

Answers

Answer: The slope of the line is b. 3

Answer:b

Step-by-step explanation:

What is the measure of angle B?

Answers

Answer:

m∡B = 120°

Step-by-step explanation:

base angles are equal

adjacent angles are supplementary so:

4x+20 + 3x-15 = 180

7x + 5 = 180

7x = 175

x = 25

∡B = 4(25) + 20

∡B = 120°

Answer:

39.6

Step-by-step explanation:

(3x-15)+(4x+20)+2x=360

9x+5=360

9x=355

*Divide each side by 9*

X=39.4

*SUBSTITUTE X*

3(39.4)-15=103.2

4(39.4)+20=177.6

*ADD THE TOTALS FROM ABOVE*

103.2+177.6= 280.8

360-280.8=79.2

*DIVIDE THE TOTAL BY 2*

79.2/2=39.6

*CHECK*

3(39.4)-15=103.2

4(39.4)+20=177.6

103.2+177.6+39.6+39.6=360 IS CORRECT.

Hope this helps! :)

Which is the value of x?
10
7

Answers

Answer: 12.2

Step-by-step explanation:  Pythagorean Theorem

90 is 150 of what number HELP

Answers

Answer: 60%
Step by step: 90 is 60% of 150
Divide to get your answer

What is the common denominator of StartFraction 1 Over a EndFraction StartFraction 1 Over b EndFraction in the complex fraction StartFraction 1 Over a EndFraction minus StartFraction 1 Over b EndFraction divided by StartFraction 1 Over a EndFraction 1 Over b EndFraction?.

Answers

The common denominator is 1

Given the expression:

[tex]\frac{1/a-1/b}{1/a1/b}[/tex]

Find the LCM of the numerator to have:

[tex]\dfrac{\frac{b-a}{ab} }{\frac{1}{a} \frac{1}{b} }[/tex]

Simplify both the numerator and the denominator to have:

[tex]= \dfrac{\frac{b-a}{ab} }{\frac{1}{ab} }\\= \frac{b-a}{ab} \times ab\\=\frac{b-a}{1} \times 1 \\=\frac{b-a}{1}[/tex]

From the result, we can see that the common denominator is 1

Learn more about fractions here: https://brainly.com/question/17743912

Answer:

here is the correct answer for edge2022

Step-by-step explanation:

Find 85 - 72 x 4 ÷ 2 (13 - 11)

Answers

Answer:

13

Step-by-step explanation:

using BODMAS

13-11=2

SO 2*2=4

4/4=1

1*72=72

THEREFORE it is 85-72 =13

Other Questions
Is this table proportional?XY1 3 34 125 157 21 Your engineering department is asked to evaluate the performance of a new 370-hp sports car. You know that 27% of the engine's power can be converted to mechanical energy of the 1200-kg car, and that the power delivered is independent of the car's velocity. What do you report for the time it will take to accelerate from rest to 60 mi/h on a level road? A geriatric team wants to involve the patients family in his or her care. When is the best time to invite the family to become part of the team?not at allbefore the patients procedureafter the patients dischargeat the very beginning 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Which one is correct Which of the following lines of a dialogue is most appropriate for a naturalist play A. Where are we going? What's happening? B. Does thou require a repast this morn?C. Hark, what light younder window breaks?D. Whither are we bond? At optimum light intensity, which atmospheric gas most directly influences the rate of photosynthesis? * Jamal has a plan to save money for a trip. Today, Jamal deposits $8.00 into the savings account. Each week, Jamal will add $5.00 to the amount that is deposited into the savings account. The table below shows the relationship between the number of weeks and how much money, in dollars, Jamal deposits into the savings account. Week 0 1 2 3 4 Deposit (Dollars) 8 13 18 23 28 Let f(x) represent the amount of money Jamal deposits into saving account at the end of x weeks. Based on the table, what is f(8)? Which details should you look for in determining the setting of a story? Check all that apply. the storys time period where the author lives the characters environment how long the story is where the story takes place As a missionary, where did you spend most of your time?A) at a churchB) in the fieldsC) in CaliforniaD) at a mission Por que tenen que dar el motivo de viaje?Los agentes quieren visitar los pasajeros en su hotelLos agentes can la informacin a los pasajerosLos pasajeros necesitan poner el motivo en el pasaporteLos pasajeros no pueden pasar por la aduana sin la informacin When Hugo puts a book and a candle on a scale, the scale reads 8.705 lbs. When he removes the book, the scale reads 4.93 lbs. How much does the book weigh? A colony of bacteria is growing at a rate of 50% per hour.If this rate of growth remains the same and the colony starts with 100 bacteria, approximately how many bacteria will there be after 6 hours?1139 bacteria Dwayne is selling hamburgers and cheeseburgers. He has 100 burger buns. Each hamburger sells for $3, and each cheeseburger sells for $3. 50. Which system of inequalities represents the number of hamburgers, h, and the number of cheeseburgers, c, he must sell to have sales of at least $80? h c 80 3h 3. 5c 100 h c 80 3h 3. 5c 100 h c 100 3h 3. 5c 80 h c 100 3h 3. 5c 80. Match the following regulations to their appropriate categories. Name and describe one way the Crusades affected the Christian population. 50 points + brainilest!! Is Neptunes volume more than 100 times as large as earth the narrowest official definition of the money supply is Help help help help help Jimmy needs to rent a banquet hall for a charity dinner. Facility A charges customers a one-time fee of $500 plus $15 for every meal. Facility B charges customers a one-time fee of $1000 plus $5 for every meal.Which inequality can be used to find m, the minimum number of meals that can be served so that the total charge at Facility A is less than the total charge at Facility B?#1. 500+15m1000+5m#3. 500m+151000m+5