Supply chain issues and a flu outbreak have caused a surge in prices for which grocery item?

Answers

Answer 1

Supply chain issues and a flu outbreak have resulted in a surge in egg prices.

Prices of eggs in some countries have risen sharply due to supply chain issues and flu outbreaks. One factor behind this shortage of egg supply and the sharp rise in their prices is an outbreak of avian influenza, also called the bird flu, a highly contagious virus that is proven to be fatal to chickens. It has affected more than 57 million birds including chickens.

Therefore, supply chain issues and a flu outbreak have produced a surge in egg prices.

You can learn more about avian influenza at

https://brainly.com/question/21103924

#SPJ4


Related Questions

The scientific method is the technique used by economists to determine

Answers

Economists employ the scientific method to ascertain the laws or fundamentals of economics. To explain and/or forecast the behavior of people or institutions, certain rules or principles have been developed .

By methods, what do you mean?

The term "technique" refers to a certain way of carrying out an action, typically one that requires practical abilities. tests carried out with a novel method. Alternative words: way, system, approach, technique More Technique synonyms.

It's important to comprehend the distinction between skill and technique. Again, technique is the capacity for physical performance, but skill is the capacity for performance in a gaming environment. Technique should always come first when coaching young players.

To know more about  developed visit:

https://brainly.com/question/28011228

#SPJ4

irs issues 12 million tax refunds after correcting 2020 returns

Answers

For the 12 million Americans who were eligible for a tax credit on unemployment benefits received during the first year of the COVID-19 outbreak, the IRS has now issued their delayed tax refunds.

Give a brief account on IRS issuing 12 million tax refunds.

The IRS has completed correcting millions of 2020 tax year returns; as a result, the organization has issued 12 million tax refunds, averaging $1,232 apiece and amounting to around $14.8 billion in total. The American Rescue Plan Act of 2021 was amended to give people with modified adjusted gross incomes of less than $150,000 a tax cut of up to $10,200 on unemployment benefits. As a result, the IRS had to modify the tax returns. The tax break was created to assist the millions of people who were made unemployed as a result of the COVID-19 outbreak or lost their jobs and got unemployment compensation. However, due of the timing of the American Rescue Plan Act's introduction, many taxpayers who had received unemployment benefits throughout 2020 had already filed their 2020 federal tax returns without the benefit of the unemployment compensation deduction.

To know more about, IRS, visit :

https://brainly.com/question/29692276

#SPJ4

sarah is going to buy a new cell phone. the cell phone costs $175 plus a 10% sales tax. what is the total price that sarah will pay for her new cell phone?

Answers

Total price = the cell phone costs $175 plus a 10% sales tax

=  $175 +  10% of $175

=$192.5

The cost of the new cell phone that Sarah is going to buy is $172 with additional payment charges of sales tax which are 10% sales tax.

On substituting the given values as mentioned in the question, the total price that Sarah has to pay are phone cost and sales tax, which is $192.5.

A sales tax is a tax paid to a governing body on the sale of certain goods and services. Laws generally allow sellers to collect taxes from consumers at the time of purchase.

When a tax on goods or services is paid by consumers directly to the governing body, it is usually called a use tax.

To learn more about 'sales tax', here:

https://brainly.com/question/29442509

#SPJ4

What is technology and give 5 examples?

Answers

Technology refers to techniques, processes, and equipment that are the outcome of scientific knowledge being applied to practical objectives. Technology is evolving at a rapid pace.

What are 5 examples of technology?

Electronic technologies, mechanical technologies, medical technologies, industrial and manufacturing technologies, and tools are five sorts of technologies. Phones, computers, wheels, and washing machines are all examples of technology.

The use of scientific ideas and concepts in the design, manufacture, installation, testing, servicing, usage, and control of electrical and electronic parts, equipment, and systems is known as electronics technology. Electronics technology is employed in virtually every industry, including commercial, residential, and industrial.

Mechanical Engineering Technology is the application of engineering concepts and technology advancements to the development of usable goods and manufacturing machines.

Medical technology is described as technologies that diagnose, treat, and/or improve a person's health and well-being, including both low- and high-risk medical equipment ranging from tongue depressors, surgical gloves, and medical thermometers to insulin pumps, pacemakers, and in vitro diagnostics.

Industrial technology is the application of engineering and manufacturing technology to increase the speed, ease, and effectiveness of production. Industrial technology employs imaginative and technically adept people who may assist a business in achieving effective and lucrative output.

To learn more about technology visit here:

https://brainly.com/question/7804664

#SPJ1

which of the following is not part of the opportunity cost of going on vacation? a. the money you spent on food b. the money you spent on airline tickets c. the money you spent on a broadway show d. the money you could have made if you had stayed home and worked

Answers

The money spent on food is not a part of the opportunity cost of taking off on vacation. So option a. is correct. The opportunity cost of production of an entity refers to the cost which has to be renounced in terms of the next best alternative which could be evoked out of that cost.

Therefore, food is part of our everyday costs which will not be evaluated as the sacrifice of any additional commodity. Opportunity cost is the forgone advantage that would have been derived from a choice not preferred. To adequately evaluate opportunity costs, the costs and advantages of every alternative known must be assessed and weighed against the others. Contemplating the significance of opportunity costs can teach individuals and organizations to be more prosperous in decision-making.

To learn more about the opportunity cost visit here:

https://brainly.com/question/1549591

#SPJ4

If you are looking at a cell under the microscope and you found it has a flagella and lysosomes what would you conclude about this cell?.

Answers

You would conclude that this cell is a type of eukaryote, most likely a protozoan. Flagella and lysosomes are both organelles found in eukaryotic cells, so this cell is likely to be eukaryotic in nature.

What is eukaryote?

A eukaryote is an organism with a complex cell or cells, in which the genetic material is organized into a membrane-bound nucleus or nuclei. Eukaryotes include animals, plants, and fungi, as well as protists, such as amoebas, algae, and some other single-celled organisms. All eukaryotes have a membrane-bound cell nucleus, where the genetic material is found. This is in contrast to prokaryotes, which lack a nucleus and nuclear membrane, and instead have their genetic material spread throughout the cytoplasm.

To learn more about eukaryote
https://brainly.com/question/6663522
#SPJ4

What are the 2 advantages of shopping online?

Answers

Customers can purchase items from the comfort of their own homes or workplace. Shopping is made easier and convenient for the customer through the internet. It is also easy to cancel the transactions. Saves time and efforts

What is a similarity between a cover letter and an introduction statement?

Answers

Although they have a similar pattern, a cover letter and an introduction letter serve completely distinct purposes. A letter of introduction informs a potential employer about your qualifications and expresses your desire to be considered for a position.

Is there a word completely?

While a cover letter and an introduction letter both follow a similar pattern, they serve quite distinct purposes. An introduction letter informs a potential employer of your qualifications and expresses your desire to be thought about for any open opportunities. Fully means entirely, thoroughly indicates that "every element of it is done," utterly means entirely, and absolutely also means completely, according to the Macmillan Dictionary. These expressions all refer to moving closer to a state or a goal while still falling short of achieving it. The most frequent and widely applicable word for this is almost.

To know more about position visit:

https://brainly.com/question/15668711

#SPJ4

all pledges are legally enforceable; however, the league's experience indicates that 10% of all pledges prove to be uncollectible. what amount should the league report as pledges receivable, net of any required allowance account?

Answers

The league should report the total amount of pledges as pledges receivable, but should also have an allowance account for uncollectible pledges in the amount of 10% of the total pledges. This allowance account would then be subtracted from the total pledges receivable to give the "net" number of pledges that can reasonably be expected to be collected.

What is a league report?

A league report is a document or set of documents that provide financial and/or operational information about a league organization. This can include financial statements, such as balance sheets and income statements, as well as other information on the league's operations, such as membership numbers, attendance at events, and other metrics. The purpose of a league report is to provide transparency and accountability to the league's members, stakeholders, and the public.

To know more about stakeholders, visit:

https://brainly.com/question/29532080

#SPJ4

What kind of economy does Cuba have today?

Answers

The economy of Cuba is a mixed command frugality dominated by state- run enterprises. Utmost of the labor force is employed by the state.  

Cuba's  profitable freedom score is 29.5, making its frugality the 175th freest in the 2022 indicator. Cuba is ranked 31st among 32 countries in the Americas region, and its overall score is below the indigenous and world  pars.  

Cuba has what is known as a command frugality, where government  opinions — not  request forces of  force and demand — largely determines the  product, vacuity and value of goods.  It's also not extensively considered a advanced country but rather a developing country and its ranking as the world's number one,  utmost sustainable advanced country may leave some sceptical or scratching their heads.

To learn more about Cuba, visit here

https://brainly.com/question/13135683

#SPJ4

What are examples of economic influences?

Answers

Economic indicators include commodity prices (oil, steel, gold, etc.), inflation, interest and currency rates, and economic growth.

What do you mean by commodity?

A commodity is a basic good that is used in trade and is interchangeable with other items of the same kind. Most frequently, commodities are utilized as raw materials to create other products or services. Thus, a commodity typically refers to a raw resource utilized to create completed goods.

The bulk of products that customers buy contain commodities, such as tires, tea, ground beef, orange juice, and apparel. Copper, crude oil, wheat, coffee beans, and gold are some of the most widely used commodities.

When all units of production are the same, regardless of

To know more about  economic visit

https://brainly.com/question/14787713

#SPJ4

there should also be a method called make purchase that receives the number of items to be bought and decreases amount by that much. the regular prices of these products to be

Answers

The method of quantity discount is to make purchase that receives the number of items to be bought and decreases amount by that much. The regular prices of these products to be on discounted rates.

When making a purchase, the regular prices for an item is the price that is typically charged. This is the amount that is listed on the item or the price that is quoted by the seller. A quantity discount is a pricing structure that rewards customers for purchasing larger quantities of a product or service.

This type of discount is usually offered by retailers or wholesalers in order to encourage customers to buy in bulk. The discount is typically based on the total quantity of the purchase, and the amount of the discount can vary depending on the size of the order. Prices may vary depending on the store, the item, or the time of year, but the regular price is the amount that is generally expected to be paid.

To know more about purchase, click here.

https://brainly.com/question/24112214

#SPJ4

Which is an illustration of a microeconomic question?Select one:a. What is the current national rate of unemployment?b. Will a new type of television set increase the number of buyers?c. Is the economy experiencing a decline in the rate of inflation?d. Is the production of goods and services in the economy lower this year than last year?

Answers

B. Will a new type of television set increase the number of buyers is an illustration of a microeconomic question.

A microeconomic question is one that examines the economic behavior of individuals or firms and how they interact in specific markets. Microeconomics looks at how prices are determined, how resources are allocated, and how individuals and firms make decisions. Option b. Will a new type of television set increase the number of buyers is a microeconomic question as it examines how the introduction of a new product will affect the behavior of buyers in the market for televisions, which is a specific market. On the other hand, options a, c and d are macroeconomic questions as they examine economic aggregates such as national unemployment rate, inflation rate, and production of goods and services in the economy.

To know more about microeconomic question lick below:

https://brainly.com/question/29617237#

#SPJ4

locust company disposed of an asset at the end of the eighth year of its estimated life for $25,500 cash. the asset's life was originally estimated to be 10 years. the original cost was $125,100 with an estimated residual value of $12,600. the asset was being depreciated using the straight-line method. what was the gain or loss on the disposal?

Answers

The $3300 gain was on the disposal

Calculation od dep=(original cost-Salvage value)/Estimated life

=(65400-6400)/10=$5900 per year

After 8 year Carter Company disposed of an asset for $21500

Book value after 8 years=65400-(5900*8)=18200

Gain=21500-18200=3300 gain

The garbage collector no longer has to call the objects' Object function because the Dispose method handles all object cleanup. Override finalise. The SuppressFinalize method call stops the garbage collector from running the finalizer as a result. Call to GC if the type lacks a finalizer

To learn more about disposal

https://brainly.com/question/14732695

#SPJ4

a developer of a large shopping center donated a building and land to hetting co. without charge. the agreement provided that the company employ 350 people for 10 years. the land was appraised at $65,000 and the building at $44,000. required: 1. prepare the journal entry to record the acquisition of the land and building. 2. next level how should the 10-year agreement be reported in the financial statements? 3. next level if the title were not to pass until after 10 years, would your answers to requirements 1 and 2 change?

Answers

The total land debit is $65000, the total building debit is $44000, and the given Capital Credit is $109000.

A journal entry has been the act of maintaining or producing records of any economic or non-economic transaction. Transactions are recorded in an accounting journal, which displays a company's debit and credit balances. The journal entry can all be made up of many records, each of which is either one debit or even a credit. Financial statements are written documents that describe a company's commercial activity and financial performance.

Financial accounts are often audited by government agencies, accountants, and companies, among others, to ensure correctness and for tax, financing, and investment purposes. If the cash given to business is less than the amount originally recorded as the value of the land, the sale results in a loss, which you record as a debit. Capital credits are the funds or margins that remain after all business-related expenses have been paid.

To know more about the Journal entry, here

https://brainly.com/question/20421012

#SPJ4

why would investors compare their performance to the s&p 500?

Answers

There are several well-known stock indices, but the S&P 500 is the most commonly used benchmark.

The Standard and Poor's 500, or simply the S&P 500, is a stock market index that tracks the stock price performance of 500 large companies listed on US stock exchanges. It is one of the most watched stock indices.

This index is one of the factors in calculating the Conference Board Leading Economic Index, which is used to predict the direction of the economy.

The index is made up of 500 large companies in a variety of industries and tracks the US corporate economy.

However, when it comes to large-cap stocks, the index misses a much broader spectrum of mid- and small-cap stocks that make up the bulk of the economy.

As a market capitalization-weighted index, the benchmark also disproportionately weights large companies, which make up the majority of the index.

To know more about 'S&P 500', here:

https://brainly.com/question/30020358

#SPJ4

where y is gdp, c is consumption, i is investment, (g ) is government spending, (t ) is net taxes, and there is no international trade, public saving equals

Answers

Public saving equivalents: Y - C - G when Y is a Gross domestic product, C is utilization, I is a venture, and G is government spending and there is no worldwide exchange.

In a closed economy, public reserve funds (NS) rise to the amount of private and public recoveries, or Gross domestic product - C - G.

The public authority spending plan shortfall is equivalent to G - T in situations where Y is a Gross domestic product, C is utilization, I is a venture, G is government use, T is net expenses, and there is no worldwide exchange. At the point when there is an excess in the public authority spending plan, public saving is helpful.

Learn more about GDP, c:

https://brainly.com/question/14436536

#SPJ4

Who controls property and distribution of income in a communist system?

Answers

Dictatorial leaders controls property and distribution of income in a communist system.

Income is the spending and saving opportunity acquired by an entity during a certain time period, which is usually stated in monetary terms. Income in the United States is defined by tax law as any wage, salary, profit, interest payment, rent, or other type of profits earned in a calendar year for families and individuals.

Discretionary income is frequently defined as gross income less taxes and other deductions, and it is extensively used to compare taxpayer wellbeing.

To know more about Income here-

https://brainly.com/question/14732695

#SPJ4

an agent accepts an unsolicited telephone order from a new customer to buy shares of a nyse stock at the current market price. the salesman executes the order and then forwards the new account form to the manager for the manager's signature. which statement is true?

Answers

The statement which is true is that, the agents actions are prohibited because the manager has to approve the opening of the account which is prior to the first trade.

Here, the procedure in order to open a new account is in order to have the manager approve the opening of the account which is said to be prior to the first trade. Thus, it is prohibited for the agent in order to execute the trade before the manager tends to approve the accounts opening.

However, the margin accounts tend to require more than just a basic new account form. So, the customers who are seen to be opening the margin accounts must fill out and sign the margin agreement first.

To learn more about the margin account here:

https://brainly.com/question/29841879

#SPJ4

NAUPA, The National Association of Unclaimed Property Administrators represents state governments that actively locate owners while protecting forgotten unclaimed money until found.
It is a non-profit organization affiliated with the National Association of State Treasurers and the Council of State Governments. True Or False

Answers

True It is a non-profit organization that is a member of the Council of State Governments and the National Association of State Treasurers.

What does the term "non-profit organization" imply?

The term "non-profit organization" refers to a group that was established with the intention of doing something other than making a profit and for which the members, officers, or directors receive no portion of the organization's earnings.

What exactly is a nonprofit organization and how do they operate?

A nonprofit organization (NPO) is one that is not motivated by profit but rather by a commitment to a particular cause, which is the goal of all income beyond what is necessary to run the organization. NPOs are granted tax-exempt status by the federal government as a result, exempt from income tax.

To learn more about non-profit organization here:

https://brainly.com/question/21307064

#SPJ4

It is a non-profit organization that is a member of the Council of State Governments and the National Association of State Treasurers is a true statement.

What exactly is a nonprofit organization and how do they operate?

A group that was created with the goal of doing something other than making a profit is referred to as a "non-profit organization" and one in which the members, officers, or directors do not receive any of the profits.

A nonprofit organization (NPO) is one that is driven by a commitment to a particular cause rather than by a desire to make a profit. This cause is the focus of any funds received in excess of what is required to run the organization. Therefore, NPOs are exempt from paying income tax because of the federal government's provision of tax-exempt status.

To learn more about non-profit organization, visit:

https://brainly.com/question/21307064

#SPJ4

which market structure has one large firm supplying all of the output?

Answers

Monopoly market structure has one large firm supplying all of the output

What is Monopoly?

Monopoly is a popular board game in which players compete to acquire wealth by buying and trading properties and developing them with houses and hotels. Players take turns rolling a pair of dice and moving around the board, buying and trading properties, and collecting rent from other players when they land on their properties. The game ends when all properties are owned and one player has amassed the most wealth.  Monopoly is a great game for family game nights or for friends to get together and have fun. It's a classic game that can provide hours of entertainment.

What is an Firm?

A firm is a business organization, typically one that provides goods or services to customers in exchange for money. A firm is generally organized as a company, partnership, or sole proprietorship. Firms are usually owned and managed by individuals who use their own capital to finance their business operations. The owners of the firm are typically the shareholders and are responsible for managing the firm's finances and operations.Firms provide a variety of goods and services, ranging from basic products such as food and clothing to complex services such as financial advice and medical care. They also play an important role in the economy, providing jobs and generating tax revenue.

To know more about Firm,

https://brainly.com/question/28039495

#SPJ4

1) in your job as an assistant manager at a fast food restaurant, you are frequently responsible for training new hourly workers to operate at the facility's food preparation equipment. how could you expand your experience and expertise in training new activities into a process, a project, and perhaps even a program?

Answers

As an Assistant Manager at a fast food restaurant, training new hourly workers to operate the food preparation equipment is a frequent responsibility.

To expand this experience and expertise, you can create a process, a project, and even a program to develop more efficient and effective training activities.

By creating a process, you can map out each step of the training program and determine the most efficient way to complete each step.

A project can then be developed to lay out the timeline, resources, and goals of the training.

Finally, you can develop a program to make the training process more organized, effective, and efficient. This program can also be used to track the progress of the training, making it easier to evaluate the success of the program.

By creating a process, a project, and a program, you can expand your experience and expertise in training new activities and develop a more successful training program.

To learn more about project, click here:

https://brainly.com/question/29564005

#SPJ4

assume that sales are predicted to be $3,400, the expected contribution margin is $1,020, and a net loss of $150 is anticipated. the break-even point in sales dollars is:

Answers

To start with, register the decent charges and commitment edge proportion as displayed underneath:

Commitment edge- Fixed costs = Overall gain( mischance)

$1,020 - Fixed costs = -$ 150

Fixed cost = $ 1020$ + 150

=  $1,170

Commitment edge proportion = Commitment edge proportion/ Deals

= $ 1020/$ 3400 = 0.3

Equal the original investment point in deals bones

= Fixed costs / Commitment edge proportion

Equal the original investment point in deals bones

= Fixed costs commitment edge costs

=  $1,170/0.3 = $3,900

The break-even point in deals bones

is  $3,900

Hence, the correct option is  $3,900

Hence option (D) is correct.

The break-even point is the place where all out cost and complete income are original, significance there's no mischance or gain for your independent adventure.

Learn more about computation of break-even point:

https://brainly.com/question/23993939

#SPJ4

This question is not complete , here I am adding the complete question:

assume that sales are predicted to be $3,400, the expected contribution margin is $1,020, and a net loss of $150 is anticipated. the break-even point in sales dollars is:

(A) $1,170

(B) $3,550

(C) $2,530

(D) $3,900

(E) $2,230

the degree to which employees are fully involved in their work combined with the strength of their commitment to their jobs and company is called blank . multiple choice question. behavioral wellness self-satisfaction company loyalty employee engagement need help? review these concept resources.

Answers

The degree to which employees are fully involved in their work combined with the strength of their commitment to their jobs and company is called option D: employee engagement.

Employee engagement is a measure of how deeply interested people are in their work and how strongly committed they are to the organisation. Engagement is an agreement between an employer and employee to work together for the greater good, based on the greatest levels of trust. Employees that are engaged typically perform at their highest levels and produce more work while feeling more satisfied in their jobs. As a result, option D is the best one.

Autonomy in a job refers to how much control, freedom, and discretion employees have over how they organise their work and carry out their duties. The results of the work depend on the efforts and decisions made by the employees in occupations with a high degree of autonomy.

To know more about employee engagement, refer to the following link:

https://brainly.com/question/28920261

#SPJ4

which of the following is generally incorrect in comparing manufacturing and service in the following context. group of answer choices degree of customer contact: (manufacturing, low); (service, high) uniformity of input: (manufacturing, high); (service, low) uniformity of output: (manufacturing, high); (service, low) degree of customer contact: (manufacturing, high); (service, low) amount of product inventory: (manufacturing, high); (service, low)

Answers

The best approach is to costs per unit. Both production and service activities cover the costs related to each unit. The distinction between providing a service and providing a tangible good is minimal aside from that.

What separates the manufacturing and service sectors of the economy?

Manufacturers often follow a set method for making their goods. Large-scale production of items takes place in an environment analogous to a factory or warehouse. The final result is generally interchangeable. Industries categorized as services are those that provide services rather than produce goods.

What significant differences are there between service and manufacturing operations?

Contrary to manufacturing operations, which prioritize creating and storing goods, service-providing activities allow for the simultaneous creation and consumption of services.

To know more about Cost per unit visit:

brainly.com/question/29355214

#SPJ4

under the controls section of the marketing plan, which area provides a detailed account of how the specific actions of the marketing plan will be carried out and who will be responsible for those activities?

Answers

Hence, the correct answer is implementation.

What exactly is a marketing plan?

A marketing plan is a detailed document or blueprint that covers the advertising and marketing efforts for the future year. It describes the business operations necessary to achieve specific marketing objectives within a defined time frame. A marketing plan also includes a description of a company's current marketing position, a discussion of the target market, and a description of the marketing mix that will be employed to achieve the company's marketing goals. A marketing plan has a formal framework, but it may be used as either a formal or informal document, making it highly versatile. It contains some historical data, prospective estimates, and approaches or plans for accomplishing marketing objectives.

To learn more about the marketing plan, click

https://brainly.com/question/29775565

#SPJ4

What are the 7 economic social goals?

Answers

Some examples of national economic goals include effectiveness, equality, economic freedom, full employment, economic development, security, and stability.

An entrepreneur is a person whose responsibility it is to start and expand a business or other organisation, who bears personal responsibility for debts, and whose main goal is to make money.

It is impossible to overestimate the significance of an entrepreneur's engagement since, by starting a company, they may produce things and services for the benefit of customers and society by combining other production factors like land, labour, and money. In addition to fostering economic success and redistributing it among society's members, entrepreneurship can lower unemployment.

For such more question on economic.

https://brainly.com/question/28244992

#SPJ4

type of routine payments are collected from patients, at the time of visit, to help establish patient billing policies

Answers

Medical debt collection occurs when an overdue medical bill is sent to a debt collection agency.

What is Routine payments?

Recurring payment is a payment model where the customers authorize the merchant to pull funds from their accounts automatically at regular intervals for the goods and services provided to them on an ongoing basis.

Forms of Payment

Cash and Checks. The use of cash and checks are in decline; however, they are still valid and accepted payment methods.

Money Order. Money orders are in the same situation as cash and checks – they're declining.

Debit and Credit.

Mobile Payments or Digital Wallets.

Digital Currency - Bitcoin.

Examples include cable bills, cell phone bills, gym membership fees, utility bills, and magazine subscriptions. Recurring billing may also be referred to as automatic bill payment.

To learn more about pay refers to:

https://brainly.com/question/25898631

#SPJ4

What characteristics of a command economy exist in a mixed economy?

Answers

Command  economy are characterized by large  overpluses and  dearths, monopolies, and prices set by the government.

Mixed economy are characterized by commercial profitability, the use of  financial and  financial  programs to stimulate growth, and the actuality of a public and private sector.   A mixed frugality has three of the following characteristics of a  request frugality. First, it protects private property. Second, it allows the free  request and the laws of  force and demand to determine prices.

Third, it's driven by the  provocation of the  tone- interest of  individualities.   In a command economy, all  coffers are  possessed and controlled by the state. In a mixed system, private  individualities are allowed to  enjoy and control some( if not most) of the factors of  product. Free  request  husbandry allow private  individualities to  enjoy and trade, freely, all  profitable  coffers.

To learn more about command economy, visit here

https://brainly.com/question/13719381

#SPJ4

______ ownership of capital gives capitalism its name.

Answers

Private property: In a market system, individuals and businesses, not governments. Own most of the properties. Is this extensive private ownership of capital that gives capitalism its name.

What is defined private property?

Private property refers to ownership of property by an individual, basically anyone or anything other than the government. Private property consists of real estate, buildings, goods and intellectual property (copyrights, patents, trademarks and trade secrets).

What's the purpose of private property?

Private property increases efficiency by incentivizing resource owners to maximize their value. The higher the value of the resource, the greater the trading power granted to the owner of the resource. Because in the capitalist system, the person who owns the property is entitled to whatever value is added to the property.

To know more about Private Property visit here:

https://brainly.com/question/29613081

#SPJ4

Other Questions
the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25 Work out the equation of the line shownbelow.Give your answer in the form y = mx + c,where m and c are integers or fractions intheir simplest forms.Y-160-140--120--100-80-60-40-20--80 -70 -60 -50 -40 -30 -20 -10 0-20--40--60-80--100-120--140---160-10 20 30 40 50 60 70 80 x A 2kg block is attached to a spring for which k=200N/m, it is hold at an extension of 5cm and then released at t=0. Find the displacement as a function of time. The velocity , acceleration and total energy when x=+_ A/2. the lowest prices. the most product options. the fewest product options. superior value for the price. the bloch sphere geometric representation of a quantum state is parameterized by two angles and such that . what are the values of the angles and for the state Evaluate the expression for x = -8.x = 16, and x = 4.X 4 which nursing action is appropriate when providing care to a patient who experiences apiration because of enteral feedings A. I hiked on mountain paths, biked on wooded trails, and kayaked on clear ponds.B. These drones can soar, swoop, hover, and even make the buzzing sound of a housefly.C. Mr. Patel improves our school every day by teaching his classes well, he coaches his team well, he even gives personal advice and counseling to students who need it.D. We are kinder, more thoughtful, more conscientious, better students. The first category of evaluation and management codes is? Which of these is a new form of payment that has been recently accepted in some companies?A. CashB. CheckC. Credit CardD. Cryptocurrency 9800 workers in Arizona retired in 2010 as compared to 23,430 in 2009. What is the absolutechange in the number of workers that retired? evaluating a company's performance not only by its ability to generate economic profits but also by its impact on people and the planet. Triple bottom line T/F tatagcgtagctagct repeated in tandem over and over is a gene sequence that codes for a protein. Which is a trusted resource for determining the right contraceptive to use? What is the new point after rotating the point (3,5) 180 clockwise? Is a polysaccharide that functions in energy storage in plants? helppppppppppp meeeeeeeeee What was your basis in determining the activities or tasks to be done?