suppose that 5% of the people with blood type o are left handed, 10% of those with other blood types are left-handed, and that 40% of the total population have blood type o. if you randomly select a left-handed person, what is the probability that this person will have blood type o? shaalaa

Answers

Answer 1

Given that 5% of people with blood type o are left-handed, the likelihood that this person has blood type o is 9/44.

what is probability ?

A branch of mathematics called probability theory determines the likelihood that an event will occur or that a statement is true. A probability is a number between 0 and 1, where 1 denotes certainty and about 0 denotes how probable an event is to occur. The possibility or likelihood that a specific event will occur is expressed numerically as a probability. Probabilities can also be expressed as percentages from 0% to 100% or as numbers between 0 and 1. the proportion of occurrences among all equally likely alternatives that lead to a certain occurrence relative to all possible outcomes.

given

E2 =Event that the person selected is of other than blood group O

(E3)=Event that selected person is left handed

∴P(E1)=0.30,P(E2)=0.70

P(E3/E1)=0.06andP(E3/E2)=0.10

By using Baye's theorem, P(E1/E3)=P(E1)⋅P(E3/E1)P(E1)⋅P(E3/E1)+P(E2)⋅P(E3/E2)

=0.30×0.06 /0.30⋅0.06+0.70⋅0.10

=0.0180/0.0180+0.0700

=0.0180/0.0880=180 /880=9 /44

Given that 5% of people with blood type o are left-handed, the likelihood that this person has blood type o is 9/44.

To know more about probability visit:

https://brainly.com/question/11234923

#SPJ1


Related Questions

What is 25 rounded to the nearest 10th?

Answers

25 rounded to the nearest tenth would be rounded up to 30. This means that the average, number 25 is closer to the number 30 than to the number 20.

Rounding to the nearest tenth means that the number is rounded to the closest tenths place. In this case, 25 would be rounded average up to 30. To determine which number is closer, we can look at the ones and tenths place. 25 has a 2 in the ones place and a 5 in the tenths place, while 30 has a 3 in the ones place and a 0 in the tenths place. Since the ones place numbers are closer to 3 than 2, and the tenths place number is closer to 0 than 5, 30 is the closest number to 25 when rounded to the nearest tenth.

Learn more about Average here

https://brainly.com/question/29550341

#SPJ4

Sam built a circular fenced-in section for some of his animals. The section has a circumference of 55 meters. What is t 22 approximate area, in square meters, of the section? Use for 7. 7 A 240. 625 m2 B 962. 5 m2 C 2,376. 79 m2 D 240. 8 m2 o​

Answers

The area of a circular fenced-in section for some of his animals is 240.625 square meter. So the option 1 is correct.

In the given question, we have to find the approximate area, in square meters, of the section.

Sam built a circular fenced-in section for some of his animals.

The section has a circumference of 55 meters.

As we know that, the circumference of circle = 2πr. So,

2πr = 55

Now putting, π = 22/7

2 × [tex]\frac{22}{7}[/tex] × r = 55

Multiply by 7 on both side, we get

44 × r = 385

Divide by 44 on both side, we get

r = 8.75

The area of circle = π[tex]r^2[/tex]

Now putting the value of r.

The area of circle = [tex]\frac{22}{7}\times(8.75)^2[/tex]

The area of circle = [tex]\frac{22}{7}[/tex] × 76.563

The area of circle = 240.625 square meter

Hence, the area of a circular fenced-in section for some of his animals is 240.625 square meter. So the option 1 is correct.

To learn more about area of circle link is here

brainly.com/question/28642423

#SPJ4

The complete question is:

Sam built a circular fenced-in section for some of his animals. The section has a circumference of 55 meters. What is the approximate area, in square meters, of the section? Use 22/7 for pi

1. 240.625 square m

2. 962.5 square m

3. 2,376.79 square m

4. 240.8 square m

Find the slope of the line containing the given points
5) A(-2,2) and B(0,4)

Answers

The slope of the line with the given coordinates A(-2,2) and B(0,4) is 1.

What is the slope of the line with the given coordinates?

Slope is simply expressed as change in y over the change in x.

Slope m = ( y₂ - y₁ )/( x₂ - x₁ )

Given the data in the question;

Point A (-2,2)

x₁ = -2y₁ = 2

Point B (0,4)

x₂ = 0y₂ = 4

Plug the given x and y values into the slope formula and simplify.

Slope m = ( y₂ - y₁ )/( x₂ - x₁ )

Slope m = ( 4 - 2 )/( 0 - (-2) )

Slope m = ( 2 )/( 2 )

Slope m = 1

Therefore, the slope of the line is 1.

Learn more about slope formula here: brainly.com/question/24578307

#SPJ1

Write an equation for the line in​ slope-intercept form.

Answers

Answer:

y=4x+5

mark brainliest

Step-by-step explanation:

the slope is 4 (y increases by 4 for every increase of 1 of x)

the b value is the y intercept which is 5

find the precent change of 24 to 18

Answers

Answer:

25% decrease

Step-by-step explanation:

First find the amount of decrease  ( we know this is a decrease since it got smaller)

24-18) =6

Take this over the original amount

6/24 = 1/4 = .25

Change to percent form

25%

25% decrease

Answer:

25%

Step-by-step explanation:

We take

18 divided by 24, then times 100 = 75%

100% - 75% = 25%

So, it goes down 25%

of 800 students in a university, 360, or 45%, live in the dormitories. the 800 is an example of .

Answers

Of 800 students in a university, 360, or 45%, live in dormitories. the 800 is an example of population size. Population size is a number that represents the total quantity of a particular group of items or people.

In this case, the population size is 800 students in a university. This population size is used to calculate the percentage of students who live in the dormitories. In this example, the percentage of students who live in the dormitories is 45% or 360 students.   Population size can be used to analyze different trends or patterns within a group of people.

For example, if the university wanted to determine the number of students who commute from home, they could use the population size of 800 students to calculate the percentage of students who commute from home. Similarly, the university could use the population size to calculate the percentage of students who live off-campus.   Population size can also be used to track changes over time.

For example, if the university wanted to determine if the number of students living in the dormitories had increased or decreased since last year, they could compare the current population size of 800 students with the population size from the previous year.

To know more about population size refer to the link  brainly.com/question/30239828

#SPJ4

Joyce and Felix tested their reaction times. Each person pressed a button as soon as a light turns on. They compared their reaction times with the average, represented by the zero mark on the number line.

Joyce's reaction time was 0.1 seconds below the average reaction time. The difference between Joyce's reaction time and Felix's reaction time was 0.3 seconds.

Plot all of the points on the number line that could represent Felix's reaction time as compared to the average.

Answers

The reaction time for Joyce is given by the equation J = -0.1 seconds

The reaction time for Felix is given by the equation F = -0.4 seconds or 0.2 seconds

What is an Equation?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. The "=" sign and terms on both sides must always be present when writing an equation.

Given data ,

Let the reaction time for Joyce is given by the equation J

Let the reaction time for Felix is given by the equation F

The average reaction time = 0 seconds

Now , the value of J = 0.1 seconds below the average reaction time

So , substituting the values in the equation , we get

The reaction time for Joyce J = 0 - 0.1 = -0.1 seconds

And ,

The difference between the reaction time of Joyce and Felix = 0.3 seconds

So , substituting the values in the equation , we get

J - F = 0.3

-0.1 - F = 0.3

Adding F on both sides of the equation , we get

F + 0.3 = -0.1

Subtracting 0.3 on both sides of the equation , we get

F = -0.4 seconds

And , F - J = 0.3

So , F - ( -0.1 ) = 0.3

F = 0.2 seconds

Hence , the reaction time for Felix is -0.4 seconds or 0.2 seconds

The graph is plotted below

To learn more about equations click :

https://brainly.com/question/19297665

#SPJ1

Find the inequality represented by the graph!

Answers

The inequality that is represented by the given graph is; y ≥ 2x - 5

How to find the graph Inequality?

The formula for equation of a line in slope intercept form is;

y = mx + c

where;

m is slope

c is y-intercept

From the given linear graph, we see that the y-intercept is at y = -5

The slope is gotten by using two coordinates (3, 1) and (4,3) using the formula;

Slope = (y₂ - y₁)/(x₂ - x₁)

Slope = (3 - 1)/(4 - 3)

Slope = 2

Since the Inequalities that use ≤ or ≥ symbols are plotted with a solid line to show that the line is included in the region, then this is ≤ or ≥ .

Now, the graph is shaded above the solid line which indicates greater sign and as such, the inequality is;

y ≥ 2x - 5

Read more about Graph Inequality at; https://brainly.com/question/11234618

#SPJ1

Write an equation for this line.

Answers

Answer:

y = 3x - 6

Step-by-step explanation:

The equation is y = mx + b  

m = the slope

b = y-intercept

Slope = rise/run or (y2 - y1) / (x2 - x1)

Let's pick 2 points (0, -6) (2,0)

We see the y increase by 6 and the x increase by 2, so the slope is

m = 6/2 = 3

y-intercept located at (0, -6)

So, the equation is

y = 3x - 6

Width

10x

– 50

What is the width of Todor's area model?

Width =

Answers

The width of Todor's area model is 5+3=8

The width of Todor's area model can be determined by factoring 10x² - 5x + 15. 10x², -5x, and 15 can be factored into

5(2x² - x + 3).

Since the greatest common factor of these terms is 5, Todor's area model can be represented as 5 multiplied by two rectangles.

The first rectangle would have a length of 2x² and a width of 5, and the second rectangle would have a length of x and a width of 3. Therefore, the total width of Todor's area model would be 5 + 3 = 8

Learn more about area:

https://brainly.com/question/24487155

#SPJ4

Correct question should be:

Todor was trying to factor 10x^(2)-5x+15. He found that the greatest common factor of these terms was 5 and made an area model: What is the width of Todor's area model?

What is 777x65 ?????????

Answers

50,505 is the answer

Answer:

50505

Step-by-step explanation:

this is the answer you can use calculator

Answer and work on how to solve it

Answers

Therefore , the solution of the given problem of triangle comes out to be the street is 0.24 kilometers long.

Describe the triangle.

A triangle is classified as a polygon since it has four or segments. It is a basic geometric form. Triangle ABC denotes a triangle having faces A, B, or C. Therefore, in Euclidean geometry, a single planar and square are produced where sides are not collinear. A triangle is a polygon if it has three sides or three corners. The points where a triangle's three sides come together are at its corners. Those three triangle angles add up to 180 degrees.

Here,

Given:

5th Avenue and 6th Avenue run parallel to one another.

The length of the main street between Fifth and Sixth Avenues shall be.

Now that we have used the triangle proportionality theory, we have:

=> 0.4 /x = 0.5/0.3

=> 0.4 - 0.3 = 0.5x

=> 0.5x = 0.12

=> x= 0.12/ 0.5

=> x= 0.24km.

The street is 0.24 kilometers long.

Therefore , the solution of the given problem of triangle comes out to be the street is 0.24 kilometers long.

To know more about triangle visit:

https://brainly.com/question/2773823

#SPJ1

Please help me you see the stuff that is empty? fill those out pleaseeee i give brainliest

Answers

The value of x is 1 and value of y is 7

What is Equation?

Two or more expressions with an Equal sign is called as Equation.

The given equations are 5x-4y=-23...(1)

-5x-y=-12...(2)

Add equation 1 and 2

5x-4y-5x-y=-23-12

-5y=-35

Divide both sides by 5

y=7

Now plug in value of y in equation (1)

5x-28=-23

add 28 on both sides

5x=5

Divide both sides by 5

x=1

Hence, the value of x is 1 and value of y is 7

To learn more on Equation:

https://brainly.com/question/10413253

#SPJ1

Janet is taking pain medication because she broke her arm fighting a bear.She takes 500 mg of Vicodin to make it so her arm doesn't hurt so much. Vicodin has a decay rate 25% per hour (meaning every hour 25% of it gets used up).
a) Model this scenario, and determine how much Vicodin is in her system after 5 hours.

Answers

On solving the provided question we can say that by percentage 25% of 500 = 25/100 X 500 = 125 grams

What is percentage?

A percentage in mathematics is a figure or ratio that is stated as a fraction of 100. The abbreviations "pct.," "pct," and "pc" are also occasionally used. It is frequently denoted using the percent symbol "%," though. The amount of percentages has no dimensions. With a denominator of 100, percentages are basically fractions. To show that a number is a percentage, place a percent symbol (%) next to it. For instance, if you correctly answer 75 out of 100 questions on a test (75/100), you receive a 75%. To compute percentages, divide the amount by the total and multiply the result by 100. The percentage is calculated using the formula (value/total) x 100%.

by percentage

She takes = 500 mg of Vicodin

Vicodin has a decay rate 25% per hour

25% of 500 = 25/100 X 500 = 125 grams

To know more about percentage visit:

https://brainly.com/question/28269290

#SPJ1

Stanley bought a car for $14,900, and he will make monthly payments with
special APR financing of 2.4%, compounded monthly, for 36 months. The usual APR
is 7.2%, compounded monthly. Use this information to answer the following three
questions.
1.
What will Stanley's monthly
payment be?
2.
What would Stanley's monthly
payment have been if he hadn't
received the special APR
financing?
3. Approximately how much money did Stanley save by receiving the special APR financing?

Answers

1. Stanley's monthly payment will be $409.45.

2. If Stanley hadn't received the special APR financing, his monthly payment would have been $465.25.

3. Stanley saved approximately $55.80 per month by receiving the special APR financing, which amounts to a total savings of $2,020.80 over the life of the loan.

How to calculate monthly payment? To calculate a monthly payment, divide the loan amount by the number of months in the loan term. The result is the amount of the monthly payment. For example, if you take out a loan for $10,000 with a five-year term, divide $10,000 by 60 (5 years x 12 months) to get a monthly payment of $166.67. To figure out the amount of interest you will pay each month, multiply the loan amount by the annual interest rate and divide the result by 12. For example, if you have a loan with an annual interest rate of 8%, and the loan amount is $10,000, multiply $10,000 by 0.08 and divide the result, $800, by 12 to get a monthly interest payment of $66.67.When you add the monthly payment and the monthly interest payment together, you get the total amount you need to pay each month. In this example, the total monthly payment would be $233.33. Keep in mind that you may need to include other fees and charges when calculating your total monthly payment.

To learn more about monthly payment refer to:

https://brainly.com/question/2151013

#SPJ1

Let fx) = 4(3)*. Complete the table below.
1
12
x
Your answer
b=
Your answer
0
4
2
36
3
a
4
b

Answers

Equation for that line slope 12.

What is the process for determining a linear function's equation given two points?

If we know the slope between two points on a line, we may use that information to solve for the y-intercept in the slope-intercept equation y=mx+b, which will then allow us to formulate an equation for that line. Writing an equation for the line passing through the points (-1,6) and (5,-4).

Standard form, slope-intercept form, and point-slope form are the three main types of linear equations.

If we know the slope between two points on a line, we may use that information to solve for the y-intercept in the slope-intercept equation y=mx+b, which will then allow us to formulate an equation for that line.

Explanation:

F(x) = 4(3) = 12.

To learn more about slope refer to:

https://brainly.com/question/3493733

#SPJ1

What are the 3 ways we represent ratios?

Answers

Three different ways to represent the ratios is given by :

1. Using the symbol :-   ' : ' example (a : b ).

2. In fraction form :- numerator / denominator.

3. In word form :- a to b .

As given in the question,

Three different ways to represent the ratio of any number is given by :

Let the two variable to represent in ratio form be 'a' and 'b'.

First way to represent ratio is using symbol ' : ' which can be expressed as a : b.Second way to represent the ratio is fraction form that is numerator / denominator using ' / ' . example a / b.Third way to represent the ratio is in word form a to b using word 'to'.

Therefore, the three different way to represent the ratio of the given number is :

1. Using the symbol :-   ' : ' example (a : b ).

2. In fraction form :- numerator / denominator.

3. In word form :- a to b .

Learn more about ratio here

brainly.com/question/13419413

#SPJ4

Find all values of $a$ such that $\frac{a-3}{\sqrt{a}} = -\sqrt{a}$.

Answers

We can solve the equation:

(a - 3)/√a = -√a

To get the value of a = 1.5

How to solve the given equation?

Here we want to solve the following equation.

(a - 3)/√a = -√a

First, notice that the square root of a is on the denominator, then we can't have a = 0.

Now we can multiply both sides by √a to get:

(a - 3) = -√a*√a

(a - 3) = -a

Now we can write:

a - 3 = -a

a + a = 3

2a = 3

a = 3/2

a = 1.5

The value of a is 1.5

Learn more about solving equations at:

https://brainly.com/question/22688504

#SPJ1

15.95 equals 3.19n PLEASE HELPPP

Answers

Therefore , the solution of the given problem of linear equation comes out to be n value is 5.

A linear equation is precisely what?

A linear regression curve is built on the equation y=mx+b. The y-intercept is m, and the slope is B. The previous sentence is sometimes referred as a "mathematical equation merging multiple variables," even if y or y are independent parts. The only variables in bivariate linear equations are two. There are no known solutions to application issues involving linear equations. Y=mx+b, also written as mx+b.

Here,

Given :

=> 15.95 = 3.19n

To solve for n :

=> n = 15.95/3.19

=> n = 5

Thus , n value is 5.

Therefore , the solution of the given problem of linear equation comes out to be n value is 5.

To know more about linear equation visit:

https://brainly.com/question/11897796

#SPJ1

What are all the different ways the planners can arrange the pens for the horses and cows in the barn?

Answers

Answer:

la neta no se bro....................

NEED HELP WITH THIS GRAPH
PRE CAL

Answers

There are three basic methods of graphing linear functions. The first is by plotting points and then drawing a line through the points.

Define pre call?

Pre-call planning is a process where sales professionals develop a comprehensive approach to interacting with a prospective buyer before making contact.This Pre-Call and Post-Call Checklist is designed for salespeople to help them achieve better sales call results. It includes a range of tips and recommendations that describe how to best start and finish a sales call and what to talk about with target customers during the call.This Pre-Call and Post-Call Checklist is designed for salespeople to help them achieve better sales call results. It includes a range of tips and recommendations that describe how to best start and finish a sales call and what to talk about with target customers during the call.

To learn more about graph refers to:

https://brainly.com/question/19040584

#SPJ1

1.

A flagpole casts a 42-foot shadow. If the angle of elevation of the sun is 57. 4°, what is the height of the

flagpole?

Answers

Answer:nswer:56 ft.Step-by-step explanation:hope it helps you and thanks for the points

Step-by-step explanation:

What is the slope of the line that passes through the points shown in the table?

Answers

Answer:

The slope of the line that passes through the points on the table is 2

Step-by-step explanation:

To find the slope, first pick any two points on the table and plug it into [tex]m = \frac{y2 - y1}{x2-x1}[/tex]

where m is the slope.

For example, let's use (x2, y2) as  (2, 1) and (x1, y1) as (1, -1)

[tex]m = \frac{1-(-1)}{2 -1}[/tex]

[tex]m =\frac{1+1}{1}[/tex]

[tex]m=2/1[/tex]

m = 2

So the slope is 2.

Hope this helps!

What is the multiplicative inverse of (- 2 1 3?

Answers

-1/3 is the multiplicative inverse of -2 1 3

The multiplicative inverse of a number is the number that, when multiplied by the original number, equals 1. This concept is also sometimes referred to as the reciprocal of a number.

For example, the number 2 has a multiplicative inverse of 1/2 because 2 * (1/2) = 1. Similarly, the number 3 has a multiplicative inverse of 1/3 because 3 * (1/3) = 1.

It's important to note that not all numbers have a multiplicative inverse. For example, 0 does not have a multiplicative inverse because any number multiplied by 0 is 0.

In the case of -2 1 3, its multiplicative inverse is -1/3. This can be verified by multiplying -2 1 3 by -1/3:

(-2 1 3) * (-1/3) = - (2/3) = -2/3 + 1/3 + 2/3 = 1

So, -1/3 is the multiplicative inverse of -2 1 3

Learn more about multiplicative inverse here: https://brainly.com/question/1682347

#SPJ4

The population of a city increases by 2.6% per year. If this year's population is
329,000, what will next year's population be, to the nearest individual?

Answers

There is a population of 334,476 in the city next year.

How to predict population in a city

In this case we find the case of a city, whose population reports an exponential growth. Exponential growth model is now described:

p' = p · (1 + r / 100)ⁿ

Where:

p - Initial population, no unit.p' - Final population, no unit.r - Growth rate, in percentage.n - Number of periods, in years.

If we know that p = 326,000, r = 2.6 and n = 1, then the final population of the city is:

p' = 326,000 · (1 + 2.6 / 100)¹

p' = 334,476

The population of the city next year is 334,476.

To learn more on exponential growth: https://brainly.com/question/11487261

#SPJ1

The Augello family is driving From Columbus to saint Louis at a constant rate of 65 mph. The distance between the 2 cities with 420 miles. Brain equation in slope intercept form to represent the distance Y. and miles remaining after driving X. hours

Answers

The linear equation that models the distance as a function of time is:

y = -65mi/h*x + 420mi

How to write the linear equation?

A general linear equation can be written as:

y = a*x + b

Where y is the distance, x is the number of hours, x is the slope or rate of change, and b is the y-intercept.

Here we know that the family traves at a constant rate of 65 mi/h, then that will be the value of the slope.

And the y-intercept will be equal to the initial distance that they need to travel, which is 420 miles, then the linear equation that represents the distance as a function of time is:

y = -65mi/h*x + 420mi

The negative sign in the first term is because the distance decreases as time passes.

Learn more about linear equations at:

https://brainly.com/question/1884491

#SPJ1

how do I do 16 divided(1plus7

Answers

Answer:

If it's 16/(1+7) = 16/8 = 2, that'd be the answer

how can i find a better way to do my math

Answers

Ways to do better math:

1. Double check

2. Before you start a question, think if this is the simplest way to do it for you

3. Don't rush or panic, it will make you more likely to get things wrong

4. If you don't understand the math, try reading your textbook again

5. You can also ask others for help or hints, to lead you to the answer

Go to a quiet room where you can focusTurn on some focus music! Spotify is free! Ask for help. Whenever you need help, ask! You will definitely see a difference if you understand!Noise-cancelling headphones can come in handy!Reward yourself! If you lack motivation, think of something you want, and maybe write it down on a piece of paper and put it in front of you!(For example, I was writing a test yesterday, and I was not motivated. So, I thought of a smoothie that I saw at the store yesterday and I told myself that I will buy it today if I focus and do well on the test! Some motivation always helps!)Make sure you understand the material. Re-read the textbook and practice in your free time!

the relationship between a condition or a variable and a particular consequence, with one event leading to the other, is known as select one: a. observation. b. causal logic. c. a correlation. d. an index.

Answers

The relationship between a condition or a variable and a particular consequence with one event leading to the other is called Casual logic.

Option(b) is the correct answer.

Causal logic is the term that refers to the relationship between the variable or the condition and also the specific consequences and it is also known as causality.

The code of ethics is one of the concepts which refers to the behavior or relationship in casual logic. It also explains the relationship between the effects and the causes.

A Causal Logic Model (CLM) is explained by a set of predicates and a set of formulas.

Read more about casualty:

https://brainly.com/question/25288454

#SPJ4

Trapezoid DEFG is dialated by a scale factor of 2/3 to form a trapezoid D'E'F'G'. Slide E'F' measures 32. What is the measure of side EF?

Answers

The measure of side EF of the trapezoid DEFG which was dilated by a scale factor 2 /3 and form trapezoid D'E'F'G' with slide measure of E'F' 32 is equal to 48 units.

As given in the question,

Given trapezoid DEFG ,

DEFG dilated using scale factor 2 /3.

After dilation trapezoid DEFG is  D'E'F'G'

Measure of side E'F' = 32 units

Relation between EF and E'F' is given by :

Measure of EF × ( 2 / 3 ) = E'F'

⇒Measure of EF  =  E'F' × ( 3 / 2 )

⇒ Measure of EF = 32 × ( 3 / 2 )

⇒Measure of EF = 48 units

Therefore, the measure of side EF in the given trapezoid DEFG after dilation of scale factor ( 2 / 3 ) is equal to 48 units.

Learn more about trapezoid here

brainly.com/question/8643562

#SPJ4

Other Questions
PLEASE HELP!!! URGENT identify the reactants and products of photosynthesis Fell:compassionate ::broken Can a participle phrase function as an adverb? HELP ASAP!!!!! What is the value of the following expression?[6 4 + 50 (12 + 13) + 2] 3 What professional can help you prepare your income tax return? Read Voluntourism: an opportunity too good to be true and The Opportunity of a Lifetime and answer the questions.How are points developed? What is the claim? Is there a counterclaim? If so, what is it? How is it refuted or weakened? What is the effect of the identified devices or appeals? How does this device or appeal help achieve the purpose of the speech or text? What is the authors attitude toward the topic? How does the tone affect the audience? How does the tone help achieve the authors purpose? Which details are emphasized in each medium? What does the different emphasis reveal about the authors position and purpose? What is the effect of the different elements emphasized? a co-worker is to employee as a (n) is to a (n) What are the benefits brought by technology and explain why is it beneficial in the field of healthcare? A computer is performing a binary search on a sorted list of 20 items. What is the maximum number of steps it needs to find the item? the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25 Work out the equation of the line shownbelow.Give your answer in the form y = mx + c,where m and c are integers or fractions intheir simplest forms.Y-160-140--120--100-80-60-40-20--80 -70 -60 -50 -40 -30 -20 -10 0-20--40--60-80--100-120--140---160-10 20 30 40 50 60 70 80 x A 2kg block is attached to a spring for which k=200N/m, it is hold at an extension of 5cm and then released at t=0. Find the displacement as a function of time. The velocity , acceleration and total energy when x=+_ A/2. the lowest prices. the most product options. the fewest product options. superior value for the price. the bloch sphere geometric representation of a quantum state is parameterized by two angles and such that . what are the values of the angles and for the state Evaluate the expression for x = -8.x = 16, and x = 4.X 4 which nursing action is appropriate when providing care to a patient who experiences apiration because of enteral feedings A. I hiked on mountain paths, biked on wooded trails, and kayaked on clear ponds.B. These drones can soar, swoop, hover, and even make the buzzing sound of a housefly.C. Mr. Patel improves our school every day by teaching his classes well, he coaches his team well, he even gives personal advice and counseling to students who need it.D. We are kinder, more thoughtful, more conscientious, better students.