The barber cuts 61 haircuts in 4 days. Determine the rate for a ratio of the two different quantities.

Answers

Answer 1

The rate of the number of haircuts to the number of days as -

{r} = 15.25.

What are ratios?In mathematics, a ratio shows how many times one number contains another.In mathematics, an expression or mathematical expression is a finite combination of symbols that is well-formed according to rules that depend on the context.Mathematical symbols can designate numbers (constants), variables, operations, functions, brackets, punctuation, and grouping to help determine order of operations and other aspects of logical syntax.

Given is that the barber cuts 61 haircuts in 4 days.

We can write the rate for the ratio of the number of haircuts to the number of days as mentioned below -

{r} = 61/4

{r} = 15.25

Therefore, the rate of the number of haircuts to the number of days as -

{r} = 15.25.

To solve more questions on algebraic expressions, visit the link below -

brainly.com/question/1041084

#SPJ1


Related Questions

Which statement best explains whether the following table represents a linear or nonlinear function?


x −2 −1 0 1 2
y −4 −2 0 2 4
The table represents a nonlinear function because there is not a constant rate of change in the input values.
The table represents a nonlinear function because there is not a constant rate of change in the output values.
The table represents a linear function because there is a constant rate of change in the input and output values.
The table represents a linear function because there is not a constant rate of change in the input and output values.

Answers

Answer:

its C; or their is a constat change in the output values and it is non linear

Step-by-step explanation:

this is because we can see that 0/0 match each other. There is a constamt chage in the imput valu.

Select whether the relationship between each pair of quantities is proportional. A bike rental store charges $20 as a flat fee, plus $5 per hour.

Answers

The given relation can be written as:

y = $5*x + $20

Notice that we have a constant term, thus it is not a proportional relation.

Is the relationship proportional?

A general proportional relationship can be written as:

y = k*x

Where k is a constant of proportionality.

The given case is:

" A bike rental store charges $20 as a flat fee, plus $5 per hour."

We know that there is a flat fee of $20 plus $5 per hour, so we can write the equation:

y = $5*x + $20

Notice that we have a constant term, thus, it is not a proportional relation.

Learn more about proportional relations at:

https://brainly.com/question/12242745

#SPJ1

Look at this diagram:

If TV and WY are parallel lines and m

Answers

If TV and WY are parallel lines, then m∠VUX = 53°.

What are parallel lines?

Lines that are parallel to one another on a plane do not intersect or meet at any point. They are always equidistant from one another and parallel. Non-intersecting lines are parallel lines. Parallel lines intersect at infinity is another way to put it.

It is given that line segment TV and WY are parallel to each other.

A line ZS intersect the parallel lines.

The measure of m∠TUS = 53°.

The measure of m∠VUX = m∠TUS as they are both vertically opposite angles and hence they are same.

Therefore, m∠VUX = 53°.

To learn more about parallel lines from the given link

https://brainly.com/question/26961508

#SPJ1

33. Jamal organizes an annual recycling drive to recycle cardboard. A recycling company

pays him for the cardboard he collects. The table shows the numbers of pounds of

cardboard and amounts of money collected in previous years of the recycling drive.

Recycling Drive Data

Pounds of Amount of

Cardboard Money Collected

1,630

$96

2,7

$110

3,220

$160

Part A

Use the data in the table to write an equation that can be used to find the amount of

money collected, y, for x pounds of cardboard.

Answers

From the table which shows numbers of pounds of cardboard and amounts of money collected in previous years of recycling drive , then equation to find amount of money collected is  y = 0.0126x + 75.462    .

From the table ,

we get the data that ,

amount paid for 1630 pounds of card board is = $96  ;

the amount paid for 2740 pounds of card board is = $110  ;

let the amount of money be denoted as = y ;

the amount of cardboard collected be denoted as = x  ;

we get the two set of points as (1630 , 96) and (2740 , 110) ;

the equation is ⇒ [tex](y-96) = (\frac{110-96}{2740-1630}) \times (x-1630)[/tex] ;

solving further ,

we get ;

⇒ [tex](y-96) = (\frac{14}{1110}) \times (x-1630)[/tex]

⇒ [tex](y-96) = 0.0126 \times (x-1630)[/tex]

⇒ [tex]y-96 = 0.0126x-20.538[/tex]

⇒ [tex]y = 0.0126x-20.538 +96[/tex]

⇒ y = 0.0126x + 75.462  ;

Therefore , the equation find the amount of money collected (y) , for "x" pounds of cardboard is y = 0.0126x + 75.462 .

The given question is incomplete , the complete question is

Jamal organizes an annual recycling drive to recycle cardboard. A recycling company pays him for the cardboard he collects. The table shows the numbers of pounds of cardboard and amounts of money collected in previous years of the recycling drive.

Pounds of Amount of Cardboard      Money Collected

            1630                                                   $96

            2740                                                  $110

            3220                                                  $160

Use the data in the table to write an equation that can be used to find the amount of money collected "y" , for "x" pounds of cardboard.

Learn more about Equation here

https://brainly.com/question/30278702

#SPJ4

A 50 foot ladder is set against the side of a house so that it reaches up 48 feet. If Jack grabs the ladder at its base and pulls it 4 feet farther from the house, how far up the side of the house will the ladder reach now? (The answer is not 44 ft.) Round to the nearest tenth of a foot

Answers

Check the picture below.

before Jack moved the ladder

[tex]\textit{using the pythagorean theorem} \\\\ c^2=a^2+b^2\implies \sqrt{c^2 - b^2}=a \qquad \begin{cases} c=hypotenuse\\ a=adjacent\\ b=opposite\\ \end{cases} \\\\\\ \sqrt{50^2 - 48^2}=x\implies \sqrt{196}=x\implies \boxed{14=x}[/tex]

after Jack pulled the ladder

[tex]\textit{using the pythagorean theorem} \\\\ c^2=a^2+b^2\implies \sqrt{c^2 - a^2}=b \qquad \begin{cases} c=hypotenuse\\ a=adjacent\\ b=opposite\\ \end{cases} \\\\\\ \sqrt{50^2 - (x+4)^2}=y\implies \sqrt{50^2 - (14+4)^2}=y \\\\\\ \sqrt{50^2 - 18^2}=y\implies \sqrt{2176}=y\implies \boxed{46.6\approx y}[/tex]

Why are the trigonometric ratios the same for all 30 60 90 triangles?

Answers

Sine (sin), cosine (cos), tangent (tan), cotangent (cot), cosecant (cosec), and secant are the six trigonometric ratios (sec). A branch of mathematics called trigonometry in geometry deals with the sides and angles of a right-angled triangle. Trig ratios are therefore assessed in relation to sides and angles.

The trigonometric ratios (sine, cosine, and tangent) are the same for all 30-60-90 triangles because these triangles have a unique set of properties that make them special. Specifically, all 30-60-90 triangles have a right angle, and the angle measures are in a ratio of 1:2:3. Because of these properties, the length of the hypotenuse is always twice the length of the shorter leg, and the length of the longer leg is always equal to the square root of 3 times the length of the shorter leg. This allows us to determine the exact values of the trigonometric ratios for all 30-60-90 triangles, regardless of their size.

To know more about trigonometric ratios visit :

https://brainly.com/question/25122825?referrer=searchResults

#SPJ4

Put the following ORIGINAL values in order from least to greatest: 4⁻² -4², (-4)². 4⁰

Answers

The ordered exponential values, from least to greatest, are given as follows

-4², 4^(-2), 4^0, (-4)²

How to order the exponential values?

An exponential value is defined as follows:

y = a^x.

In which the base and the exponent are given as follows:

a is the base.x is the exponent.

When two numbers have the same base, we order them according to the exponent, the lowest the exponent, the lowest the number, hence they are ordered as follows:

4^(-2), 4^0, (-4)²

As:

2 > 0 > -2.

The smallest number is -4², as the exponential has precedence over the negative, hence the value is of -4² = -(16) = -16.

More can be learned about exponential values at https://brainly.com/question/25537936

#SPJ1

Pls help me evaluate 252.7 divided by 19

Answers

Answer:

Step-by-step explanation:

Answer: 13.3

252.7 divided by 19

A LOT OF POINTS

The table shows a comparison between EU and USA shoe sizes:

USA (Men's)
7
8
9
EU
40
41
42
(a) Develop a linear model to find the EU shoe size given the USA shoe size.
(b) Use your model to predict the EU shoe size for a USA Men's shoe
size of 12.
(c) Use your model to predict the USA Men's shoe size for an EU shoe size of 44.
(d) Interpret the gradient of your model in context.
(e) Given that USA Men's shoe sizes typically run from 6 to 16, calculate
a reasonable domain and range for your model.

Answers

Between men's and women's sizes, there is a roughly 1.5 size difference. Men's sizes apply to the unisex fashions. For women, go down 1.5 sizes.

What size is EUR 40 41 in US men?

( a ) By adding 33 to your current US size, you may convert a men's US shoe size to an EU size with ease. For illustration, if you are a US men's size 9, your EU size is 42. There are centimeter-based shoe sizes throughout Europe.

( b ) European Size 40.=25,3 cm. EU Size 41.=26.0 cm Size 42 in EU.

( c ) By adding 33 to your current US size, you may convert a men's US shoe size to an EU size with ease.

( d ) US to EU and EU to US shoe size conversion for Euro shoes. According to the ISO standard, an EU Size 40 is equivalent to a US women's shoe size 9.

( e ) By adding 33 to your men's US shoe size, you can convert to Euro Sizing.

To learn more about Sheo sizes refer to :

https://brainly.com/question/16041814

#SPJ1

Please help i need the wright answer please

Answers

Tadeo volunteered for 2 hours, and Dylan volunteered for 12 hours.

What is the solution to the equation?

The allocation of weights to the important variables that produce the calculation's optimum is referred to as a direct consequence.

Tadeo volunteered at the library 6 times as many hours over the weekend as Dylan. Together, they volunteered a total of 14 hours.

Let x represent Dylan's hours and y represents Tadeo's hours. Then the equations are given as,

y = 6x                    ...1

x + y = 14               ...2

From equations 1 and 2, then we have

x + 6x = 14

7x = 14

x = 2

Then the value of 'y' is given as,

2 + y = 14

y = 12

Tadeo volunteered for 2 hours, and Dylan volunteered for 12 hours.

More about the solution of the equation link is given below.

https://brainly.com/question/545403

#SPJ1

Mr. Grant wants to tile a 27 - square - foot area with square tiles. let s = the side length, in feet, of a square tile. Use the expression 27 divided by s2 to find the number of tiles Mr. Grant needs to buy

Answers

The expression for the number of tiles will be 27 / ( s² ).

What is an expression?

The mathematical expression combines numerical variables and operations denoted by addition, subtraction, multiplication, and division signs.

Mathematical symbols can be used to represent numbers (constants), variables, operations, functions, brackets, punctuation, and grouping. They can also denote the logical syntax's operation order and other properties.

Given that Mr. Grant wants to tile a 27 - square - foot area with square tiles. let s = the side length, in feet, of a square tile.

The number of tiles will be calculated as,

Number = Total area / Area of tile

Number = 27 / s²

Hence, the number of tiles will be calculated by the formula Number = 27 / s².

To know more about an expression follow

https://brainly.com/question/11447405

#SPJ1

Target sells skateboards for $35. To make a profit in the Spring and Summer months,
Target increases the price with a 42% markup. How much is the markup?

Answers

The markup is $14.70.

Answer:

$14.7

Step-by-step explanation:

To find the markup, you can use the following formula:

markup = (selling price - cost price) / cost price x 100

cost price = $35

selling price = $35 + markup

markup = (selling price - $35) / $35 x 100

Now you know that selling price = $35 + markup and markup = 42%, so you can use this information to find selling price:

markup = 42% = 0.42

selling price = $35 + $35*0.42 = $35+14.7 = $49.7

So the markup is $14.7

Select the correct answer. What is the value of x in the equation ln (x + 6) – ln (2x – 1) = 1? A. -0.21 B. 0.74 C. 1.35 D. 1.97

Answers

Answer: 6!

Step-by-step explanation: Isolate the variables. In order to do that you have to divide each side by factors that don't contain the variables.

Answer: Correct option is (D) 1.97

Step-by-step explanation:

According to question,

ln (x + 6) – ln (2x – 1) = 1.....(i)

Now by using log rule

Log(a) – Log(b)= Log(a/b)

Equation (i) becomes

Log((x + 6) / (2x - 1)) = 1

Taking anti log on both sides

((x + 6) / (2x - 1)) = e1

We know that

e1 = 2.72

Therefore,

((x + 6) / (2x - 1)) ≈ 2.72

(x + 6) = 2.72 (2x - 1)

x + 6 = 2.72 (2x) - 2.72 (1)

x + 6 = 5.44x - 2.72

8.72 = 4.44x

By cross multiplication we get,

x = 8.72 / 4.44

x = 1.97

Hence the correct value of x is 1.97

What is distance Class 9 formula?

Answers

Distance is the total movement of an object without any regard to direction. We can define distance as to how much ground an object has covered despite its starting or ending point.

The complete length of the path between any two points is called the distanceDistance is a scalar quantity as it only depends upon the magnitude and not the directionThe distance can only have a positive value

While distance and displacement appear to have the same meaning, they actually have very different definitions and implications. Displacement is the measurement of "how far an object is out of place," whereas distance refers to "how much ground an object has covered during its motion." Let's examine the distinction between distance and displacement in this post.

Distance refers to the actual length of the object's route. The shortest distance between an object's original and final positions is called displacement. It has a scalar value. A vector quantity, that is. A body can never travel a distance of zero.

To know more about distance visit :

https://brainly.com/question/26711747?referrer=searchResults

#SPJ4

4x - 10
40
120°
115°
24
24
Find the range of possible values for x


Inequalities in two triangles

Answers

Therefore , the solution of the given problem of inequality comes out to be x = 12.5°.

What exactly is inequality?

An inequality in mathematics is a linear relationship or a set of integers even without equal sign. Equilibrium follows equity ineluctably. Inequality exists between two variables when they are not equal. There are distinctions between equality and inequality. I've selected the most prevalent symbol because when variables aren't identical or comparable (). Any number of inequalities, no matter how little or large, can be used to compare values.

Here,

Given :4x -10 = 40

=> 4x = 40 + 10

=>  4x =50

=> x  =50/4

=>x= 12.5°

Therefore , the solution of the given problem of inequality comes out to be x = 12.5°.

To know more about inequality visit:

https://brainly.com/question/29914203

#SPJ1

Cesium-137 has a half-life of approximately 30 years. How much of a 40 g sample would be left after 90 years?

Answers

40 grams of sample would be left 5 grams after 90 years.

What is an exponential function?

Mathematical functions with exponents include exponential functions. f(x) = bˣ, where b > 0 and b 1, is a fundamental exponential function.

Given:

Cesium-137 has a half-life of approximately 30 years.

The amount of 40 g sample would be left after 90 years,

= 40 x (1/2[tex])^{90/30}[/tex]

= 40 x (1/2)³

= 5

Therefore, 5 grams would be left.

To learn more about the exponential decay;

https://brainly.com/question/14344314

#SPJ1

How do you transform the given graph of the parent function?

Answers

The process of transforming the graph into the parent function is explained below.

The term function is defined as a mathematical relationship from a set of inputs to a set of outputs

Here we have to define the process of converting the given graph into parent function.

In order to find that we must know the definition of parent function,

The term parent function is defined as the most basic version of an algebraic function.

There are basically four types of transformation are used.

They are listed as follows:

1) Translation which means that the change in the  position on the coordinate plane

2) rotation defined the change in the angle of object

3) reflection refers the a mirrored preimage, and

4) enlargement refers the increment of every side proportionally

To know more about function here.

https://brainly.com/question/28193995

#SPJ4

3 divided by 1 over 2

Answers

If i understood correctly, it should be 3/2

If we divide 3 by 1/2 then we put the multiplication sign and do reciprocal of 1/2 which is 2/1 or 2.. so 3 × 2= 6

(Hope this helps you out!)

I need answers please​

Answers

Answer:The graph of the equation that is a line that slants to the left would be (B) y = 2x+3

Step-by-step explanation:

The slope of the line in figure 3c-1a is (A) positive slope.

The y-intercept of the line in figure 3c-1b is (A) -3.

The trend of the graph of the line in figure 3c-1a is (B) increasing.

Please note that the above answers are based on the information provided, but since we do not have any information about figure 3c-1, it is not possible for me to confirm that the answers are accurate.

It is important to have more context and information to fully understand and answer the questions.

a recent study reported that 1.5 percent of flights are canceled by major air carriers. consider a simulation with 50 trials designed to estimate the number of canceled flights from a random sample of size 100, where the probability of success, a canceled flight, is 0.015. of the following dotplots, which best represents the possible results from the simulation described?

Answers

The possible results from the simulation described from the dotplots is with most of the dots at 1 and 2.

The dot plot that best represents the possible results from the simulation described would be one where the majority of the dots are clustered around 1-2 canceled flights, with some dots representing 0 canceled flights and a few dots representing 3 or more canceled flights. This is because with a probability of success (a canceled flight) of 0.015, the expected number of canceled flights in a sample of 100 would be 1.5 (0.015 x 100), and the distribution of the number of canceled flights from the 50 trials would likely be approximately normal with a mean of 1.5 and a standard deviation of 0.35 (the standard deviation for a binomial distribution with n = 100 and p = 0.015).

Learn more about probability and estimation using simulations here: https://brainly.com/question/19426816

#SPJ4

The triangles shown below must be congruent.
151-
80⁰
10
O A. True
OB. False
51
80⁰
10

Answers

Answer:

false

Step-by-step explanation:

The first and second terms of an exponential sequence (G.P) are respectively the first and third terms of a linear sequence (A.P). The fourth term of the linear sequence is 10 and sum of its first five terms is 60. find (a) the first five terms of the linear sequence and the sum of the first n terms. (b) the sum Sn of the first n terms of the exponential sequence. (c) the limit of Sn for large value of n​

Answers

Answer:

a) To find the first five terms of the linear sequence and the sum of the first n terms, we can use the following formulas:

The common difference of an A.P is (an - a1) / (n - 1)

The sum of the first n terms of an A.P is (n/2)(2a1 + (n-1)d)

Let the first term of the linear sequence be a1 and the common difference be d. Since the first and second terms of the exponential sequence are the first and third terms of the linear sequence, we can write:

a1 = a and a3 = ar^2

Given that the fourth term of the linear sequence is 10, we can write:

a1 + 3d = 10

Given that the sum of the first five terms of the linear sequence is 60, we can write:

(5/2)(2a1 + (5-1)d) = 60

Solving these two equations for a1 and d gives:

a1 = 2, d = 2

Therefore, the first five terms of the linear sequence are 2, 4, 6, 8, 10, and the sum of the first n terms is (n/2)(2a1 + (n-1)d) = (n/2)(2*2 + (n-1)2) = n2

b) To find the sum of the first n terms of the exponential sequence, we can use the following formula:

Sn = a(1 - r^n) / (1 - r)

where a is the first term and r is the common ratio.

Given that a1 = a and a3 = ar^2, we can write:

a = a1 and r^2 = a3/a1

Substituting these values into the formula for Sn gives:

Sn = a(1 - r^n) / (1 - r) = a1(1 - (a3/a1)^n) / (1 - (a3/a1)^(1/2))

c) As n tends to infinity, the limit of Sn is a1/(1-(a3/a1)^(1/2))

So the first five terms of the linear sequence are 2, 4, 6, 8, 10, the sum of the first n terms is 2n and the limit of Sn for large value of n is a1/(1-(a3/a1)^(1/2))

Step-by-step explanation:

A shift in the supply curve reflects a change in ____?

Answers

Answer: Supply

(The answer is supply because the opposite axis in a curve is supply, there's nothing other than that)

Answer: supply

Step-by-step explanation: Just took the test

What is the form of the Pythagorean triple generator?
O A. (x² + y²)² = (x² - y²)² + (2xy)²
O B. (x² + y²)² = (x² + y²)² + (2xy)²
O C. (x² + y²)² = (x² - y²)² - (2xy)²
O D. (x² - y²)² = (x² + y²)²-(2xy)²

Answers

The form of the Pythagorean triple generator is  (x² + y²)² = (x² - y²)² + (2xy)²

What is Pythagorean triple generator?A collection of three natural integers f, g, and h is referred to as a Pythagorean triple if f2 + g2 = h2. If a valid result is obtained when three numbers are entered into the Pythagorean Theorem formula, then three numbers DO form a Pythagorean triple. Neither two even numbers nor one odd number can ever be used to create a Pythagorean triple. This is accurate since an even number's square is an even number, and an odd number's square is an odd number. Pythagorean triples consist of the three positive numbers a, b, and c, where a2+b2 = c2. The symbols for these triples are (a,b,c). Here, a represents the right-angled triangle's hypotenuse, b its base, and c its perpendicular.

To learn more about Pythagorean triple generator refer to:

https://brainly.com/question/7988959

#SPJ1

Convert the degree measure below to radians.
1230°= ? radians

Answers

Answer:

41/6 n

Step-by-step explanation:

Given

1230°

Find

Convert degree to radians

Explanation

To convert a degree measurement to radians we use the following formula:

Substitute the value of 1230°:

Simplify:

Answer:

41/6 n

What are the different methods of factoring quadratics?

Answers

There are several different methods for factoring quadratics, including factoring by grouping, completing the square, difference of squares, sum and difference of cubes, synthetic division and quadratic formula.

Factoring by grouping: This method involves grouping the first two terms and the last two terms of the equation, and then factoring out a common factor.

Completing the square: This method involves changing the form of the equation so that the left side is a perfect square trinomial. This allows you to take the square root of both sides and solve for the roots.

Difference of squares: This method can be used when the equation is of the form a^2 - b^2 = 0. It can be factored as (a+b)(a-b) = 0.

Sum and difference of cubes: This method can be used when the equation is of the form a^3 + b^3 = 0 or a^3 - b^3 = 0. It can be factored as (a+b)(a^2-ab+b^2) = 0 or (a-b)(a^2+ab+b^2) = 0.

Synthetic division: This method can be used when the equation is in the form of a polynomial divided by a binomial. It uses division to factor the polynomial.

Quadratic Formula: This method can be used when factoring by grouping or completing the square seems difficult or impossible. This method uses the formula -b±√(b^2-4ac) /2a where a, b, c are the coefficient of x^2,x and constant term in the equation to find the roots of the quadratic equation.

To know more on factoring quadratics

https://brainly.com/question/1863222

#SPJ4

CC.3 Solve a system of equations by graphing: word problems W9J or For her parents' anniversary party, Kira is considering using one of two venues. A hotel in Stamford will cost $200 for a reservation, plus $50 per person. A restaurant in the same city will cost $75 per person, in addition to $150 for the reservation. In order to make the best decision, Kira figures out how many attendees it would take to have the venues cost the same amount. How many attendees would that be? Write a system of equations, graph them, and type the solution.

Answers

The hotel is $250 plus $25 per person so the equation would be y= 25x + 250
(Y is the total cost and x is the number of people)
the restaurant is $100 plus $40 per person so the equation would be
y = 40x + 100
What we want to know is which x value would make the y values equal to each other. So you can just replace the "y" in one equation with the other equation:
25x + 250 = 40x + 100
and then solve...
1. subtract 100 from both sides
25x + 150 = 40x
2. subtract 25x from both sides
150 = 15 x
3. divide both sides by 15
10 = x
you can check by plugging 10 into the original equations
25(10) + 250
250 + 250 = 500
and
40(10) + 100
400 + 100 = 500
they both cost $500 when you invite 10 people

I really need help for a math assignment can someone help me please thanks.

Answers

The simplified expression is -7-4z/9

Which linear system is Mcq? A : y [ n ] = x [ n ] x x [ n - 1]

B : y [ n ] = x [ n ] + x [ n - 10]

C : y [ n ] = x 2 [ n ]

D : (a) and (c)

Answers

Only, Option B: y [ n ] = x [ n ] + x [ n - 10] forms a linear system.

A linear system is a mathematical model that represents a relationship between input and output using linear equations.

A: y [ n ] = x [ n ] x x [ n - 1]: This is not a linear system because it includes a product of two input signals x[n] and x[n-1], which makes the system non-linear.

B: y [ n ] = x [ n ] + x [ n - 10]: This is a linear system because it includes only one input signal x[n] and one delayed input signal x[n-10], which are added together. It's a linear combination of input signals and it's a linear system.

C: y [ n ] = x 2 [ n ]: This is not a linear system because it includes the square of the input signal x[n] which makes the system non-linear.

D : (a) and (c): Only option B is a linear system.

It's worth noting that linear systems are characterized by the linearity property, which means that the input-output relationship is a linear combination of the inputs.

Therefore, Option B: y [ n ] = x [ n ] + x [ n - 10] forms a linear system.

To know more about linear systems refer to:

brainly.com/question/28977228

#SPJ4

The value of x is 6, what is
the value of y? What is the
scale factor?

Answers

The value of y is 12 and the scale factor is 2.

What is the scale factor?The value of y is dependent on the scale factor. The scale factor is the ratio between two corresponding lengths in two similar figures. For example, if two shapes have a side length of 3 and 6, the scale factor is 2. This means that for every unit increase in the length of one side, the other side increases by a factor of 2.In this case, the value of x is 6, so the scale factor is 6/y. To determine the value of y, we need to divide the number 6 by the scale factor. For example, if the scale factor is 2, then y would be 3. If the scale factor is 4, then y would be 1.5.Once the scale factor is determined, we can use it to calculate the value of y. For example, if the scale factor is 3, then the value of y would be 2. If the scale factor is 5, then the value of y would be 1.2.In conclusion, the value of y is dependent on the scale factor. The value of y can be determined by dividing the number 6 by the scale factor. This can be used to calculate the value of y for any given scale factor.

To learn more about the scale factor refer to:

https://brainly.com/question/25722260

#SPJ1

Other Questions
a satisfactory ecg recording should have ________. the manager of a furniture factory finds that it costs $2600 to manufacture 90 chairs in one day and $4800 to produce 290 chairs in one day. (a) express the cost c (in dollars) as a function of the number of chairs x produced, assuming that it is linear. Warren wanted to save money to purchase a new car. He started by saving $1 on the first of January. On the first of February, he saved $4. On the first of March, he saved $16. So on the first day of each month, he wanted to save four times as much as he did on the first day of the previous month. If Warren continues his savings pattern, how much will he need to save on the first day of October? On a separate sheet of paper, explain how the routeLewis and Clark followed ontheir return trip differed fromthe route they followed asthey set out moving west.Why do you think the twoexplorers split up for part ofthe route? PLEASE HELP!!! URGENT identify the reactants and products of photosynthesis Fell:compassionate ::broken Can a participle phrase function as an adverb? HELP ASAP!!!!! What is the value of the following expression?[6 4 + 50 (12 + 13) + 2] 3 What professional can help you prepare your income tax return? Read Voluntourism: an opportunity too good to be true and The Opportunity of a Lifetime and answer the questions.How are points developed? What is the claim? Is there a counterclaim? If so, what is it? How is it refuted or weakened? What is the effect of the identified devices or appeals? How does this device or appeal help achieve the purpose of the speech or text? What is the authors attitude toward the topic? How does the tone affect the audience? How does the tone help achieve the authors purpose? Which details are emphasized in each medium? What does the different emphasis reveal about the authors position and purpose? What is the effect of the different elements emphasized? a co-worker is to employee as a (n) is to a (n) What are the benefits brought by technology and explain why is it beneficial in the field of healthcare? A computer is performing a binary search on a sorted list of 20 items. What is the maximum number of steps it needs to find the item? the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25 Work out the equation of the line shownbelow.Give your answer in the form y = mx + c,where m and c are integers or fractions intheir simplest forms.Y-160-140--120--100-80-60-40-20--80 -70 -60 -50 -40 -30 -20 -10 0-20--40--60-80--100-120--140---160-10 20 30 40 50 60 70 80 x A 2kg block is attached to a spring for which k=200N/m, it is hold at an extension of 5cm and then released at t=0. Find the displacement as a function of time. The velocity , acceleration and total energy when x=+_ A/2. the lowest prices. the most product options. the fewest product options. superior value for the price.