The objective lenses of the compound light microscope are attached to the

Answers

Answer 1

Answer:

C

Explanation:

its C

Answer 2

Answer:

The objective lenses of the compound light microscope are attached to the rotating nosepiece.

Explanation:


Related Questions

Which of the following would NOT be considered growth and development?

Answers

The statement that would not be considered growth and development is as follows: group of molecules that are attracted together to form a larger sheet.

What is growth and development?

Growth in living organisms refers to the increase in size and number of living cells while development refers to the progressive changes in within an organism.

Growth and development can be exemplified by the following scenarios:

A single cell getting larger before dividingAn egg becoming multiple cellsAn organism going through multiple stages of life

Therefore, this reveals that statement that would not be considered growth and development is as follows: group of molecules that are attracted together to form a larger sheet.

Learn more about growth and development at: https://brainly.com/question/8347621

Ya'll I need serious help give a brotha sum help
What would create more genetic variation: only independent assortment (round 1 and 2) or a combination of crossing over and independent assortment (round 3)?

Answers

Answer:

A combination of crossing over and independent assortment (round 3)

Explanation:

:)

biology The studly of cells is called what​

Answers

Answer:

Cytology is the study of cells as fundamental units of living things.

Question 9 of 10
Which three plates touch the South American plate?

Answers

Answer:

South American plate is bounded by African plate in the east, Nazca plate in the west, Antarctic plate and Scotia plate in the south, and Caribbean plate and North American plate in the north.

Explanation:

How does tsunami occurs? explain its effect

Answers

A tsunami usually occurs after an earthquake. Tsunamis can cause flash floods, destroy building and ships, cause extensive damage to human made objects as well as the environment, and cause death to both humans and animals.

I have many questions for my hw
Here are all the facts:
A girl, lets call her Grace, is wondering which pet she should get. she has owned a betta fish before, and has done a lot of research for hermit crabs. But here are some things she doesn't know:

1. Which one is easier to care for? Betta fish or hermit crab
2. Will a hermit crab be ok in a five 1/2 gallon tank?
3. Is it ok if she just gets one hermit crab or should she get multiple?
4. And ultimately, which one should she get, hermit crab or betta fish?

The last one is the most important. Thanks!

Answers

Answer:

1. Betta Fish

2. Yes. Choose a terrarium that has at least 5 gallons of space per 2 crabs.

3. They require companionship! Hermit crabs, despite their name, are social creatures that thrive best in groups of two or more.

4. Both are entertaining, but I prefer betta. Hermit crabs, in my experience, are extremely sensitive and difficult to keep alive. Hermit crabs proved to be much more difficult than I anticipated, but bettas are a little more straightforward. That is just my opinion; I am sure you will do fantastic with whatever you choose.

I hope this helps you

:)

Penelope is adding fractions while taking a math test. What part of her brain is at work?
spinal cord
cerebrum
cerebellum
hypothalamus

Answers

Answer:

Cerebrum

Explanation:

The cerebrum is the part of the brain that includes the hippocampus, which is responsible for solving math problems.

Answer:

cerebrum

Explanation:

edge 2022

Which one of the following is the softest?

(A) Aluminium

(B) Iron

(C) Lithium

(D) Sodium

Answers

Answer:

Sodium

Explanation:

Sodium is the softest and 2nd most reactive element/metal after potassium.Represented as Natrum(Na)You can cut this with regular knifes even .

Which behavior is a response that is determined by heredity?
O fighting for protection
O All behaviors are determined by heredity.
O hunting in packs
O sleeping

Answers

Which behavior is a response that is determined by heredity?

Answer:

D. Sleeping

D.) sleeping

Behavioral responses such as sleep has been found to be hereditary or affected by your genes.

[tex]#Keeplearning [/tex]

A crossover in meiosis is an exchange of genetic material between

A) sister chromatids of the same chromosome.
B) sister chromatids of homologous chromosomes.
C) sister chromatids of non-homologous chromosomes.
D) non-sister chromatids of homologous chromosomes.
E) non-sister chromatids of non-homologous chromosomes.

2.

A tetrad is made up of

A) four non-homologous chromosomes.
B) four non-homologous chromatids.
C) four homologous pairs of chromosomes.
D) two homologous pairs of chromosomes.
E) two homologous chromosomes, each consisting of two chromatids.

3.

Which of the following statements about crossing over is TRUE?

A) It occurs only in males.
B) It occurs only in some chromosomes.
C) It occurs only between genes that are heterozygous.
D) It results in reduced genetic variation among gametes.
E) None of the above

4.

Crossing-over occurs during prophase I of meiosis.

A) True
B) False

5.

Crossing-over allows the reassortment of linked genes.

A) True
B) False

Answers

A crossover in meiosis is an exchange of genetic material between

A) sister chromatids of the same chromosome.

B) sister chromatids of homologous chromosomes.

C) sister chromatids of non-homologous chromosomes.

D) non-sister chromatids of homologous chromosomes.

E) non-sister chromatids of non-homologous chromosomes. ✓

During meiosis, the two chromosomes in each parent,swipe their place resulting in a hybrid new genetic material

2.A tetrad is made up of

A) four non-homologous chromosomes.

B) four non-homologous chromatids.

C) four homologous pairs of chromosomes.

D) two homologous pairs of chromosomes.

E) two homologous chromosomes, each consisting of two chromatids.

Tetrad is a group of four chromatids formed in pachytene stage of meiosis

3. Which of the following statements about crossing over is TRUE?

A) It occurs only in males.

B) It occurs only in some chromosomes.

C) It occurs only between genes that are heterozygous.

D) It results in reduced genetic variation among gametes.

E) None of the above

The process of crossing over takes place between homologous chromosomes to increase genetic diversity

4.Crossing-over occurs during prophase I of meiosis.

A) True ✓

B) False

crossing over helps in genetic variation and occurrs between prophase 1 & metaphase 1

5. Crossing-over allows the reassortment of linked genes.

A) True

B) False

Crossing over helps in the reassortment of non-sister chromatids of non-homologous chromosomes
A crossover in meiosis is an exchange of genetic material between non-sister chromatids of homologous chromosomes. Thus, the correct option for this question is D. A tetrad is made up of two homologous chromosomes, each consisting of two chromatids. Thus, the correct option for this question is E. The statement which is true about crossing over is none of the above. This is because the process of crossing over occurs between homologous chromosomes. Thus, the correct option for this question is E. The statement "the process of crossing over occurs during prophase I of meiosis" is definitely true. The statement "Crossing-over allows the reassortment of linked genes" is definitely true.

What is Crossing over?

Crossing over may be defined as the process through which the exchange of genetic material between homologous chromosomes takes place that results in the mixture of parental characteristics in the offspring.

According to the context of this question, the process of crossing over takes place during the Pachytene stage of meiosis which significantly involves the reassortment of linked genes.

Therefore, each of the given questions is well answered above.

To learn more about Crossing over, refer to the link:

https://brainly.com/question/927405

#SPJ2

Name the chemical that helps in providing the ideal pH for pancreatic amylase to function in the human body.*​

Answers

Answer:

What is the chemical that helps in providing the ideal PH for pancreatic amylase to function in the human body?

Explanation:

This allows the protein lipase to break down and digest the fat in the small intestine much more quickly. The pancreas secretes bicarbonate to neutralize the acidity of chyme and pancreatic amylase to aid in the digestion of carbohydrates.

HELP!!!
[BWS.05]Where would positively charged particles be most likely found in an atom?
O around the electrons
O inside the electrons
O inside the nucleus
O outside the nucleus

Answers

Answer:

inside the nucleus

Explanation:

protons and nuetrons are in the nucleus, electrons are the ones that orbit a nucleus

An ecosystem is a community of living organisms and the nonliving components of the environment Energy flows in an ecosystem in one direction through food chains, and a food web is made up of all the food chains within a community of organisms. Biodiversity refers to the variation in species found within an ecosystem, and it is measured in two ways: (1)
species richness, which is the total number of different species in an ecosystem; and (2) relative abundance, which is a measure of how common each species is within the ecosystem
Imagine that carnivore D represents the sea lamprey in the Great Lakes ecosystem. This invasive species has been present there
since the 1800's yet the ecosystem has remained stable. How can you explain this?
A) The sea lampreys are indigenous to salt water and have a very short life
span
B) There are complex feeding mechanisms at work to protect the other
species in the food web.
C) The sea lampreys only feed on one type of fish so they have only depleted
that single population.
D) Marine scientists have developed a method to effectively remove the
Lampreys from the Great Lakes.

Answers

Answer:

B

Explanation:

there are complex feeding mechanisms at work to protect the other species in the food web

How many miles away is the moon from earth?

Answers

The moon is 238,900 miles away from earth

A divergent boundary at two oceanic plates can result in a
-mid-ocean ridge
-volcanic island arc
-continental volcanic arc
-subduction zone

Answers

The answer is -volcanic island arc.

Effects that are found at a divergent boundary between oceanic plates include: a submarine mountain range such as the Mid-Atlantic Ridge; volcanic activity in the form of fissure eruptions; shallow earthquake activity; creation of new seafloor and a widening ocean basin.

Which of the following can cause damage to blood vessels if not treated?
hypertension
smoking
obesity
genetics

Answers

Answer:

hypertension

Explanation:

because high blood

Answer:

hypertension

Explanation:

High blood pressure is a major risk factor for cardiovascular disease.

What is the mRNA that would be transcribed from this strand of DNA?

Answers

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

Which structures are most similar in birds and mammals based on their functions?

air sacs in birds and rib cages in mammals
air sacs in birds and mammary glands in mammals
gizzards in birds and teeth in mammals
crops in birds and teeth in mammals

Answers

Answer:

C: gizzards in birds and teeth in mammals

Explanation:

1. A crossover without sister chromatid cohesion can facilitate chromosome segregation.

a. True
b. False

2. There are more noncrossovers than crossovers during meiosis.
a. True
b. False

3. True/False Crossovers exchange large portions of chromosomes but noncrossovers exchange small segments.
a. True
b. False

Answers

Answer: 1b 2a 3a

Explanation: Mark me as brainiest!

If the side of a cubical cell doubled, what would the cell then require? Select all the correct answers.

A. eight times more nutrients
B. to excrete eight times more waste
C. four times more nutrients
D. to excrete four times more waste

Answers

Given what we know, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.

Why would the cell require more nutrients?

This has to do with the ratio between surface area and volume. Since volume is squared when calculating it, the volume of a cell increases much more rapidly than that of its surface area. So a cell that doubles in size would quadruple in volume, needed four times as many nutrients to maintain its internal processes.

Therefore, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.

To learn more about cells visit:

https://brainly.com/question/5763151?referrer=searchResults

hich of the following have questions that cannot have a definite answer?

a.
Art

b.
Science

c.
Religion

d.
Philosophy

e.
B and A

f.
C and B

g.
A, C, D

h.
B, D, A

Answers

I guess H would be the answer however I don’t understand how this is formatted, so art, science and philosophy all don’t have definite answers, religion does.

True or False? A forest of conifers holds more living matter than tropical rainforests.

A. True

B. False

Answers

Answer:

true

Explanation:

The statement "a forest of conifers holds more living matter than tropical rainforests" is definitely true.

How do coniferous forests differ from tropical rainforests?

Tropical Rainforests undergrowth is evenly distributed. Not much plant growth as very little sunlight passes through the canopy and reaches the forest floor, But coniferous has little undergrowth due to the low amount of sunlight received and the low soil nutrient.

The tropical rainforests have higher and large heights of trees and other vegetation. Due to this, other living matter must definitely be inhibited due to the absence of sunlight.

While in conifers, the height of trees and other vegetation is shortly limited, due to which other living matter also receive a high amount o sunlight. As a result of this, they grow and reproduce successfully.

To learn more about Tropical rainforests, refer to the link:

https://brainly.com/question/1146251

#SPJ2

Which of the following describes a step in recycling raw materials to make the same or new items?

I. Use a directory to learn how to recycle a material.
II. Use refillable water bottles.
III. Use up a product completely.

I only
II and III
I and III
I, II, and III

Answers

Answer:

I only --- Use a directory to learn how to recycle

Explanation:

Number II and III do not help in recycling raw materials to make same or new (just took test got it right)

Using a directory to learn how to recycle a material is the step in recycling raw materials to make the same or new items. The correct option is A.

What is recycling?

Recycling is the process of converting waste materials in to other unique raw materials for the production of innovative products.

A material with high recyclability is one that can be easily recycled, which also means that its material properties need not depreciate significantly compared to those of simple material.

Recycling consists of three steps namely collecting recyclable materials, transforming recycled materials into new products, and selling and purchasing products containing recycled material.

The step in recycling raw materials to make the same or new items is to use a directory to learn how to recycle a material.

Thus, the correct option is A.

For more details regarding recycling, visit:

https://brainly.com/question/11861824

#SPJ5

when did dinos die? when tell me please​

Answers

Answer:

65 Million years ago

Explanation:

I looked it up

Answer:

65 million years ago during the Jurassic and Triassic eras, a giant meteor struck what would be earth, and we had to start all over again. Here we are 65 million years later.

I hope this helps! Have a wonderful day.

The gravitational force exertedThe gravitational force exerted by an object depends on its by an object depends on its

Answers

Answer: The force of gravity depends directly upon the masses of the two objects, and inversely on the square of the distance between them. This means that the force of gravity increases with mass, but decreases with increasing distance between objects.

Explanation:

Answer:

Explanation:

The pressure that a particular object exerts on the floor depends on the gravitational force, F, and the area of its base, according to the equation.

Pressure =Fπr2

What is the shape of the area of the base of the object?

Responses

Which of the following would not be found in blood serum? (2 points)

Antibodies
Platelets
Nutrients
Wastes

Answers

Answer: The answer is (B) Platelets. You wouldn't find Platelets in blood serum.

Explanation:

Which part of the plant carries water and food to and from the leaves? veins leaf blade petiole chloroplast

Answers

Veins is the part of the plant that carries water and food to and from the leaves.

Which part carries water in the plant?

The xylem distributes water and minerals through the plant i.e. from the roots to the leaves through their vein network while on the other hand, phloem carries food from the leaves to the roots.

So we can conclude that Veins is the part of the plant that carries water and food to and from the leaves.

Learn more about water here: https://brainly.com/question/1313076#

Answer: The veins.

Explanation:

Which environmental change would most likely result in bullfrog offspring that are able to store more water than bullfrogs in previous generations?
A.
a dry season that lasts for a month
B.
flooding that turns the valley into a lake
C.
a drought that lasts for a very long time
D.
a rainy season that lasts for a month

Answers

Answer:

C.

a drought that lasts for a very long time

Answer these three questions to summarize what you have done in this project.

1. How did you model mutations in this project?

2. How are the three mutated strands similar to each other? (Hint: Think about the type of mutations modeled.)

3. How are the three mutated strands different from each other?

Answers

A mutation means an alteration in the nucleotide sequence of the genome of an organism.

What is mutation?

Your information is incomplete. Therefore, an overview will be given. A mutation is a change in a DNA sequence.

Mutations can be from DNA copying mistakes that are made during cell division, the exposure to ionizing radiation, and exposure to chemicals called mutagens.

There are three types of DNA mutations which are base substitutions, deletions, and insertions.

Learn more about mutations on:

https://brainly.com/question/17031191

Mill proposes that "higher" pleasures are those preferred by the majority of people. Do you agree that this is a good way of distinguishing between higher and lower pleasures? Can a well-informed majority prefer higher pleasures?​

Answers

Higher pleasure is a pleasure that would be chose by a greater number in the population.

What is higher pleasure?

The term higher pleasure is a pleasure that would be chose by a greater number in the population even when it involves some level of discomfort. This opposed to the lower pleasures which could be traded for the higher pleasures.

I agree with Mill's proposal regarding higher pleasures. For instance people will always prioritize the pleasure of learning things which is a higher pleasure to other pleasures.

What is higher pleasure: https://brainly.com/question/22406307

Other Questions
WILL RECEIVE BRAINLIESTMr. Campbell has a square garden with an area of 256 square feet. He wants to put a fence along 3 sides of the garden. How may feet of fencing will he need? Help!?!?!?! Brady had 12 cupcakes, if he wanted 4 cupcakes piled in each group, how many groups were there?? what is solar installation SOMEONE HELP ME URGENTLY!! I dont really understand what this means . can yall help me please HELP PLEASE HELP PLEASEEEEE!!!!!!! Pls help with times tables if u click there will be a picture Question 1Determine which pairs of polygons are similar. im confused can someone help me Which of these sentences contains an adverbial clause?A. He told me where I could get some coffee.B.What she pointed out is very significant in these times.C. I do not know how to invest my money.D.Most animals thrive where they can find food easily. A form of agriculture devoted to raising large numbers of cattle or sheep for sale to meat processors is: Tim is late for the class meeting.- Tim: Sorry, I'm late, Peter.- Peter: ___________A. Thanks a lot. B. Same to you C. Never mind. D. Good idea. The process of evaporation, condensation, and precipitation is called _____.A.turgorB.osmosisC.active transportD.the water cycle Can u explain this 4 me? Discuss the population distribution of Nepal by development regions from census 2011. Why is it usually a good economic decision to purchase home insurance even if you don't have a mortgage? A. Because the deductible is close to matching the cost of a potential claim B. Because the likelihood of making an insurance claim is very low C. Because the coverage is more valuable than the cost of the premium D. Because the cost of the premium is less than one's salary What problems do you think developed with such crowded towns? Haley and Sabrina are both training for a race.Haley runs 4.2 miles each day.Sabrina has been running as many miles each day as Haley.Next week, Sabrina is going to increase the miles she runs each day by 25%.Haley and Sabrina both train by running 6 days each week.What is the total number of miles Sabrina will run next week to train for the race? A. 5 B. 18.3 C. 21 D. 47.25 Jada flew home from vacation with a heavy bag. With the first airline she flew, jada had to pay $29 to check her bag, plus $4 for every pound that her bag was over the weight limit. The next flight was with another airline that had the same weight limit. Jada had to pay $11 per pound that her bag was over the weight limit, in addition to the checked bad fee of $15. By coincidence, the fees ended up being the same with both airlines. How far over weight limit was the bag? How large was each airlines fee? How did President Franklin D. Roosevelt respond to these developments?A He proposed expanding the court and adding justices that supported his policies.B He attempted to impeach the chief justice to open the position for a liberal justice.C He attempted to dissolve the court to eliminate a major obstacle to his policies.D He proposed a constitutional amendment to abolish the practice of judicial review.