The population of a slowly growing bacterial colony after t hours is given by
p(t) = 4t² + 27t + 150. Find the growth rate after 2 hours.
bacteria/hour
Submit Question

Answers

Answer 1

A function is an expression that defines a relationship between an independent variable and a dependent variable.

The number of bacteria colonies after 2 hours is 220.

What is a function?

It is an expression that defines a relationship between an independent variable and a dependent variable.

We have,

P(t) = 4t² + 27t + 150

Where t = time

P(t) = population of a slowly growing bacteria colony after a particular time

The growth rate after 2 hours:

P(2) = 4 x (2)² + 27 x 2 + 150

P (2) = 16 + 54 + 150

P (2) = 220

Thus the number of bacteria colonies after 2 hours is 220.

Learn more about functions here:

https://brainly.com/question/17440903

#SPJ5


Related Questions

What is another way to write 54?


5×5×5×5

4+4+4+4+4

4×4×4×4×4

5+5+5+5
IT CANT BE NONE OF THE ABOVE

Answers

Answer: 5^2.48 is honestly as close as you can get.

I’m assuming you mean 5^4

So 5x5x5x5

Hope this helps

Examine the figure. What is the measure of angle a?

Answers

A = 180-90-31

A = 59

Answer: 59

Xavier has 29 baseball
cards he'd like to share
with his 3 best friends.
Each friend gets an equal
number of cards. How
many baseball cards will
be left over?
Math

Answers

Answer:

2

Step-by-step explanation:

29 % 3 = 9

3x9 = 27

29 - 27 = 2

The normal price of a television is reduced by 30% in a sale. The sale price of the television is £350 Work out the normal price of the television?​

Answers

Answer:

$245

Step-by-step explanation:

0.7 * 350 = 245

The normal price of the television, if The normal price of a television is reduced by 30% in a sale, The sale price of the television is £350, is £500.

What is the sale price?

The price at which something sells or is purchased following a price reduction. The cost that something is sold for. In other words, the price at which something is sold to a customer is called the sale price

Given:

The normal price of a television is reduced by 30% in a sale,

The sale price of the television is £350,

Write the equation of the above statement as shown below,

Normal price - 30% of normal price = Sale price

Substitute the value,

Normal price(1 - 0.30) = £350  

Normal price = 350 / 0.7

Normal price = £500

To know more about the sale price:

https://brainly.com/question/28932962

#SPJ2

In an A.P. if Tₚ = q and Tq = p, then find the rth term.
Please solve this problem​

Answers

Formula:

We know that

nth term of the AP is Tn = a+(n-1)d

Where, a = First term

d = Common difference

n = number of terms

Now,

Given that

pth term of the A.P. = Tp = q

⇛a + (p-1)d = q

⇛(p-1)d = q - a

⇛d = (q-a)/(p-1) →→→→(i)

and

qth term of the A.P. = Tq = p

⇛a + (q-1) d = p

⇛ (q-1)d = p-a

⇛ d = (p-a)/(q-1) →→→→(ii)

From Eqn(i) and Eqn(ii)

⇛(q-a)/(p-1) = (p-a)/(q-1)

On applying cross multiplication then

⇛(q-a)×(q-1) = (p-a)×(p-1)

⇛q²-q-aq+a = p²-p-ap+a

⇛q²-q-aq = p²-p-ap

⇛ap-aq = p²-p+q-q²

⇛a(p-q) = (p²-q²)-(p-q)

⇛a(p-q) = (p+q)(p-q)-(p-q)

⇛ a(p-q) = (p-q){(p+q)-1}

On cancelling (p-q) both sides then

⇛a = (p+q-1) →→→→Eqn(iii)

On Substituting the value of a in Eqn(ii) then

⇛ d = [p-(p+q-1)]/(q-1)

⇛d = (p-p-q+1)/(q-1)

⇛d = (-q+1)/(q-1)

⇛d = -(q-1)/(q-1)

⇛d = -1

We have,

a = p+q-1 and d = -1

Now, rth term of the AP

⇛ Tr = a + (r-1)d

⇛Tr = (p+q-1)+(r-1)(-1)

⇛ Tr = p+q-1+(-r+1)

⇛ Tr = p+q-1-r+1

⇛ Tr = p+q-r

Therefore, Tr = p+q-r

Answer: rth term of the given A.P. is p+q-r

Answer:

rth=q+p+qxp

Step-by-step explanation:

rth= 3 of the T and Tq added together and joined.

Help help math math math

Answers

Answer:

-3) -23

0) -8

3) 7

6) 22

Step-by-step explanation:

Plug in the x value for each function and solve for y

Answer:

-3) -23

0) -8

3) 7

6) 22

Step-by-step explanation:

if x+1/x=7,find x^2+1/x^2​

Answers

Answer:

x²+1/x² = 51

Explanation:

Given x - 1/x = 7 ---(1)

We know the algebraic identity:

a²+b²-2ab = (a-b)²

Or

a²+b² = (a-b)²+2ab

Now,

x²+1/x²

= (x-1/x)²+2*x*(1/x)

= (x-1/x)²+2

:7²+2 [ from (1)] =

= 49+2

= 51

Therefore,

x²+1/x² = 51

39 round to the nearest hundred

Answers

As it says nearest to hundred it will be 0-100 and the closest one is the answer, in this case the number is 39 which means it’s closer to 0,so the answer is 0

Subtract 8−2x from 3−6x . Enter your answer by filling in the boxes. $$

Answers

Answer:

-4x-5

Step-by-step explanation:

(3-6x)-(8-2x) = 3-8+2x-6x = -4x - 5

If f(x) is an exponential function where f(4.5) = 16 and f(9.5) = 60, then find
the value of f(15), to the nearest hundredth.

Answers

The value of f(15), to the nearest hundredth is 253.88

The standard exponential equation is given as:

y = ab^xf(x) = ab^x

If f(4.5) = 16, then;

16 = ab^4.5 ..............1

Similarly, if f(9.5) = 60, then:

60 = ab^9.5 ........................... 2

Dividing both equations will give:

60/16 = ab^9.5/ab^4.5

60/16 = b^9.5-4.5

60/16 = b^5

3.75 = b^5

b = 1.3

Get the value of a. Recall that;

60 = ab^9.5

60 = a(1.3)^9.5

60 = 12.09a

a = 60/12.09

a = 4.96

Get the value of f(15)

f()15 = 4.96(1.3)^15

f(15) = 4.96(51.18)

f(15) = 253.88

Hence the value of f(15), to the nearest hundredth is 253.88

Learn more on exponential functions here: https://brainly.com/question/12940982

Measure the paper clip to the nearest 1/8 inch.

A. 1 2/8 inches

B. 1 1/2 inches

C. 1 4/8 inches

D. 1 3/8 inches

Answers

Answer:

1 3/8   D

Step-by-step explanation:

The first and most obvious part of the answer is that the paper clip is at least 1 inch long. The question is how much longer?

It is between 1/4 of an inch and 1/2 of an inch. In fact it is exactly half way between them.

So that resembles an average.

(1/4 + 1/2)/2 = (1/4 + 2/4) / 2 = (3/4)/2

[tex]\frac{\frac{3}{4} }{2} = \frac{\frac{3}{4} }{\frac{2}{1} }[/tex]

Now the trick is to invert the denominator (make it 1/2) and multiply

3/4 * 1/2 = 3/8

Does anyone know how to solve this?

Answers

I don’t now but good luck

How do you balance a firm’s need to succeed and the need for not asking the workers for perfection?

Answers

The way to balance a firm's need to succeed and the need for not asking the workers for perfection is through the offering of training to workers, which allows them to notably improve their performances autonomously, without this being directly instigated by the company's directory.

That is, through the education of workers in the different areas of their jobs, the level of the same will be improved and better results will be obtained.

Learn more about perfectionism in https://brainly.com/question/7277328

Elton has 2 jobs and can work at most 32 total hours per week. He makes $9.00 per hour as a dog walker and $10.00 per hour as a store clerk. He wants to earn a minimum of $200 per week. Which is system of inequalities can be solved to find the possible combination of hours worked at each job that will help him to reach his goal?

Answers

Answer:

3-4 days

Step-by-step explanation:

So, if Elton works at each job for 5 hours, he will get $95. He would keep on doing this for 2-3 days. He would get $190 in total. The next day, he could get his $10 for being a store clerk. 190 + 10 = 200. And that's how Elton would make $200 in less than one week!

B+8/2=6
How do I do this

Answers

divide 8/2 which is 4 so B+4=6 subtract 4 from both sides so b+4-4=6-4

so that means B=2 and that is ur answer

Answer:

B = 2.

Step-by-step explanation:

First work out 8/2. Okay so how many 2's go into 8? 4.

We now have B + 4 = 6.

Now that we've simplified it a bit we can do a reverse equation and turn it into subtraction.

Take the answer (6) and 4 and put them into a subtraction equation,

6 - 4. And simple subtraction should be easy so 6 - 4 = 2.

So B equals 2. Let's check it! 2 + 4 = 6. I think that sounds right so that will be the answer. B=2.

Hope that helps. x

5x²-11x +6 . factories the expression

Answers

Answer:

5

x

2

11

(

x

)

+

6

Step-by-step explanation:

[tex]5x^2-11x+6\\\\=5x^2-5x-6x+6\\\\=5x(x-1) - 6(x-1)\\\\=(x-1)(5x-6)[/tex]

Suppose there is a game where there are 5 identical boxes to choose from. One of these boxes has a
prize. Each time the game is played, the prize is randomly placed in one of the 5 boxes. If someone
were to play this game 4 times in a row, what is the probability this person will win the prize exactly 2
times?

Answers

Answer:

0.1536

Step-by-step explanation:

This is a binomial probability distribution with 2 successes in 4 trials.

The chance of a success is 1/5 =  0.2.

So there needs to be 2 successes and 2 failures in the 4 plays.

Reqd. Probability is 4C2*(0.2)^2(0.8)^2

= 0.1536.

Find area of the region under the curve y=9−3x^2 and above the x-axis.

Answers

Answer:

A = 12√3

Step-by-step explanation:

first find the limits by finding the zeros

0 = 9 − 3x²

3x² = 9

x² = 3

x = ±[tex]\sqrt{3}[/tex]

[tex]A = \int\limits^a_b ({9 - 3x^2\\}) - 0\, dx[/tex]

where b = [tex]-\sqrt{3}[/tex] and a = [tex]\sqrt{3\\}[/tex]

A = 9x - x³ [tex]\left \{ {{\sqrt{3} } \atop {-\sqrt{3} }} \right.[/tex]

[tex]A = 9\sqrt{3} - \sqrt{3} ^3 - (9(-\sqrt{3)} - (-\sqrt{3} )^3)[/tex]

[tex]A = 9\sqrt{3} -3\sqrt{3} +9\sqrt{3} - 3\sqrt{3}[/tex]

[tex]A = 12\sqrt{3}[/tex]

1: Solve and Graph: 5-3(x - 1)> 2
2: Solve and Graph: 2x - 3> 7 or x+5<2
3: Solve for x: |1x-5|=13

Answers

Answer:

3) x=18 , -8

Step-by-step explanation:

hi

hope it helps you


Help help math I need to pass please

Answers

Answer:

63 degrees

Step-by-step explanation:

The hint tells you that you can add the other 2 angles in the triangle to get the answer.

Consider the triangle below.
M
(15x + 5)º
--
(3x + 2)
(5x - 11)
N
Determine the measure of angle P.
Р
mZP
degrees

Answers

The measure of angle P is 29 degrees

The sum of an interior angle of a triangle is 180 degrees. Given the following parameters:

m<M = 15x + 5m<N = 3x + 2m<P = 5x - 11

Taking the sum and equating to 180 degrees:

m<M + m<N + m<P = 180 degrees

15x + 5 + 3x + 2 + 5x - 11 = 180

23x - 4 = 180

23x = 184

x = 184/23

x = 8

Get the measure of m<P

m<P = 5x - 11

m<P = 5(8) - 11

m<P = 40 - 11

m<P = 29 degrees

Hence the measure of angle P is 29 degrees

Learn more on angles here: https://brainly.com/question/25770607

A contractor decides that he can build a house in eight weeks using 5 men. If he employs 3 more men, how long will the job take? Assume that all the men work at the same rate. ​

Answers

The answer is 5 weeks

How does (x^3)^3 = x^6 ?

Answers

Answer:

It does not, unless [tex]x=0[/tex] or [tex]x=1[/tex]

If you remember how to raise a power to a given power you remember to multiply the exponents (or, if you don't, apply the definition of [tex](x^3)^3=(x^3)(x^3)(x^3)=x^9[/tex]

At this point you're being asked if [tex]x^9=x^6[/tex] and the only two numbers for which this is true are 0 and 1 (side note: if the left hand side was an even function also [tex]-1[/tex] was a possible candidate, but alas 9 is odd).

Please write in full sentences.
Brainliest and 100 points.
If you don't know then don't answer.

Answers

Answer:

no because there is a 10 which make it not proportional

Step-by-step explanation:

hope that helps.

Answer: No they are not proportional because the last row has -10 which obstructs the whole relationship.

An urn contains three red balls and four blue balls. Draw two balls at random from the urn, without replacement. Compute the expected number of red balls in your sample. (Round your answer to four decimal places.)

Answers

Step-by-step explanation:

in total we have 3+4 = 7 balls.

when we draw the first ball, the probability to draw a red ball is 3/7, and a blue ball 4/7.

when we draw the second ball, we have now only 6 balls in total.

the probabilty to draw a red back now depends also on the result of the first draw.

if the first ball was already red, then we have only a chance now of 2 out of 6.

if the first ball was blue, then we have now a chance of 3 out of 6.

so, the probably to draw at least 1 red ball in 2 draws is the probability of drawing one on the first draw plus the probability of drawing one on the second :

1 - probability to see 2 blue balls

1 - 4/7 × 3/6 = 1 - 12/42 = 30/42 = 0.714285714...

the expected number of red balls in 2 draws is

1 red in first red in first red in second

but not second and second but not first

1×(3/7 × 4/6) + 2×(3/7 × 2/6) + 1×(4/7 × 3/6) = 12/42 + 12/42 + 12/42 = 36/42 = 6/7 = 0.857142857 ≈ 0.8571

Devaughn is 15 years younger than sydney. the sun of their ages is 63. what is sydney’s age?

Answers

Answer:

39

Step-by-step explanation:

d = s - 15

d + s = 63

Replace d with s - 15

s - 15 + s = 63

2s -15 = 63

2s = 78

s = 39

what is the value of x

Answers

Answer:

I Know the answer but it has too many steps-by-step explanation so I cant tell comment and mark me brainliest.

Step-by-step explanation:

Mr. Hare left at 8:00 a.m. and is traveling 40 miles per hour. Mrs. Hare left at 9:00 a.m. and is traveling at 50 miles per hour. If Mr. and Mrs. Hare are traveling the same direction, what time will it be when Mrs. Hare is at the same location as Mr. Hare?

A. 11:00 a.m.
B. 1:00 p.m.
C. 2:00 p.m.
D. 3:00 p.m.

Answers

Answer:

The answer is b

Step-by-step explanation:

During the 8-9 , Mr hare travel 40miles

For the time 9 onwards they travel concurrently,

Let x be the distance covered by both since they can only meet if they covered the sams distance,

x/50 = x/40 -1 ,where the 1 is the (8-9) 1 hr

x/40 - x/50 = 1

x = 200

Time take by Mr Hare = 200/ 40 = 5

from 8 add 5 hours will be 1

Note, i took this answer from an answer from another answer.

Equation for 13 divided by 4 equals 3.25

Answers

Answer: 13 ÷ 4 = 3.25 or [tex]\frac{13}{4} = 3.25[/tex] (Both means the same thing but you can pick which equation you want0

Step-by-step explanation: Hope this helps! :D

Solve the equation for​ z, where z is restricted to the given interval.

[tex]y=7sinz[/tex], for z in [tex][-\frac{\pi }{2}, \frac{\pi }{2} ][/tex]

Answers

[tex]y = 7sin(z)\implies 0 = 7sin(z)\implies 0=sin(z)\implies sin^{-1}(0)=sin^{-1}[sin(z)] \\\\\\ sin^{-1}(0)=z\implies 0=z[/tex]

Other Questions
A, who travels 4 miles an hour starts from a certain place 2 hours in advance of B, who travels 5miles an hour in the same direction. How many hours must B travel to overtake A? You can change the ____ or position of text within a document's margins. a. fielding b. proportion c. location d. alignment sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a sport 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ