What adaptation do seeds dispersed through ballistochory have?
a)

sail-like structure

b)

smooth and aerodynamic

c)

hollow on the inside

d)

pleasant smell and taste

Answers

Answer 1

Answer:

smooth and aerodynamic

Explanation:

Seeds are usually smooth, like a baseball, so that they cut smoothly through the air and don't have a lot of wind resistance.

Answer 2

The adaptation that seeds dispersed through ballistochory has smooth and aerodynamic. The correct option is b.

What are adaptations?

Adaptation is a biological process that is done by many plants and animals to survive in given conditions. Adaptation is causing the partial or full change in their body or functions to match with the environmental conditions.

Plants with ballistochory means possibly ejects by the seeds full stop this adaptation or evolution happened in which seats are dispersed into many tentacles and seats are dispersed into soils for pollination this comes under wind dispersion.

Seeds launch an angle and release the elastic energy store in the fruit. These adaptations are smooth.

Therefore, the correct option is b. smooth and aerodynamic

To learn more about ballistochory, refer to the below link:

https://brainly.com/question/24148239

#SPJ2


Related Questions

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

Which of the following are all examples of pollution
Pesticide Run-off
Desertification
Global Warming
Poaching
Burning of Fossil Fuels

Answers

Burning fossil fuels

• How the knowledge of classification be applied to assess the characteristics of different organisms when visit to zoo, herbaria or gardens.(Students may do research on internet to answer this question )
plz correct answer
be quick

Answers

Answer:

Compare two organism on the physical features and mode of nutrition.

Explanation:

Organisms are classified in groups and sub-groups on the basis of similarities and differences. so in order to compare two organisms, start with the similarities that are present between them. If similarities are more so they belong to the same group or if differences are more than both are placed in different groups. for classification, see the physical appearance of organism, mode of nutrition and habitat etc. If organisms are identical, they belong to the same species, if one or two characters are different so their genus will be same but specie is different. In zoo animals are different from the animals which is present in garden so compare the physical features of zoo and garden animals.

The following specimens/slides were shown to the students: mushroom, moss, earthworm, volvox, bacteria. The teacher asked them to classify them into the five kingdoms.

Answers

Answer:

Mushroom-Kingdom Fungi

Moss-Kingdom Plantae

Earthworm-Kingdom Animalia

Volvox-Kingdom Protista

Bacteria-Kingdom Monera

Explanation:

The classification of the organisms into five kingdoms is as follows:

Mushroom- Kingdom FungiMoss- Kingdom PlantaeEarthworm- Kingdom AnimaliaVolvox- Kingdom ProtistaBacteria- Kingdom MoneraWhat is classification?

Classification is distributing the organisms into different groups according to their similar characteristics. The five kingdom classification is the approved form of classification today.

The five kingdoms are Monera, Protista, Fungi, Plantae, and Animalia, and the organisms are distributed in these kingdoms.

Thus, the classification is following:

Mushroom- Kingdom FungiMoss- Kingdom PlantaeEarthworm- Kingdom AnimaliaVolvox- Kingdom ProtistaBacteria- Kingdom Monera

Learn more about classification, here:

https://brainly.com/question/14489978

#SPJ2

What is the role of Langerhans cells? prevent pathogens from entering the body using antibacterial agents destroy pathogens that enter the body using white blood cells identify pathogens that enter the body and carry them to lymph nodes for destruction

Answers

The role of Langerhans cells is that they prevent pathogens from entering the body using antibacterial agents.

What are Langerhans cells?

Langerhans cell is a dendritic cell of the skin and mucosa, containing Birbeck granules, and present in all layers of the epidermis but most prominent in the stratum spinosum.

Langerhans cells play important roles in the immune system by acting as the outermost guard of the cutaneous immune system where they induce the first reactions against pathogens encountered via the skin.

Therefore, the role of Langerhans cells is that they prevent pathogens from entering the body using antibacterial agents.

Learn more about Langerhans cells at: https://brainly.com/question/15660598

#SPJ2

Answer: 3.identify pathogens that enter the body and carry them to lymph nodes for destruction

Explanation:

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

Help!!!
I'll give brainliest the brainliest. ​

Answers

Answer:

resists the turgor  pressure of the cell:  A : cell wall

controls the activities of  the cell : C : nucleus

site of the chemical  reactions of the cell  including synthesis of  proteins:  D : cytoplasm

Answer:

1. A -  Cell Wall

2. C - Nucleus

3. B. Mitochondria

Give brainliest

What can you learn about by studying DNA?

Answers

Answer:

Explanation:

                  The study of human DNA and genetics can be intellectually fascinating, but it also has plenty of practical applications. From the use of DNA in court cases to the discovery of new therapies for genetic diseases, a thorough understanding of the human genome can have important medical, social and legal impacts.

john is testing the effect of temperature on the solubility of sugar in water

Answers

Answer:

As John is testing the effect of temperature on the solubility of sugar in water. To test this, he will measure the amount of sugar dissolved at different temperature level.

what is a warning safety sign​

Answers

Answer:

Hey there!

A warning safety sign is a sign that warns you that there may be a safety hazard around you.

Let me know if this helps :)

A molecule will become an ion when which of the following happens?

Answers

Loses or gains a charge

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Plz help me ASAP TwT

Answers

Answer:

Response

Explanation:

It is response because your pupils are responding to the light flashing in your eyes and therefore they get smaller.

Hope this helps :)

Answer:

Response

Explanation:

We can use process of elimination. Reproduction does not fit in this context--nothing is reproducing. Nothing is growing, either. Development usually refers to when an organism develops, which doesn't fit this context either. Response is the only one that fits--your pupils are responding to the sudden light.

how does quartz watch give time?​

Answers

quartz gives time by, oscillator in which vibrates quickly and precise frequency In around 32,768 times-second in response to the electronic charge.

Which of the following is NOT an organ system in the human body?
A. Endocrine system
B. Replicatory system
C. Digestive system
D. Lymphatic system

Answers

B. The replicatory system is not a organ sytem in the human body.

Superficial similarities in structures that have the same function can seem like they are evidence of a common ancestor, but they are not. An example of this is the convergent evolution of wings in insects as well as in birds. What are these types of structures called

Answers

Answer:

Distinguishing between Similar Traits

Similar traits can be either homologous structures that share an embryonic origin or analogous structures that share a function.

LEARNING OBJECTIVES

Explain the difference between homologous and analogous structures

KEY TAKEAWAYSKey PointsOrganisms may be very closely related, even though they look quite different, due to a minor genetic change that caused a major morphological difference.Unrelated organisms may appear very similar because both organisms developed common adaptations that evolved within similar environmental conditions.To determine the phylogeny of an organism, scientists must determine whether a similarity is homologous or analogous.The advancement of DNA technology, the area of molecular systematics, describes the use of information on the molecular level, including DNA analysis.Key Termsanalogous: when similar similar physical features occur in organisms because of environmental constraints and not due to a close evolutionary relationshiphomologous: when similar physical features and genomes stem from developmental similarities that are based on evolutionphylogeny: the evolutionary history of an organismmolecular systematics: molecular phylogenetics is the analysis of hereditary molecular differences, mainly in DNA sequences, to gain information on an organism’s evolutionary relationships

where are genes located in a prokaryotes cell?

Answers

Vas happenin!
Hope your day is good well or night

In the nucleus

Hope this helps *smiles*

how many different versions of a gene are carried in a single normal cell?

Answers

Answer:

two versions of a gene are carried in a single normal cell called alleles

Select all that apply.
Which conditions relate to the research of van Helmont?
plant mass related only to soil
conclusions partly correct
demonstrated plant food from soil
conducted around 1400 AD.
plant mass related to H 20

Answers

Answer:

I'd say the best Answer is A & C

Explanation:

please give the correct answer to this question​

Answers

Answer: Lymphatic system

Explanation:

Not respiratory and excretory for sure.

Not nervous because the diagram doesn't show spinal nerves clearly. So its lymphatic system.

:-)

why is it necessary yo separate oxgynated and deoxgynated blood in livng oranisum

Answers

Explanation:

it is necessary in mammals and birds to separate oxygenated and deoxygenated blood because this makes their circulatory system more efficient and helps in maintaining a constant body temperature

Glycolysis and gluconeogenesis are opposing pathways in that they begin or end with the same metabolites and share common intermediates and/or enzymes. Yet, for energetic reasons, the two processes cannot be the exact reverse of each other. How is this possible

Answers

Answer:

Due to difference in their products.

Explanation:

Glycolysis and gluconeogenesis are not exact reverse to each other because in glycolysis, glucose is converted into pyruvate, adenosine triphosphate (ATP), NADH, protons i.e. hydrogen ions and water whereas in gluconeogenesis, pyruvate is converted into glucose and glycogen. So due to  the formation of different products of each process we can say that glycolysis is not exact reverse of gluconeogenesis.

Why is it necessary to separate oxgynated blood and deoxgynated blood in living organisums?

Answers

Answer:

For efficient transportation of blood.

Explanation:

Before working at the hospital, Beth was given a Mantoux skin test to detect tuberculosis. If it were positive, the site of the test would become hardened and red. What type of response is this?

Answers

The options are missing from the question,the missing options are;

a. Anaphylactic

b. Histamine

c. Immediate allergic

d. Delayed allergic

e. B-cell mediated.

The correct answer to the question is option D

DELAYED ALLERGIC.

Delayed allergic response is a type of late response to antigen that occurs 48-72hours after exposure to an antigen.

This type of allergic response is mediated by T-cells and macrophages.

They are otherwise known as delayed hypersensitivity response/reaction.

The response is delayed because there is sensitization upon first exposure to the antigen, therefore if there is a re-exposure,a secondary cellular response is initiated triggering the actions of the already sensitized T-cells and macrophages.

Which of the traits below are completely influenced by the expression of genes? (Choose all that apply)
weight
attached or unattached earlobes
hair texture
eye color

Answers

Eye color bjfijdjsuddjjdcnvnfjd

Answer:

attached or unattached ear lobes

-gene 1
-gene 2
-gene 3
How are these three genes related?

Answers

Answer:

Depends on the locations of these gene segment on the chromosome whether it be found on the same or different.

It can either be linked or unlinked.

1. Viruses such as avian (bird) flu and swine flu that mutate and can spread from animals to human populations are known as what?
O A. Vectors
O B. Transmuting viruses
O C. Epidemics
O D. Zoonoses

Answers

Answer:

B

Explanation:

they are transmuting viruses

B. Transmuting viruses is the answer

1. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. A phylogenetic tree containing two main branches for evolutionary relationships among the animals.
B. The first branch leads to Drosophila.
C. The second branch divides into two branches, 2a and 2b. Branch 2a leads to Lancelet.
D. Branch 2b divides into two branches: 3a and 3b. Branch 3a leads to Zebrafish.
E. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Frog.
F. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Chicken.
G. Branch 5b divides into two branches leading to Human and Mouse, respectively.
2. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.
B. The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.
C. A frog is the ancestor of both a mouse and a chicken.

Answers

The figure shows a tree diagram with two main branches. The first branch leads to Drosophila. The second branch divides into two branches 3a and 3b. Branch 3a leads to Lancelet. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Zebrafish. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Frog. Branch 5b divides into two branches: 6a and 6b. Branch 6a leads to Chicken. Branch 6b divides into two branches leading to Human and Mouse, respectively.

This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.

The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

A frog is the ancestor of both a mouse and a chicken.

The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.

Answer:

The answer is below

Explanation:

Given the information above, and from the available pictures which showed the detailed analysis of the information presented in the question. It can be concluded that, the nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

Hence, the right answer is option B.

if you think about fat as old stuff,what new stuff can be made from it

Answers

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

Fat is derived from plant and animal sources. They include seeds, fruits, fatty fish.

Fats serve as a source of energy in organisms and also serve as insulation.

If you think about fat as old stuff,what new stuff can be made from it means of the things fats can be made from and they include Paints, Lubricants, Biofuel, Face cream, Soap etc. These products are manufactured in industries on a large scale due to their high demand.

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

An ecologist samples the abundance of various species along an environmental gradient and fails to find clusters of species. Instead, peaks of abundance of dominant species are merely randomly spaced segments along a continuum. This distribution of species supports the

Answers

Answer:

This distribution of species supports Gleason´s Individualistic concept of a community.

Explanation:

This theory was proposed by Gleason and it states that plant species respond individually to environmental factors that continuously change at spatial and temporal levels. This means that the combination and distribution of plants in a certain point or area are unique because each vegetable species has a different distribution pattern and a different tolerance and abundance rate. Hence each species´ response curve to a certain gradient has its own shape and size and it different from other species curves.  

Plants assembly growing in an area is the result of environmental conditions and migration rate of species. As every area is continuously getting propagules of different species, the survival success of each plant depends not only in environmental factors, but also depends on the tolerance to other new species and their interactions. This combination along a gradient always results in different composition and abundance of species. This is why a sample can not be confined to a clearly defined vegetable community.

This point of view is known as individualistic or continuum concept of vegetable community. Gleason believed that vegetable species were distributed as a continuum and that communities can not be identified as combinations of associated species that repeat in space.

Other Questions
help please! I need this ASAP Find the value of x 4 and 6 can be classified as: Communicating public information messages internally to the workforce is important because it allows the PIO to: A. Enlist support and involvement of organization personnel while communicating a consistent message B. Demonstrate commitment to the organization C. Test the message on a " safe" audience D. Add to the measurable statistics An object is moving at a speed of 5 kilometers every 4.5 hours. Express this speed in miles per minute Complete the Magic Square. The _____ is important to the cultural context of Nectar in a Sieve. Select all that apply.Muslim traditionhistory of Britainpartition of IndiaIndian caste system True or False: If the data for an observation on either the dependent variable or one of the independent variables are missing at random, then the size of the random sample available from the population must be reduced, which reduces the estimator's precision and introduces a bias. the cost of cementing a wall 8 feet wide and 24 feet long at 14.40 a square yard iswill mark brainlist Rewrite the expression as an equivalent ratio of logs using the indicated base.log17(52.875) to base 10. sam ran 63,756 feet in 70 minutes what is sams rate in miles per hour? (there are 5,280 feet in one mile) 2% of the students at Hamilton Middle School have red hair. There are 700 students at Hamilton MiddleSchoolHow many students at Hamilton Middle School have red hair? past examples of governments that were not democratic? What are some of the major issues with geotagging? What concerns you the most? What's the exact value of tan 15? Phoebe took a survey of her classmates' favorite sport. The results are in the table below:What is the relative frequency of survey members who prefer tennis? PLS HELP ME ON THIS QUESTION I WILL MARK YOU AS BRAINLIEST IF YOU KNOW THE ANSWER!!Find the interquartile range of the data set that consists of 10, 10, 8, 4, 5, 7, 7, 4, 3, 10.A. 4B. 10C. 7D. 6 I'm stuck, please help Which element provides strength to the exoskeletons of clams and oysters?sulfuroxygen hydrogenphosphorus PLEASE HELP! D:Which of the following is an example of the idea of "separation of powers" in the American constitutional system?A - Each state elects representatives and senators to Congress.B - The process for creating laws involves Congress and the president.C - The military is allowed to make decisions without the president's approval.D - Congress is allowed to pass laws without approval of the president. Kohler Corporation reports the following components of stockholders' equity on December 31, 2009. Common stock$10 par value. 100,000 shares authorized. 40,000 shares Issued and outstanding $400,000Paid-ln capital In excess of par value, common stock . 60,000Reamed earnings 270,000Total stockholders 730,000In year 2010, the following transactions affected its stockholders' equity accounts. Jan. 1 Purchased 5,500 shares of its own stock at $15 cash per share.Jan. 5 Directors declared a $4 per share cash dividend payable on February 28 to the February 5 stockholders of record.Feb. 28 Paid the dividend declared on January 5.July 6 Sold 2,063 of its treasury shares at $19 cash per share.Aug. 22 Sold 3,437 of its treasury shares at $12 cash per share.Sept. 5 Directors declared a $4 per share cash dividend payable on October 28 to the September 25 stockholders of record.Oct. 28 Paid the dividend declared on September 5.Dec. 31 Closed the $408,000 credit balance (from net income) in the Income Summary account to Retained Earnings.Required a. Prepare journal entries to record each of these transactions for 2010. b. Prepare a statement of retained earnings for the year ended December 31, 2010. c. Prepare the stockholders' equity section of the company's balance sheet as of December 31, 2010.