What characteristic of sexual reproduction did Mendel investigate that resulted in offspring expressing characteristics that differed from their parents?

Answers

Answer 1

Explanation:

Mendel crossed two unlike parents to get offspring with characterestics that differ that of the parents

Answer 2

Mendel used the characteristic of sexual reproduction in which the genes from the two parents combine to form the offspring. This results in offspring expressing the characteristics that differed from their parents.

What is Sexual reproduction?

Sexual reproduction is a type of reproduction in which the production of new organisms occur by the combination of genetic information of the two parents or individuals of different sexes. In most of the species, the genetic information is carried on the chromosomes in the nucleus of reproductive cells called gametes, which fuse to form a diploid zygote in the organism which matures to form a complete organism.

Mendel called the material which is responsible for the characteristics as "factors", and he proposed that during sexual reproduction, each of the parent contributed a form of this factor to the resulting offspring. This combination of the parental factors then determined which form of a trait will be visible in the offspring.

Learn more about Sexual reproduction here:

https://brainly.com/question/7464705

#SPJ3


Related Questions

How do I work this question out I’m struggling

Answers

I think the best thing to do is use a ruler maybe.

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

1. Viruses such as avian (bird) flu and swine flu that mutate and can spread from animals to human populations are known as what?
O A. Vectors
O B. Transmuting viruses
O C. Epidemics
O D. Zoonoses

Answers

Answer:

B

Explanation:

they are transmuting viruses

B. Transmuting viruses is the answer

please give the correct answer to this question​

Answers

Answer: Lymphatic system

Explanation:

Not respiratory and excretory for sure.

Not nervous because the diagram doesn't show spinal nerves clearly. So its lymphatic system.

:-)

Why is it necessary to separate oxgynated blood and deoxgynated blood in living organisums?

Answers

Answer:

For efficient transportation of blood.

Explanation:

if you think about fat as old stuff,what new stuff can be made from it

Answers

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

Fat is derived from plant and animal sources. They include seeds, fruits, fatty fish.

Fats serve as a source of energy in organisms and also serve as insulation.

If you think about fat as old stuff,what new stuff can be made from it means of the things fats can be made from and they include Paints, Lubricants, Biofuel, Face cream, Soap etc. These products are manufactured in industries on a large scale due to their high demand.

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

what is a warning safety sign​

Answers

Answer:

Hey there!

A warning safety sign is a sign that warns you that there may be a safety hazard around you.

Let me know if this helps :)


Mention the types of bees​

Answers

Answer:

ok thus very good percent few Mohammad khan

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Which of the traits below are completely influenced by the expression of genes? (Choose all that apply)
weight
attached or unattached earlobes
hair texture
eye color

Answers

Eye color bjfijdjsuddjjdcnvnfjd

Answer:

attached or unattached ear lobes

The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the likelihood that an organism could become extinct. Which of the following could also increase an organism's chances of extinction? A. an increase in predation, competition, and/or disease B. a lack of genetic diversity in an organism's species C. the inability to reproduce D. all of these

Answers

Answer:

D

Explanation:

all of those are likely to increase an organisms chances of extinction

Select all that apply.
Which conditions relate to the research of van Helmont?
plant mass related only to soil
conclusions partly correct
demonstrated plant food from soil
conducted around 1400 AD.
plant mass related to H 20

Answers

Answer:

I'd say the best Answer is A & C

Explanation:

An ecologist samples the abundance of various species along an environmental gradient and fails to find clusters of species. Instead, peaks of abundance of dominant species are merely randomly spaced segments along a continuum. This distribution of species supports the

Answers

Answer:

This distribution of species supports Gleason´s Individualistic concept of a community.

Explanation:

This theory was proposed by Gleason and it states that plant species respond individually to environmental factors that continuously change at spatial and temporal levels. This means that the combination and distribution of plants in a certain point or area are unique because each vegetable species has a different distribution pattern and a different tolerance and abundance rate. Hence each species´ response curve to a certain gradient has its own shape and size and it different from other species curves.  

Plants assembly growing in an area is the result of environmental conditions and migration rate of species. As every area is continuously getting propagules of different species, the survival success of each plant depends not only in environmental factors, but also depends on the tolerance to other new species and their interactions. This combination along a gradient always results in different composition and abundance of species. This is why a sample can not be confined to a clearly defined vegetable community.

This point of view is known as individualistic or continuum concept of vegetable community. Gleason believed that vegetable species were distributed as a continuum and that communities can not be identified as combinations of associated species that repeat in space.

What can you learn about by studying DNA?

Answers

Answer:

Explanation:

                  The study of human DNA and genetics can be intellectually fascinating, but it also has plenty of practical applications. From the use of DNA in court cases to the discovery of new therapies for genetic diseases, a thorough understanding of the human genome can have important medical, social and legal impacts.

Superficial similarities in structures that have the same function can seem like they are evidence of a common ancestor, but they are not. An example of this is the convergent evolution of wings in insects as well as in birds. What are these types of structures called

Answers

Answer:

Distinguishing between Similar Traits

Similar traits can be either homologous structures that share an embryonic origin or analogous structures that share a function.

LEARNING OBJECTIVES

Explain the difference between homologous and analogous structures

KEY TAKEAWAYSKey PointsOrganisms may be very closely related, even though they look quite different, due to a minor genetic change that caused a major morphological difference.Unrelated organisms may appear very similar because both organisms developed common adaptations that evolved within similar environmental conditions.To determine the phylogeny of an organism, scientists must determine whether a similarity is homologous or analogous.The advancement of DNA technology, the area of molecular systematics, describes the use of information on the molecular level, including DNA analysis.Key Termsanalogous: when similar similar physical features occur in organisms because of environmental constraints and not due to a close evolutionary relationshiphomologous: when similar physical features and genomes stem from developmental similarities that are based on evolutionphylogeny: the evolutionary history of an organismmolecular systematics: molecular phylogenetics is the analysis of hereditary molecular differences, mainly in DNA sequences, to gain information on an organism’s evolutionary relationships

Glycolysis and gluconeogenesis are opposing pathways in that they begin or end with the same metabolites and share common intermediates and/or enzymes. Yet, for energetic reasons, the two processes cannot be the exact reverse of each other. How is this possible

Answers

Answer:

Due to difference in their products.

Explanation:

Glycolysis and gluconeogenesis are not exact reverse to each other because in glycolysis, glucose is converted into pyruvate, adenosine triphosphate (ATP), NADH, protons i.e. hydrogen ions and water whereas in gluconeogenesis, pyruvate is converted into glucose and glycogen. So due to  the formation of different products of each process we can say that glycolysis is not exact reverse of gluconeogenesis.

• How the knowledge of classification be applied to assess the characteristics of different organisms when visit to zoo, herbaria or gardens.(Students may do research on internet to answer this question )
plz correct answer
be quick

Answers

Answer:

Compare two organism on the physical features and mode of nutrition.

Explanation:

Organisms are classified in groups and sub-groups on the basis of similarities and differences. so in order to compare two organisms, start with the similarities that are present between them. If similarities are more so they belong to the same group or if differences are more than both are placed in different groups. for classification, see the physical appearance of organism, mode of nutrition and habitat etc. If organisms are identical, they belong to the same species, if one or two characters are different so their genus will be same but specie is different. In zoo animals are different from the animals which is present in garden so compare the physical features of zoo and garden animals.

What is the role of Langerhans cells? prevent pathogens from entering the body using antibacterial agents destroy pathogens that enter the body using white blood cells identify pathogens that enter the body and carry them to lymph nodes for destruction

Answers

The role of Langerhans cells is that they prevent pathogens from entering the body using antibacterial agents.

What are Langerhans cells?

Langerhans cell is a dendritic cell of the skin and mucosa, containing Birbeck granules, and present in all layers of the epidermis but most prominent in the stratum spinosum.

Langerhans cells play important roles in the immune system by acting as the outermost guard of the cutaneous immune system where they induce the first reactions against pathogens encountered via the skin.

Therefore, the role of Langerhans cells is that they prevent pathogens from entering the body using antibacterial agents.

Learn more about Langerhans cells at: https://brainly.com/question/15660598

#SPJ2

Answer: 3.identify pathogens that enter the body and carry them to lymph nodes for destruction

Explanation:

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

how many different versions of a gene are carried in a single normal cell?

Answers

Answer:

two versions of a gene are carried in a single normal cell called alleles

1. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. A phylogenetic tree containing two main branches for evolutionary relationships among the animals.
B. The first branch leads to Drosophila.
C. The second branch divides into two branches, 2a and 2b. Branch 2a leads to Lancelet.
D. Branch 2b divides into two branches: 3a and 3b. Branch 3a leads to Zebrafish.
E. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Frog.
F. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Chicken.
G. Branch 5b divides into two branches leading to Human and Mouse, respectively.
2. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.
B. The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.
C. A frog is the ancestor of both a mouse and a chicken.

Answers

The figure shows a tree diagram with two main branches. The first branch leads to Drosophila. The second branch divides into two branches 3a and 3b. Branch 3a leads to Lancelet. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Zebrafish. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Frog. Branch 5b divides into two branches: 6a and 6b. Branch 6a leads to Chicken. Branch 6b divides into two branches leading to Human and Mouse, respectively.

This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.

The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

A frog is the ancestor of both a mouse and a chicken.

The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.

Answer:

The answer is below

Explanation:

Given the information above, and from the available pictures which showed the detailed analysis of the information presented in the question. It can be concluded that, the nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

Hence, the right answer is option B.

A molecule will become an ion when which of the following happens?

Answers

Loses or gains a charge

Which of the following are all examples of pollution
Pesticide Run-off
Desertification
Global Warming
Poaching
Burning of Fossil Fuels

Answers

Burning fossil fuels

why is it necessary yo separate oxgynated and deoxgynated blood in livng oranisum

Answers

Explanation:

it is necessary in mammals and birds to separate oxygenated and deoxygenated blood because this makes their circulatory system more efficient and helps in maintaining a constant body temperature

john is testing the effect of temperature on the solubility of sugar in water

Answers

Answer:

As John is testing the effect of temperature on the solubility of sugar in water. To test this, he will measure the amount of sugar dissolved at different temperature level.

Help!!!
I'll give brainliest the brainliest. ​

Answers

Answer:

resists the turgor  pressure of the cell:  A : cell wall

controls the activities of  the cell : C : nucleus

site of the chemical  reactions of the cell  including synthesis of  proteins:  D : cytoplasm

Answer:

1. A -  Cell Wall

2. C - Nucleus

3. B. Mitochondria

Give brainliest

Why does the land around a once active coal mine remain barren?
A: Toxic nitrous oxides were released into the soil killing all plants.
B: C: Ozone is formed from hydrocarbons which prevent the growth of plants.
Please don't just take points. Thank you and have a good day

Answers

Hello!!

The answer is A. Toxic nitrous oxides were releassed into the soil killing all plants

Answer:

Empty coal mines are flooded with acid rain so no life forms can survive.

Explanation:

The opposable thumb is a trait that connects us to other primates; allowing us to grab and use tools and increasing chances for survival. This means it is a(n) __________.

Answers

Answer:

The options to this question are;

A. genotype

B. adaptation

C. selective pressure

D. stabilizing pressure

The answer is B) Adaptation

Explanation:

Adaptation is the process whereby an organism becomes well suited to survive in its natural environment, which is aided by the possession of certain traits called adaptive features. For example, the fins of a fish makes it fit to survive in an aquatic environment, likewise the opposable thumbs of humans make us well suited to survive in our environment.

As stated in the question, the opposable thumb i.e. movement of the thumb independently of the other four fingers, is a characteristics of primates. This unique feature (opposable thumb) allows us to grab things, get a good grasp of tools, use tools effectively, write things, etc. All these ability due to the possession of opposable thumb increases our chances of survival. Hence, the possession of opposable thumb is regarded as an ADAPTATION

-gene 1
-gene 2
-gene 3
How are these three genes related?

Answers

Answer:

Depends on the locations of these gene segment on the chromosome whether it be found on the same or different.

It can either be linked or unlinked.

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

Other Questions
If everyone on the planet used the same amount of resources as an average American, what percent of the Earth wouldneed to be used to support everyone?A. 75%B. 50%C. 150%D. 200% please give correct amswer.. Closing prices of two stocks are recorded for 50 trading days. The sample standard deviation of stock X is 4.665 and the sample standard deviation of stock Y is 8.427. The sample covariance is $35.826.Calculate the sample correlation coefficient. (Round your answer to 4 decimal places.) Soil moisture (wethess) isimportant for...?A. it is a determination of how much water the soil canhold and how easily water moves through,B. it is evidence of how easily the process of runoff inwhich the soil is filtered can occur.C. Both & BD. None of the above The 2016 annual report for Mega Mills disclosed that 1 billion shares of common stock have been authorized. At the end of 2015, 760 million shares had been issued and the number of shares in treasury stock was 101 million. During 2016, the only common share transactions were that 18 million common shares were reissued from treasury and 24 million common shares were purchased and held as treasury stock.Required: Determine the number of common shares a. Issued b. In treasuryc. Outstanding at the end of 2016. what can be broken but never held? The Atlantic Division of Stark Productions Company reported the following results for 2019: Sales $4,000,000 Variable costs 3,200,000 Controllable fixed costs 300,000 Average operating assets 2,500,000 Management is considering the following independent alternative courses of action in 2020 in order to maximize the return on investment for the division. 1. Reduce controllable fixed costs by 10% with no change in sales or variable costs. 2. Reduce average operating assets by 10% with no change in controllable margin. 3. Increase sales $500,000 with no change in the contribution margin percentage.Compute the return on investment for 2019. Each of the following is a type of homework except:A. preparationB. practiceC. concentration.D. integrationSUBMIT A college degree is associated with a higher income on average, so it makes sense to look at educational attainment when thinking about gender wage inequality. Women's college enrollment:______a. has always been higher than men's, with the exception of the 1920s. b. was lower than men's in the 1970s, but has been higher than men's since the 1980s. c. has been just about the same as men's since the 1960s. d. was lower than men's in the 1950s, but has been the same as men's since the 1970s. The Blue Screen of death is not an common error, and it is highly likely that you have encountered and fixed several already. Discuss errors you have come across, and the troubleshooting steps that you took to resolve the problem. will mark brainliest A grocer purchased 200 eggs at rs.9each. 20 of them were broken and he/she sold the rest at rs.9.50 each.Find his /her profit or loss percent. Sam ran 63,756 feet in 70 minutes. What is Sam's rate inmiles per hour? (There are 5,280 feet in one mile.)Step 1: What is Sam's rate as stated?63,756 feet63, 756 ft70 min70 minutesStep 2: What factor is used to convert feet per minute intomiles per minute?Step 3: what factor is used to convert miles per minute to miles per hour Solve for x. PLZ ANSWER FAST Read the excerpt from The Origins of the Boxer Uprising by Joseph W. Esherick. Answer these questions about what you read. According to Esherick, why did the Boxer Rebellion become such a famous historical event? Examples of innovation,creativity and entrepreneurship Flowers may be solitary, as in a zinnia or dahlia, or appear in clusters or a/an _______________, as in a/an _______________. g f(x) = -7x^2+8x+2f(x)=7x 2 +8x+2 he most common source of osteomyelitis is an infection that migrates via the bloodstream. direct invasion from a fracture. surgical contamination. a joint prosthesis. How did Frances contributions help the Americans in the War of Independence?