What is the difference between central idea and message of the poem?

Answers

Answer 1

The central idea of a poem is the main point or theme that the poem is trying to convey.

What is poem?

A poem is a form of literature that conveys a message, emotion, or insight through the use of rhythm, imagery, and other literary devices. Poetry has been around for thousands of years, with its roots in oral storytelling traditions around the world. The form is highly varied, with different styles being used to convey different messages and ideas.

The message of a poem is the moral or lesson that the poem is trying to impart. The central idea is the overall concept that the poem is exploring, while the message is the specific takeaway that the poet wants the reader to understand.

To learn more about poem
https://brainly.com/question/940065
#SPJ4


Related Questions

Why is Dr Jekyll responsible for Mr Hyde's crimes?

Answers

Because Dr Jekyll creates Hyde despite being aware that he represents only pure evil. Jekyll is consequently accountable for Hyde's deeds.

Are Mr. Hyde's misdeeds the fault of Dr. Jekyll?

Dr. Hyde was killed by Jekyll because he was still "there" to take the poison and commit himself to put a stop to everything. The book demonstrates that Jekyll persisted in trying to right his mistakes and was deeply repulsed by Hyde's deeds.

What drives Jekyll's efforts to exterminate Hyde permanently?

What drives Jekyll's attempts to permanently sever ties with his Hyde side? Without utilizing the potion, Hyde is assuming control and Jekyll is transforming.

To know more about Dr Jekyll visit :-

https://brainly.com/question/24134485

#SPJ4

How often should you reflect on your emotional cup and needs? explain your reasoning. ​

Answers

You can reflect on your own or with others, but you cannot make other people or yourself reflect. Do not attempt to begin a reflective practise if you are not ready. Start small by journaling for five minutes each day or going for a weekly 30-minute walk of reflection.

How frequently should we reflect?

Pay attention to doing it at the same time each day. Without exceptions Even if you decide not to keep a one-sentence journal, develop the habit of reflecting on your day by giving it a few minutes at the end of each day.

What does it mean that I need space to think mean?

Reflecting entails taking a moment to stop, enjoy the adventure, and consider what is truly important to YOU.

To know more about journal visit:-

brainly.com/question/30154042

#SPJ4

(2) ...It was not because I feared it would be dull—for without Mark, Montreal was just as much of a howling wilderness as any other place. But it was so horribly far away.


Which word would be an appropriate synonym to replace howling in the passage

options: loud, desolate, terrifying, populated

Answers

The word that would be an appropriate synonym to replace howling in the passage is loud. The correct option is a.

What is a synonym?

A synonym is a word, morpheme, or phrase that means exactly or nearly the same as another word, morpheme, or phrase in a given language. For example, in the English language, the words begin, start, commence, and initiate are all synonyms of one another: they are synonymous. The standard test for synonymy is substitution: one form can be replaced by another in a sentence without changing its meaning.

Words are considered synonymous in only one particular sense: for example, long and extended in the context long time or extended time are synonymous.

Learn more about synonym, here:

https://brainly.com/question/30028676

#SPJ1

3. PART A: How does the speaker's view of her mother
change as she grows older?

Answers

She sees her mother as typical as a child, but as an adult, she sees her as a larger-than-life character.

Who is the poem's speaker?If you can, estimate her age and back it up with evidence. A young girl is the poem's speaker. She must be between 12 and 14 years old.This can be assumed because she believes that while scientists, biologists, geologists, and archaeologists are discovering so much new information, it is up to young people like her to learn about it from their textbooks.They are the means by which he alters his future. They dismantle the wall.

To learn more about mother refer:

https://brainly.com/question/15749620

#SPJ1

Please help me ASAP ASAP the question is in the picture bible subject

Answers

The main biblical themes center on God, his revealed acts of creation, provision, judgment, deliverance, his covenant, and his promises.

What is Bible subject?The main biblical themes center on God, his revealed acts of creation, provision, judgment, deliverance, his covenant, and his promises.In light of God's character, righteousness, faithfulness, mercy, and love, the Bible interprets what occurs to human beings.Both James 4:7 and Ephesians 5:21 instruct us to submit to one another and God, respectively.This time, we have two sides.Both God and other people must be subject to us, but we also must be subject to one another. The Subject Bible is a full, two-Bibles-in-one combo book with a large-print original KJV Bible in the front half (with inline definitions and Christ's words in red) and a KJV Subject Bible in the rear (with verses arranged by topics).

To learn more about Bible refer

brainly.com/question/21302634

#SPJ1

What are the main events in Dr Jekyll and Mr. Hyde?

Answers

At various levels, Jekyll and Mr. Hyde can be seen. It discusses the idea of good and evil that exists in all of us as a story.

What stands for Mr. Hyde?

Hyde is much smaller than Jekyll, and this is especially obvious when his tiny body is discovered wearing Jekyll's clothes. This size disparity suggests that the author views the evil side of the human character as being somehow inferior to the good and rational side, as Hyde represents the evil side of Jekyll.

Details of the Dr. Jekyll and Mr. Hyde main events

Utterson learns about Hyde, Jekyll's friend, trampling on a young woman.In meeting Hyde, Utterson is startled.Carew is murdered by Hyde a year later.Utterson goes to talk to Lanyon about Jekyll because he is worried about him.

Therefore,  On another level, it's a criticism of society's hypocrisy and double standards.

Learn more about Mr. Hyde from the given link.

https://brainly.com/question/12656991

#SPJ4

1. Were Gothic writers who used the literary technique of “othering” in their works doing more harm than good with respect to rectifying social injustice?

2. How do twentieth- and twenty-first-century Black female Gothic writers help to expose racism in American society today?

3. Are literary critics correct in categorizing detective novels as a subgenre of Gothic literature? Explain your answer.

4. How does the film noir style of moviemaking qualify these films as Gothic works?

5. What characteristics of Gothic literature have changed between the Victorian Era and the late twentieth and early twenty-first centuries?

6. Why is the conflict between the “haves” and the “have nots” a recurring theme in Gothic literature?

7. Why might contemporary Gothic writers want to make vampire characters more emotional beings than Victorian Era writers did?

8. How do current issues around racism influence contemporary Gothic writers?

9. How have apocalyptic themes in Gothic fiction become more powerful in the twenty-first century?

10. How have contemporary writers made Gothic fiction relevant and appealing to twenty-first-century audiences?

Answers

Whether Gothic writers who used the literary technique of "othering" in their works were doing more harm than good with respect to rectifying social injustice is a matter of debate. Some argue that the portrayal of marginalized groups in a negative light can reinforce harmful stereotypes and perpetuate discrimination. Others argue that the use of "othering" can be a tool for exposing and critiquing societal injustices.

What are the Gothic writers about?

2. Twentieth- and twenty-first-century Black female Gothic writers have helped to expose racism in American society by using the conventions of the Gothic genre to depict the experiences of Black women and the ways in which they are marginalized and oppressed. Their works often draw attention to the intersectionality of race, gender, and class in American society, and illustrate the ways in which these issues are intertwined.

3. Whether detective novels should be categorized as a subgenre of Gothic literature is a matter of debate among literary critics. Some argue that detective novels share many conventions and themes with Gothic literature, such as a focus on crime and the dark side of society, and that they can be considered a subgenre of Gothic literature. Others argue that detective novels are a distinct genre with their own conventions and themes, and should not be considered a subgenre of Gothic literature.

4. The film noir style of moviemaking qualifies these films as Gothic works because they share many conventions and themes with Gothic literature. These conventions include a focus on crime and the dark side of society, a sense of moral ambiguity, and a stylized visual aesthetic that emphasizes shadows and darkness.

5. Characteristics of Gothic literature have changed between the Victorian Era and the late twentieth and early twenty-first centuries. Victorian era Gothic fiction often featured supernatural elements, and explored themes of terror and the unknown. Contemporary gothic literature often features psychological horror, and explores themes of societal issues like class, race, gender, and sexuality.

6. The conflict between the "haves" and the "have nots" is a recurring theme in Gothic literature because it speaks to the anxieties of the upper classes about the potential for social upheaval and rebellion. Gothic literature often portrays the rich as corrupt and the poor as oppressed, which creates a sense of tension between the two groups.

7. Contemporary Gothic writers might want to make vampire characters more emotional beings than Victorian Era writers did because it makes them more relatable to the audience. Emotionally complex vampire characters can also be used to explore themes of morality, desire, and power.

8. Current issues around racism influence contemporary Gothic writers by providing new contexts and perspectives for exploring the genre's traditional themes. Many contemporary gothic writers use the genre to comment on the racial and social issues of the time, and to expose the ways in which these issues are intertwined.

9. Apocalyptic themes in Gothic fiction have become more powerful in the twenty-first century because of the growing sense of global uncertainty and fear of societal collapse. The rise of the genre of Apocalyptic fiction and the increasing awareness of environmental issues have made these themes more relevant.

10 Contemporary writers have made Gothic fiction relevant and appealing to twenty-first-century audiences by updating the conventions of the genre to reflect current societal issues and by exploring new themes and perspectives. They also adapt the conventions of gothic fiction to different mediums and forms, like TV shows, video games, graphic novels and podcasts.

Learn more about Gothic from

https://brainly.com/question/1234077

#SPJ1

How many errors can you find in this text? Assume that any names are spelt correctly:
"Brianna faced a dillemma, she had been invited to two partys on the same night."

Answers

Answer:

Explanation:

I've found two errors in this sentence. The correct sentence will be,

"Brianna faced a dilemma, she had been invited to two parties on the same night."

Errors,

1. Dilemma is spelled wrong.

2. Partys is not a word, use parties if there are two or more parties.

What word means large variety?

Answers

A huge, numerous, or broad selection. The phrases variety, assortment, medley, and miscellany are a few that denote a wide range of options.

The wide variety strategy is a merchandising tactic that depends on a diverse assortment of products to entice customers into the store. The traditional five-and-dime store is a perfect illustration of a wide variety approach.

It is commonly assumed that variety is a plural when it comes before a collective word: Here, you can get a range of cheap goods. When there is a small selection of products accessible, the is typically taken to be a singular if it is present.

To learn more about variety here:

brainly.com/question/30288475

#SPJ4

What is the importance of layout and design of retail store in retailing?

Answers

Layout is a key tactic for successful retail. By planning the flow of the store, the positioning of the merchandise, and the atmosphere, retailers can employ layout to affect client behavior.

Additionally, layouts can be used to calculate revenue per square foot and evaluate the strengths and weaknesses of a company's merchandising mix. A marketer is a person who advertises the goods and services of an association.

They determine the tactics that will increase sales and profits while making sure that these tactics are in line with both the requests and demands of the guests. The ownership structure of a retail establishment affects who you should contact in order to sell to the business, hence it is crucial for marketers to understand it.

To learn more about marketer here:

brainly.com/question/29238723

#SPJ4

Was the USSR a country?

Answers

From 1922 to 1991, the transcontinental nation known as the Soviet Union, or the Union of Soviet Socialist Republics (USSR), covered a significant portion of Eurasia.

Did the USSR consist of multiple nations?

The Union of Soviet Socialist Republics (USSR), which began as a confederation of Russia, Belarus, Ukraine, and Transcaucasia (Georgia, Azerbaijan, and Armenia) in 1922, eventually grew to 15 republics and became a global superpower. The vast nation, which was spread across 11 time zones, was home to nearly 130 distinct ethnic groups.

When did Russia become the Soviet Union?

The Soviet Union's fate was sealed by Gorbachev's failed August 1991 coup. The coup, which was planned by hard-line Communists, brought Yeltsin and the democratic forces to the forefront of Soviet and Russian politics and reduced Gorbachev's power.

To learn more about Soviet Union here:

https://brainly.com/question/12753600

#SPJ4

"The which, if you with patient ears attend, what here shall miss, our toil shall strive to mend". What does this line in the prologue of Romeo and Juliet mean?

Answers

The chorus in Romeo and Juliet's prologue begs the audience to pay close attention to the events that are about to unfold on stage, and is the meaning of given lines.

What themes are present in Romeo and Juliet's prologue?

William Shakespeare uses this poetry form to highlight the fundamental themes of the play, which are love and family strife, as well as to portray another important theme: how genuine love eventually prevails since Romeo and Juliet's deaths put an end to the family strife.

Romeo and Juliet's prologue both introduces the characters and sets the stage for the play's events. It also provides the audience with a thorough description of what will happen. The word "star-crossed," which literally means "against the stars," is used in the Prologue to describe a tragic coupling. Stars were believed to control people's destinies.

To learn more about Romeo and Juliet, visit:

https://brainly.com/question/5025530

#SPJ4

Changing the phrasing of a question from "school vouchers" to "redirect state tax revenue to help parents pay private school costs" has no influence on the answers to the questions.
True or False

Answers

False , Changing the phrasing of a question from "school vouchers" to "redirect state tax revenue to help parents pay private school costs".

With this strategy, parents and families have control over how their educational tax dollars are spent, allowing their children to attend either private or public schools since the funds can be used to cover private tuition expenses. Vouchers give pupils in failing public schools access to more educational possibilities at private schools, according to supporters. The majority of parents who used vouchers to send their kids to private schools reported being happy with the education they gave them, according to RAND researchers. Voucher programs are supported by the American Federation for Children, which estimates that the average value of a voucher is $4,600 a year.

To know more about education refer :

brainly.com/question/28358809

#SPJ4

Revise this sentence

The use of emotion to make a point

Answers

Revise sentence of this sentence is  Making a point by using emotion.

Why does revise mean?Revision entails thoroughly reevaluating, revising, and adding and removing ideas from the original manuscript; reordering any of the original draft's ideas, phrases, or paragraphs; reworking sentences and paragraphs to add more variety, improve the writing's flow, and use more accurate wording.To modify or change: to change one's mind. to change anything that has already been written or printed in order to update, improve, or make corrections: to edit a written work.They made pricing adjustments as a result of realising that some of their prices were higher than those of their rivals. It was appropriate for estimates to be updated as fresh data became available. The papers were edited for publication by three editors.

To learn more about Revise sentence refer to:

https://brainly.com/question/9087107

#SPJ1

100 points


write 3 journal entries Decide what mood or tone you want to convey. What feeling do you want to create in the reader? What attitude or feeling do you want to express toward your topic? Then replace at least five words with ones that better convey your intended mood or tone

Answers

Almost any term that may be used to describe tone can also be used to express mood: The emotions of longing, nostalgia, dread, passion, and enthusiasm are all acceptable tones and moods.

How do you describe a feeling in writing?

The words used in a story might influence how it feels. A writer can use particular words that sound harsh and staccato to evoke an upsetting or irritating mood; if they want to convey a gloomy or melancholy tone, they can pick words with unfavourable meanings to evoke brooding emotions.

What are the three ways a writer establishes mood?

A story's mood can be created by authors in a variety of ways, all of which, of course, rely on language. responses, conflict resolution, and setting can all be influenced.

To know more about emotions  visit:-

https://brainly.com/question/1258150

#SPJ4

Please an ending paragraph for a Perseus story

Answers

Perseus, passing by, saw the princess and fell in love with her. He turned the sea monster to stone by showing it Medusa's head and afterward married Andromeda.

What is the message of the story of Perseus?The story of Perseus and Medusa is a story of perseverance, bravery, and dignity. Perseus personifies the length one would go to in order to save the ones you love. Perseus shows the authenticity of his character when he rescues the helpless Andromeda from the Cetus and the attachment to the rock.Perseus, in Greek mythology, the slayer of the Gorgon Medusa and the rescuer of Andromeda from a sea monster. Perseus was the son of Zeus and Danaë, the daughter of Acrisius of Argos. As an infant he was cast into the sea in a chest with his mother by Acrisius, to whom it had been prophesied that he would be killed by his grandson. After Perseus had grown up on the island of Seriphus, where the chest had grounded, King Polydectes of Seriphus, who desired Danaë, tricked Perseus into promising to obtain the head of Medusa, the only mortal among the Gorgons.

To learn more about perseus refer to:

https://brainly.com/question/29410264

#SPJ1

Write a brief essay in which you compare the Duke of Ferrara, to the following extracts from Othello’s speech in Act 3 Scene 3. Be sure to identify character each character’s traits, motivation, and actions in your response.

Answers

The Duke of Ferrara is a character from the play "The White Devil" by John Webster, while Othello is a character from the play "Othello" by William Shakespeare.

What is comparison of Othello?Both characters are men of high status and position, with the Duke being a ruler of a city-state and Othello being a respected military leader. However, their personalities and actions differ greatly.The Duke of Ferrara is portrayed as a corrupt and power-hungry ruler, who is willing to do whatever it takes to maintain his position of power. He is also depicted as a man who is easily swayed by his passions and desires, and is willing to commit immoral acts in order to satisfy them. In contrast, Othello is portrayed as a noble and courageous man, who is deeply in love with his wife, Desdemona. He is also a man who is deeply affected by the manipulation and deceit of Iago.In Act 3 Scene 3 of "Othello," Othello gives a speech in which he expresses his jealousy and anger towards his wife, Desdemona, who he believes has been unfaithful. He is driven by a deep sense of betrayal and hurt, and is consumed by his emotions. He expresses his desire for revenge and his intention to kill Desdemona and himself, revealing his tragic flaw of jealousy.The Duke of Ferrara and Othello have different motivations and actions. The Duke is motivated by his desire for power and his passions, while Othello is motivated by his love for Desdemona and his sense of betrayal. The Duke's actions are immoral and corrupt, while Othello's actions are driven by his emotions, ultimately leading to his downfall.In conclusion, The Duke of Ferrara and Othello are both men of high status and position, but their personalities, motivations, and actions are vastly different. The Duke is a corrupt and power-hungry ruler, while Othello is a noble and courageous man, driven by his emotions and ultimately leading to his downfall.

To learn more about comparison of Othello refer:

brainly.com/question/26506136

#SPJ1

What did Romanesque focus on?

Answers

The Romanesque era began in Europe in the 10th century and lasted until the middle of the 12th century.

Through the use of sculpture, illustration, tapestry, metalwork, and other artistic techniques, Romanesque art placed a strong emphasis on architecture and the idea of visual storytelling.

What was Romanesque art's primary goal?

Due to the fact that many people in the Medieval era were illiterate, Romanesque paintings were created for didactic (educational) purposes. Additionally, the figure of Christ was portrayed on murals within an oval frame known as a mandorla, in which he was surrounded by various biblical figures or animals.

To learn more about Romanesque era here:

https://brainly.com/question/9349145

#SPJ4

In a nonfiction work, which text feature lists the major parts of a text with corresponding page numbers? Example Page Glossary Index Table of Contents


PLEASE HELP!!!

Answers

The table of contents is a feature in nonfiction books that lists the main sections and the related page numbers.

Why are numbered lists used in nonfiction texts?

To assist the reader in understanding how the book is structured, it summarizes the key ideas of the texts together with the pages. It could be in the front or rear of the book, depending on the format.

To avoid confusion, the index merely provides an alphabetical listing of the important terms, ideas, or events mentioned in the book, together with the relevant page numbers. The index, table of contents, captions beneath images or diagrams, vocabulary terms, labels or characteristics of graphs and charts, and bolded words are the nonfiction text aspects that are most frequently used.

To know more about nonfiction books, visit:

https://brainly.com/question/1697498

#SPJ4

How is Mr Hossack portrayed in both?

Answers

In Midnight Assassin and also in the article "Indicted Her for Murder," Mr. Hossack is portrayed as a well-respected member of his community.

Describe the portrayal of Mr. Hossack.

Mr. Hossack is depicted as a cunning man with a lot of foes. He is portrayed as an unpopular, failing man. In Indicted for Her Murder, the author states: "The slain man was affluent and important and had no opponent in the county so far as is known."

Mr. Hossack is described as being successful and well-known by the author of Midnight assassin, and he even sought office. People in Iowa knew Mr. Hossack, and both the book and the article claim that the only person he had problems with, was his wife and who could have committed the peculiar circumstances surrounding Mr. Hossack's death.

To learn more about Mr. Hossack, visit:

https://brainly.com/question/8506213

#SPJ4

The complete question is:

How is Mr. Hossack portrayed similarly in both Midnight Assassin and the article "Indicted Her for Murder"?

5.
COMMONLIT
How does President Bush support his claim that Muslims are treated differently after the terrorist
attacks of 9/11?

Answers

Answer:

Explanation:

dop

What does Lanyon's letter and Jekyll's confession represent in Jekyll and Hyde?

Answers

Lanyon's letter and Jekyll's confession in ekyll and Hyde is all about sacrifice.

What is Jekyll and Hyde?

This is a British TV based fantasy drama based on a novel Strange Case of Dr Jekyll and Mr Hyde by R. L. Stevenson. This part of Lanyon's letter is from Chapter 9 of the novel. Lanyon received a letter from Jekyll. Lanyon told Utterson not to open the letter until both Lanyon and Jekyll have died. Lanyon said that Jekyll is the cause of the former's illness. Jekyll has confessed that he like Lanyon as his oldest true friend, and he is ready to do any sacrifice, if needed, for Lanyon. The plot revolves around the sacrifice that is being discussed.

Learn more on Jekyll and Hyde here:

brainly.com/question/3213245

#SPJ4

PLEASE HELP!!
Sanjay has several questions about how he can organize his essay and make it easier for his readers to understand. He sends his friend Elijah some texts, asking for help on his essay. Imagine that you are Elijah, and reply to Sanjay’s questions to help him with his essay.

Part A
Sanjay: How do good writers get started on their writing projects? What are some techniques they use?

Part B
Sanjay: How do good writers make sure their essays are appropriate for their audience?

Part C
Sanjay: How do the rules of language affect writing and communication?

Part D
Sanjay: Why does a writer choose a specific form of writing?

Explain what figurative language is. Give an example of a simile and of a metaphor.

Answers

Answer: the answer is b

Explanation: i just did it

Answer:The answer is Sanjay: why does a write choose a specific form of writing

Explanation:

Is it freedom of religion or freedom from religion?

Answers

It is Freedom of religion. A varied society needs religious freedom and freedom of conscience to thrive. It enables other religions and ideologies to flourish.

Explain Freedom of religion.

Freedom of religion is the right to believe in and practice any religion of your choice without interference or coercion from the government or other individuals. This right is usually protected by the government and is included in the United States Constitution. Freedom of religion allows individuals to practice their beliefs without fear of persecution. Freedom from religion is the idea that government should not promote or endorse any particular religion or belief system. This means that public schools should not be allowed to teach religious doctrine and that governments should not be allowed to pass laws that favor one religion over another. This is meant to protect the rights of individuals to practice their own beliefs without interference from the government.

To learn more about freedom of religion visit:

brainly.com/question/81196

#SPJ4

Read the excerpt from "The Crab That Played with the Sea.”Which details from the excerpt best support the conclusion that this story is about the creation of the world? Select two options.

Answers

Things turn into geographical features of the Earth, such as the Himalayas, when the Eldest Magician blows on them. The author refers to the animals as "All-the-Elephant-there-was," "All-the-Beaver-there-was," and "All-the-Turtle-there-was."

What is the theme of The Crab That Played with the Sea?This is the story of Pau Amma, the supreme crab and king of all crabs, who toyed with the sea and brought about the existence of two tides each day. Animation director Tatiana Poliektova and time lapse and hyperlapse filmmaker Filippo Rivetti created the charming Crab Story, which combines live action and animated backgrounds. Most crabs typically take sideways steps while strolling along the seashore. Crabs can, however, move forward, backward, and diagonally. Crabs walk sideways more quickly and easily because of their rigid, joined legs. One leg never enters the path of the other when walking sideways.When the Eldest Magician blows on something, it changes into an Earthly feature, like the Himalayas. "All-the-Elephant-there-was," "All-the-Beaver-there-was," and "All-the-Turtle-there-was" are how the author refers to the creatures.The inquiry seeks information to substantiate the claim that this tale is about the world's genesis. The narrator describes how something is formed in creation stories. The mountain formation is explained by the first correct answer. According to the second right answer, there was only one of each kind of elephant, beaver, and turtle. None of the other possibilities contribute to establishing that this is a creation narrative.

The complete question is,

Read the excerpt from "The Crab That Played with the Sea.” He went North, Best Beloved, and he found All-the-Elephant-there-was digging with his tusks and stamping with his feet in the nice new clean earth that had been made ready for him. ‘Kun?’ said All-the-Elephant-there-was, meaning, ‘Is this right?’ ‘Payah kun,’ said the Eldest Magician, meaning, ‘That is quite right’; and he breathed upon the great rocks and lumps of earth that All-the-Elephant-there-was had thrown up, and they became the great Himalayan Mountains, and you can look them out on the map. He went East, and he found All-the-Cow-there-was feeding in the field that had been made ready for her, and she licked her tongue round a whole forest at a time, and swallowed it and sat down to chew her cud. ‘Kun?’ said All-the-Cow-there-was. ‘Payah kun,’ said the Eldest Magician; and he breathed upon the bare patch where she had eaten, and upon the place where she had sat down, and one became the great Indian Desert, and the other became the Desert of Sahara, and you can look them out on the map. He went West, and he found All-the-Beaver-there-was making a beaver-dam across the mouths of broad rivers that had been got ready for him. ‘Kun?’ said All-the-Beaver-there-was. ‘Payah kun,’ said the Eldest Magician; and he breathed upon the fallen trees and the still water, and they became the Everglades in Florida, and you may look them out on the map. Then he went South and found All-the-Turtle-there-was scratching with his flippers in the sand that had been got ready for him, and the sand and the rocks whirled through the air and fell far off into the sea. ‘Kun?’ said All-the-Turtle-there-was. ‘Payah kun,’ said the Eldest Magician; and he breathed upon the sand and the rocks, where they had fallen in the sea, and they became the most beautiful islands of Borneo, Celebes, Sumatra, Java, and the rest of the Malay Archipelago, and you can look them out on the map! Which details from the excerpt best support the conclusion that this story is about the creation of the world? Select two options. Things turn into geographical features of the Earth, such as the Himalayas, when the Eldest Magician blows on them. The Eldest Magician and the animals engage in conversations using language, which is an example of personification. The animals engage in activities that are typical of their species, such as the cow chewing its cud and the beaver building a dam. The author repeats foreign expressions such as "Kun" and "Payah kun" in the conversations between the Magician and the animals. The author refers to the animals as "All-the-Elephant-there-was," "All-the-Beaver-there-was," and "All-the-Turtle-there-was."

To learn more about The Crab That Played with the Sea refer to:

https://brainly.com/question/10851472

#SPJ1

what distinct feature makes a 1970s hot wheels car worth more money?

Answers

Some of the most common factors that can affect the value of a Hot Wheels car include Rarity, Condition, Color, Variations, and Popularity.

Rarity: Some Hot Wheels cars from the 1970s were produced in limited quantities, and these cars are considered to be more valuable.

The condition of a Hot Wheels car is also a major factor in determining its value. Cars that are in mint condition, with no scratches, dents, or other damage, will be worth more than cars that show signs of wear and tear.

Some Hot Wheels cars from the 1970s were produced in a variety of colors, and certain colors are considered to be more valuable than others. Variations: Some Hot Wheels cars from the 1970s have variations, such as different paint jobs, different wheels, or other small changes that can make them more valuable.

Popularity among collectors, certain Hot Wheels cars from the 1970s are considered to be more valuable than others. Cars that were based on popular TV shows or movies, or those that featured unique designs or features, are considered to be more valuable than other cars.

To learn more about Rarity

https://brainly.com/question/29237983

#SPJ4

list the three influences that affect the buying decisions of organizations.

Answers

These corporate purchasing decisions are divided into three categories: the fresh buy, the plain rebuy, and the adjusted rebuy.

What word best describes influence?

Popular synonyms for influence include authority, credit, status, and weight. Although the term "influence" can refer to a force that is applied and absorbed consciously or unconsciously, all of these terms refer to "power exerted out over minds or behavior of so many others."

What are an individual's influences?

Ability or influence over another person's actions, behaviors, opinions, etc. by a person or thing. He used family connections to secure the deal. the act or process of having an effect on another person's or persons' behavior, actions, opinions, etc.

To know more about influences visit:

brainly.com/question/29023957

#SPJ4

Is the National Association of unclaimed property Administrators legit?

Answers

The National Association of Unclaimed Property Administrators (NAUPA) is a legitimate organization that was established in 1972.

It is a non-profit organization composed of state officials responsible for the administration of unclaimed property laws. State unclaimed property administrators created the non-profit National Association of Unclaimed Property Administrators (NAUPA).

The main goal of the organization is to promote the reporting, custody, and return of unclaimed property to its rightful owners. The organization provides education, training, and advocacy to its members, and it also works to develop and promote legislation and regulations that are beneficial to the unclaimed property industry. NAUPA also works with other organizations to ensure that unclaimed property laws are used to benefit the citizens of the state.

To learn more about the National Association of unclaimed property Administrators, refer:-

https://brainly.com/question/30299441

#SPJ4

Read the passage. hesitantly, alejandro stepped up to the plate and took a deep breath, squeezing his eyes shut to try to settle his nerves. batting practice had been rocky at best lately, and he had already struck out once today. the embarrassment of that moment still burned in his cheeks, a stark crimson contrasting with his grass-green uniform. which word best describes the voice in this passage? arrogant uneasy apathetic humorous

Answers

The best word that describes the voice in the passage about Alejandro is uneasy.

Thus, the correct answer is B.

What is a voice in the literature?

In literаture, the voice expresses the nаrrаtor or аuthor’s emotions, аttitude, tone аnd point of view through аrtful, well-thought-out use of word choice аnd diction. А voice mаy be formаl or informаl; serious or lightheаrted; positive or negаtive; persuаsive or аrgumentаtive; comicаl or depressed; witty or strаightforwаrd; objective or subjective; truly, voice cаn reflect аny аnd аll feelings аnd perspectives. А work’s voice directly contributes to its tone аnd mood; helping the writer creаte the desired effect he wаnts his words to hаve on reаders.

The options are not well arranged, but most probably the options were

a. arrogant

b. uneasy

c. apathetic

d. humorous

For more information about voice refer to the link:

https://brainly.com/question/9298440

#SPJ4

Answer: its b uneasy

Explanation:

Write a letter to your uncle telling him how you are going to spend your Christmas holiday any explain why​

Answers

A letter writing is a message transmitted from one person to another through some other person or medium.

What should you include in a letter to your Uncle asking him to spend the holidays with you?

I'd want to let you know that I'll be staying with you over the winter months. The very following month, I'll be on vacation, and I've already purchased my tickets to come see you and have a good time.

How would you describe my vacation in a letter to a friend?

My vacations where I could stay up late are missed. I indulged in my love of gardening over the holidays. Vegetables were among the many plants I grew.

To know more about letter writing visit :-

https://brainly.com/question/23864960

#SPJ4

Other Questions
HELP ASAP!!!!! What is the value of the following expression?[6 4 + 50 (12 + 13) + 2] 3 What professional can help you prepare your income tax return? Read Voluntourism: an opportunity too good to be true and The Opportunity of a Lifetime and answer the questions.How are points developed? What is the claim? Is there a counterclaim? If so, what is it? How is it refuted or weakened? What is the effect of the identified devices or appeals? How does this device or appeal help achieve the purpose of the speech or text? What is the authors attitude toward the topic? How does the tone affect the audience? How does the tone help achieve the authors purpose? Which details are emphasized in each medium? What does the different emphasis reveal about the authors position and purpose? What is the effect of the different elements emphasized? a co-worker is to employee as a (n) is to a (n) What are the benefits brought by technology and explain why is it beneficial in the field of healthcare? A computer is performing a binary search on a sorted list of 20 items. What is the maximum number of steps it needs to find the item? the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25 Work out the equation of the line shownbelow.Give your answer in the form y = mx + c,where m and c are integers or fractions intheir simplest forms.Y-160-140--120--100-80-60-40-20--80 -70 -60 -50 -40 -30 -20 -10 0-20--40--60-80--100-120--140---160-10 20 30 40 50 60 70 80 x A 2kg block is attached to a spring for which k=200N/m, it is hold at an extension of 5cm and then released at t=0. Find the displacement as a function of time. The velocity , acceleration and total energy when x=+_ A/2. the lowest prices. the most product options. the fewest product options. superior value for the price. the bloch sphere geometric representation of a quantum state is parameterized by two angles and such that . what are the values of the angles and for the state Evaluate the expression for x = -8.x = 16, and x = 4.X 4 which nursing action is appropriate when providing care to a patient who experiences apiration because of enteral feedings A. I hiked on mountain paths, biked on wooded trails, and kayaked on clear ponds.B. These drones can soar, swoop, hover, and even make the buzzing sound of a housefly.C. Mr. Patel improves our school every day by teaching his classes well, he coaches his team well, he even gives personal advice and counseling to students who need it.D. We are kinder, more thoughtful, more conscientious, better students. The first category of evaluation and management codes is? Which of these is a new form of payment that has been recently accepted in some companies?A. CashB. CheckC. Credit CardD. Cryptocurrency 9800 workers in Arizona retired in 2010 as compared to 23,430 in 2009. What is the absolutechange in the number of workers that retired? evaluating a company's performance not only by its ability to generate economic profits but also by its impact on people and the planet. Triple bottom line