Answer:
The scarab or dung-beetle, and the spider to some ancient symbologists
How do simple organisms exchange substances?
O A. Directly across the alveoli.
OB. Through spiracles.
C. Directly across the external membranes.
D. Through specialized gas exchange systems.
What is the function of the mitochondria?
A. Stores the cell's DNA
B. Builds proteins
C. Produces energy for the cell by respiration
OD. Stores the cell's glucose
Reset Selection
Answer:
Produces energy for the cell by respiration
Explanation:
The glucose obtained from food is broken down to pyruvic acid in the cytoplasm. This pyruvic acid is broken down into oxygen, water and energy rich ATP molecules in the Mitochondria.
what is genetic variation
Answer:
The difference in DNA between individuals or between groups is referred to as genetic variation. Mutation and genetic recombination are two of the many causes of genetic diversity.
OAmalOHopeO
C. If you combined the elements in the product of this reaction, what type of
reaction would it be? Hint: What is the reverse of the equation you just
balanced? (1 point)
Answer:
Reversible reaction
Explanation:
If the elements of the product combine together in a chemical reaction, this reaction is called reversible reaction because the reaction moves in backward or reverse direction. For example, if acid i. e. HCl combine with base i. e. NaOH which are the reactants, it produces two products salt (NaCl) and water (H2O). If salt (NaCl) and water (H2O) combine again with each other, it produces acid i. e. HCl and base i. e. NaOH, such type of reaction is called reversible reaction.
Solid waste material from waste water is called
Answer:
sewage sludge
Explanation:
The solid material waste from waste water is called sewage
sludge
Explanation:
Sewage sludge is the solid, semisolid, or slurry residual material that is produced as a by-product of wastewater treatment processes.
For this task, you will imagine that you are a reporter for a scientific magazine. Your task is to explain the process of protein synthesis to someone who does NOT have a science background. Therefore, the explanation needs to be in simple enough terms for anyone to understand. You will organize your article in the following way: Structure and Function of DNA and RNA Transcription and RNA processing Translation Protein modification (general) You must also include the following terms: Double helix Helicase Codon Polymerase 5’ cap Poly (A) tail Introns Exons Splicesomes rRNA, tRNA, Mrna Ribosomes Anticodons E site, P site, A site Initiation Elongation Termination
Answer:
Please find the explanation below
Explanation:
Our nucleus is made up of a genetic material called deoxyribonucleic acid (DNA), which is a double-helical structure that stores the genetic information needed for the optimal functioning of any organism. DNA, alongside RNA are nucleic acids that are composed of NUCLEOTIDES subunits. The nucleotide consists of a pentose sugar (deoxyribose in DNA and ribose in RNA), nitrogenous base and a phosphate group.
However, the genetic information stored in the DNA molecule needs to be expressed in order to form useful products (proteins). This genetic expression is done in two stages viz: transcription and translation. Transcription, which is catalyzed by an enzyme called RNA polymerase is the process whereby the information stored in the DNA is used to synthesize a mRNA molecule. However, this mRNA molecule is considered pre-mature until it is processed. RNA processing occurs in three stages viz: 5' capping, polyadenylation, and splicing.
5' capping involves adding a 5' cap to the marks molecule. Polyadenylation involves adding a poly(A) tail to the mRNA molecule while splicing is the removal of introns (non coding regions) with the aid of Spliceosomes and joining of the exons (coding region). After processing, the mRNA becomes matured and ready to be translated.
Translation is the process whereby the mRNA transcript is used to synthesize a protein molecule. It occurs in the ribosomes (organelles for protein synthesis, a complex of rRNA and proteins) where the mRNA is read in a group of three nucleotides called CODON. The reading is done by the Anticodon of a transfer RNA (tRNA), which is complementary to the codon.
Translation occurs in three stages: initiation, elongation and termination. The mRNA attaches to the P site of the ribosomes (initiation) where it is attached to by a tRNA's anticodon complementary to it. The anticodon carries the amino acid corresponding the codon and shifts to the A-site. The addition of amino acid to the polypeptide chain continues (elongation) until a stop codon is encountered, which signals the end of the translation process i.e. termination. This causes the polypeptide (protein) to be released from the E-site.
The synthesized protein undergoes packaging and modification in the Golgi apparatus.
Please help please ???? I need help lol
A student did an experiment with two identical fish tanks, Tank 1 and Tank 2. About 20 ml water purifier was added to Tank 1 and 10 ml
water punfier was added to tank 2. Tank 1 was heated to 88° F and Tank 2 was left at room temperature. The water purity of each tank was
tested every day in particles per liter. The purity was recorded over a period of 5 weeks in the table shown below.
Week Water Purity of Tank 1 Water Purity of Tank 2
12.6
12.6
13.7
13.9
14.3
14.4
15.7
15.8
17.6
17.6
Based on the table, which of these conclusions is correct?
a
Fish need 10 mL of water purifier to survive.
b
More purifier is needed to keep heated water clean.
с
Water purifier can help a fish survive longer.
d
Water purifier keeps fish tanks clearer for longer.
pleasee helppp !!
Answer:
a . Fish need 10 ml of water purifier to survive.
Explanation:
Fish need 10 ml of water purifier to survive because the data of 10 ml and 20 ml purifier is the same so it is recommended to use 10 ml purifier. First the data was same but by recording next week data, it shows slightly increase in the value of tank 2 while in the last week, both has the same value so we can concluded that by using 10 ml purifier is enough for the fish to survive.
Answer:
Its B/More purifier is needed to keep heated water clean.
Explanation:
which of the following MOST directly influences a measurable outcome in an experiment?
Answer:
Hello. You did not enter the answer options, but the factor that most directly influences a measurable result in an experiment is the manipulation of the variables.
Explanation:
In an experiment, the manipulation of variables becomes highly important so that it is possible to measure, that is, evaluate the result. This is because it is the variables that express values that represent the characteristics that are being analyzed and studied within the experiment. Therefore, the manipulation between them must be done in a very rational and balanced way so as not to modify the values shown by them, changing the data and generating false or immeasurable data.
You believe that the cytosolic protein p007 is involved in mediating growth hormone-stimulated proliferation in cells. You wish to establish a cell model using your cultured fibroblasts. Provide clear explanations to the following, each worth 2.5 pts each. a) Describe how you would transfect the growth hormone receptor DNA into your cells to create stable cell lines, and include a description of the benefits of using stable cell lines versus transiently transfected cell line. b) Describe how you would measure specific receptor binding of GH to your stable cell line. c) Describe how you would measure growth hormone-induced proliferation in your stable cell line. Make sure to include controls. d) Describe how you would use RNAi to demonstrate the requirement for p007 in growth-hormone stimulated proliferation. Make sure to include controls.
Answer:
Following are the answer to this question:
Explanation:
In option a:
There are many ways, which can be defined as follows:
It keeping cells "qualified," use heat shock and handle ions like Ca and ice incubating.It uses Micro-injection with DNA. It uses the biolistics or even the process of gene-gun.The stable cell charts indicate simple and definitive outcomes when their relationship to specific results. Moreover, relative to temporary cell lines, findings are more reliable and error-free. These lines also easily break and much less.
In option b:
Radio tests including linking tests could be used
The Ligand Binding Assays is an analysis, that is based on the binding of ligands to antibodies, or other macromolecules. Its existence and distance of formed ligand-receptor complexes are defined using a system of measurement that is usually electrical or fluorescent.
In option c:
The method for measuring the levels of cell growth is accessible and the Another way is to measure the metabolism within the same cell. So many color pigments were also accessible that can permeate an organism as well as react with some proteins as well as other factors, and that can effectively identify a color final product.
Throughout relation to the amount of metabolism exercise, cell proliferation could be evaluated by researching one or even more cell markings. The BrdU limited liability assessment is a very well-published illustration.
Its specific antibody can detect BrdU and high BrdUincorporations levels are linked to high levels of cell proliferation. Command cell without DNA receptor growth hormone.
In option d:
The cell growth will stop after each use of RNA interference ( RNAi). The p007 formation as well as the effect on growth caused by the intrusion will be a goal. If development is delayed effectively, the theory will be tested successfully to a cell without any of the required DNA. The RNAi is the free cell
What is the frequency of a wave that has a wavelength of .20 m and a speed of 22 m/s
Answer:
110 Hz
Explanation:
Find the frequency of the wave using the formula, frequency = speed / wavelength.
Plug in the speed and wavelength, and solve:
frequency = speed / wavelength
frequency = 22 / 0.2
frequency = 110
So, the frequency of the wave is 110 Hz
Which occurs when the body responds to the environment by maintaining a stable internal environment despite changing
external conditions?
spontaneous generation
homeostasis
growth and development
reproduction
Answer:
homeostasis
Explanation:
Homeostasis is the biological process by which living organisms maintain a stable internal environmetal condition despite changes in their external environment. Homeostasis is an important phenomenon for the optimal functioning of any living organism.
A vivid example of homeostatic process is the regulation of temperature in humans or some animals. Self-r regulating mechanisms help keep their temperature at a stable state irrespective of temperature changes in the external environment i.e. hot or cold external conditions. The steady state of internal temperature is very important for some physiological processes in living systems.
Answer:
B
Explanation:
How does meiosis differ from mitosis?
1) it decreases the amount of cells.
2) it increases a lot of DNA.
3) it reduces the amount of DNA
4) and increases the number of cells.
Answer: Cells divide and reproduce in two ways, mitosis and meiosis. Mitosis results in two identical daughter cells, whereas meiosis results in four sex cells. Below we highlight the keys differences and similarities between the two types of cell division.
I think its choice 4 :)
Explanation: Used a science book! :)
Answer:
4. It increases the number of cells.
Explanation:
"Acidic" is an appropriate description for four of the following. Which one is the exception?
A). Soup and ammonia
B). HCI
C). Excess hydrogen ions
D). The contents of the stomach
E). A pH less then 7
Answer:
E) A pH less than 7
Explanation:
if a solution has a higher concentration of hydronium ions than pure water , it has a pH lower than 7
Answer: e
Explanation:
I did the test
discuss the reaction in tricarboxylic acid cycle
The tricarboxylic acid cycle also known as the Kreb's cycle consists of eight cycle wherein a molecule of acetylCoA is used to produce three NADH, one FADH2 and one GTP/ATP molecule.
What is the tricarboxylic acid cycle?The tricarboxylic acid cycle is a sequence of reactions in which acetylCoA molecules from the glycolytic pathway are used to produce the reducing equivalents NADH ad FADH2 which are used to produce ATP in the electron transport chain.
The tricarboxylic acid cycle also known as the Kreb's cycle consists of eight cycle wherein a molecule of acetylCoA is used to produce three NADH, one FADH2 and one GTP molecule.
Learn more about tricarboxylic acid cycle at: https://brainly.com/question/6260517
#SPJ1
Restriction digest A:
ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC
How many bases are in the second fragment?
Answer:
This question seem incomplete
Explanation:
This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51
This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below
A ⇆ T
G ⇆ C
Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).
Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51
What is the fallopian tube fimbriae made of? Pls I need help asap
Answer:
The mucous membrane would be the answer
List three protozoan infections of the circulatory system that are transmitted by arthropods. Include the disease name, specific organism (genus species), vector that is the intermediate between hosts, and disease progress in humans.
Answer:
List three protozoan infections of the circulatory system that are transmitted by arthropods:
Malaria
Toxoplasmosis
Chagas disease (American trypanosomiasis)
Explanation:
Malaria is a prozotoan infection, that can be produced by several protozoan, in the genus Plasmodium. This Plasmodium infect red blood cells and the vector that trasmites it is the Anopheles mosquitoe. In this disease, red blood cells can have severe damage in different organs because of the hemolysis.
Toxoplasmosis is a disease caused by the protozoan Toxoplasma gondii. The main vector of them are domestic cats. When cats are infected, T. gondii oocysts is found in their feces and it can spread to humans. This disease is generally asymptomatic, except when the patient has AIDS or in pregnancy, which can be very dangerous and fatal.
Chagas disease, or American trypanosomiasis is caused by protozoan Trypanosoma cruzi and is generally transmitted to people thanks to the feces of triatomine bugs. Some of the acute symptoms include fever, vomiting, headache, and in severe cases people can develop a chronic disease. In the worst cases it can produce flaccid cardiomegaly (enlargement of the heart) leading to heart failure and death.
The first place that the reabsorption of water is not automatically coupled to the reabsorption of filtered solutes occurs in the PCT.
a. True
b. False
Answer:
False
Explanation:
The correct answer is false because Reabsorption of water and other filtered solutes like vitamins, sodium e.t.c. take place in the proximal convoluted tubules.
Reabsorption is when water and solutes in the PCT are removed and moved back into the blood and it's a process that take place through bulk transport.
The solutes and water are transported from the PCT to the interstitium and then move into peri-tubular capillaries and reabsorption in PCT is isosmotic i.e solutes have the same osmotic pressure.
Growers often wrap potted plants in plastic sleeves prior to shipping. If plants remain in these sleeves too long, their leaves curl and fall off. Imagine you are working at a garden center and have been asked to make a presentation to a local garden club. Unit 5 DQ Question: Explain the processes that may cause the leaves to drop and fall.
Answer:
Shock, age and climate.
Explanation:
The processes that may cause the leaves to drop and fall are shock, age and climate. The plants drop their leaves due to shock when they experience by transplanting from place to another. When the leaves get older having yellow colour so due to no function it falls. The climatic condition is also responsible for the dropping of leaves. Those plants which can't grow in cool season so when the winter comes they shed their leaves and wait for the summer season.
Put the following biological structures in the correct order of organization, from smallest to largest:
A. Gills, pillar cells, lamellae, fish, respiratory system
B. Pillar cells, lamellae, gills, respiratory system, fish
C. Pillar cells, lamellae, gills, respiratory system, cat
D. Lamellae, gills, respiratory system, fish, pillar cells
Answer:
B
Explanation:
Cats Dont have gills so rule out C. The body has to be the end so it would be B starting from Pillar cells to fish
Biological structures are arranged based on the level of the organization. The order of organization from smallest to largest is pillar cells, lamellae, gills, respiratory system, and fish. Thus, option B is correct.
What is the level of organization?
The level of organization is the arrangement of the structures based on the level of complexity. It starts from the most simple to the most complex structures. It starts with an atom and ends in an ecosystem.
Pillar cells are the simplest level that comprises the fundamental unit made of molecules. They together make the tissues or the lamellae in the fish. The tissues or the lamellae group together to make the organ and gills.
The gills combines with the other organs to make the organ system like the respiratory system, which together with various organ system makes the fish the makes a complete organism.
Therefore, the order of the organization starts with pillar cells and ends at fish.
Learn more about the level of organization here:
https://brainly.com/question/22991776
#SPJ5
On April 26, 1986, Reactor 4 at the Chernobyl Nuclear Power Station in Ukraine exploded, releasing radioactive isotopes into the air. The majority of the isotopes that were released and spreading thousands of miles were of the element iodine. As a class, discuss what endocrine glands would be most affected and how it would become apparent in the nearby population.
Answer:
In the given case, the thyroid gland will be affected the most due to the exposure of the element iodine. For the synthesis of thyroid gland hormone, T3 and T4 iodine is required. As the exposure of the radioactive iodine element is taking place, therefore, it will result in the deterioration of the thyroid gland. Radioactive iodine is generally used in the treatment of hyperthyroidism.
However, in normal individuals, the exposure of the radioactive iodine element results in a decrease in the level of thyroid hormones below the normal level due to the destruction of the thyroid cells. The symptoms seen can be neck tenderness, swollen salivary gland, and loss in body weight.
The thyroid gland will be mostly affected in this case. The element Iodine is
the major precursor which is involved in the formation of two hormones.
Thyroid hormonesTriiodothyronine (T3)Thyroxine (T4).When an individual is exposed to radioactive iodine , it alters the production
of the hormones which leads to series of effects such as:
Decreased metabolismLow body weightGoitre etc.Read more about Thyroid hormones here https://brainly.com/question/2469666
explain where the pericardium is found and what it does for the heart
Answer:
the pericardium is found in your heat Problems can occur when the pericardium becomes enflamed or fills with fluid.
The end result of a chemical reaction is always:
A. the formation of new kinds of elements.
B. the production of water molecules.
c. a substance that was not ope of the reactants.
ak
s
D. a molecule that does not have an electric charge.
Answer:
The formation of new kinds of elements.
When a chemical reaction is finished, a new type of element is made. because the chemicals couldn't react to eachother without making something new.
After the centromeres separate during mitosis, the chromatids, now called _______, move toward opposite poles of the spindle.
Answer:
Daughter chromosomes
Explanation:
Give four reasons why th toe operating system pivotal in teaching and learning
The correct answer to this open question is the following.
The four reasons why the operating system is pivotal in teaching and learning are the following.
1) Operating systems are the foundation of the computer. Without the operation system in place, you could not run any program.
2) The operating system presents an interface that allows users to perform many tasks at the same time, with all degrees of complexity.
3) The operating system permits the installation of all kinds of software so the user could work on practically anything.
4) Applications for sound, video, graphics, mathematics, and many other activities can be run due to the operating system.
In these times of digital education, the operation system of a computer allows users to do all the needed activities to fulfill the goals of teaching and learning. From video classes, team meetings, corporate dates, continuing training activities, and many more, the capacity of a good operating system is what makes it easy for you to accomplish your goals.
Where is DNA found in the cell??????
The DNA is found in the nucleus of the cell
Most adults should consume no more than 30 percent of their daily calories from fat. A person on a daily diet of 2,500 calories should get no more than how many calories from fat each day.
Answer:
750
Explanation:
30% of 2,500 is 750, therefore 750 calories is the maximum number one should get from fat each day.
Answer:
750 marry christmas break
A cross-sectional view of a log shows a concentric pattern. Which part of the stem gives rise to this pattern?
A cross-sectional view of a log shows a concentric pattern. Which part of the stem gives rise to this pattern?
B. Xylem
as it contribute for most of a tree's growth in diameter.
identify the following organism and state to which phylum it belongs
Answer:
it belongs to Coelenterata phylum.