What is the most valid conclusion regarding ocean depth temperature, based on the data? The temperature and salinity increase with increasing depth. The salinity increases as the depth goes closer to zero. The bottom of the ocean is frozen and salinity levels are low. The ocean temperature never rises above 10°C and salinity remains constant.

Answers

Answer 1

The most valid conclusion concerning ocean depth temperature is B. The salinity increases as the depth go closer to zero.

 

Effect of Salinity on Water Depth

Decreasing ocean temperature increases ocean salinity. These occurrences put pressure on water as the water depth increases with decreasing temperature and increased salinity.

 

What is Ocean Salinity?

Ocean Salinity refers to the saltiness or amount of salt dissolved in a body of water. The salt dissolution comes from runoff from land rocks and openings in the seafloor, caused by the slightly acidic nature of rainwater.

 

Thus, the most valid conclusion one can draw regarding ocean depth temperature is Option B.

Learn more about ocean depth temperature and ocean salinity here: https://brainly.com/question/1512203 and https://brainly.com/question/10335431


Related Questions

Calcite is created by combining:
a. calcium, carbon, and nitrogen
b. calcium, carbon, and oxygen
C. calcium, oxygen, and nitrogen
d. calcium, oxygen, and hydrogen
Please select the best answer from the choices provided
Ο Α
O B
O C
O D

Answers

Answer:

Calcite is created by B: Calcium, Carbon, and Oxygen

current definition

please help​

Answers

Answer: now or like presently

Explanation:

I dont know

Select all of the following that correctly describe the Streptococcus genus
- Gram Negative
- Gram Positive
- Cocci
- Bacilli
- Tetrads
- Sarcinae
- Strepto
- Staphylo
- Fastidious
- Can grow in salt
- Can grow in acid
- Normal flora of the skin

Please explain if possible!

Answers

Gram Positive :

Streptococcus is a genus of spheroidal bacteria that belongs to the Streptococcaceae family.

The bacteria's distinctive clustering in chains that resemble a string of beads is referred to as streptococcus ("twisted berry"). Microbiologically, streptococci are classified as gram-positive and nonmotile. Cocci :

Streptococcus is a genus of gram-positive coccus (plural cocci) or spherical bacteria belonging to the Streptococcaceae family, which is part of the Lactobacillales (lactic acid bacteria) order in the Firmicutes phylum.

Gram-positive cocci are a diverse collection of bacteria that have a similar shape. Sarcina cells, for example, are grouped in cubical pockets. Streptococcus spp. resemble a string of pearls. Staphylococcus species do not divide on a regular plane.Bacilli :

Streptococcus bacteria subdivide into Strep. pyogenes (Group A), Strep. agalactiae (Group B), enterococci (Group D), Strep viridans, and Strep pneumonia. Gram-positive bacilli (rods) subdivide according to their ability to produce spores.

If complete hemolysis of the blood cells is observed, the streptococci are classified as beta'hemolytic. M protein is considered the most important virulence component of S. pyogenes. Antibodies that react with M protein are produced in response to infection. A prospective antistreptococcus vaccination based on the M protein or a derivative of it is being studied.Tetrads :

The tetrad occurs in a subgroup of the cocci where the bacterium divides in two planes to form a square of four bacteria called a tetrad. Some examples of tetrad-forming bacteria are the lactic acid bacilli, Aerococcus, a urinary tract pathogen and Pediococcus and Tetragenococcus, both of which ferment foods.

Tetrads are groups of four cocci that are positioned in the same plane (e.g. Micrococcus sp.). Sarcina is a bacterial genus that consists of eight cocci arranged in a cuboidal pattern (e.g. Sarcina ventriculi).Sarcinae :

Sarcina is a Gram-positive cocci bacterium genus belonging to the Clostridiaceae family. After the cuboidal (2x2x2) cellular affiliations they create during division along three planes, the genus gets its name from the Latin word "sarcina," which means "pack or bundle."

Diplococci are pairs of cocci; streptococci are rows or chains of such cells; staphylococci are grapelike clusters of cells; sarcinae are packets of eight or more cells; and tetrads are groups of four cells in a square layout. Variations in the reproductive mechanism of bacteria result in these distinctive groups.Strepto :

a combining term that means "twisted" and is used to make composite words: streptococcus

Streptococcus- a spherical or oval bacteria of the genus Streptococcus that occurs in pairs or chains and is harmful for humans, causing scarlet fever, tonsillitis, and other diseases.Fastidious :

Streptococcus is a genus of gram-positive cocci that are organized in chains. These are fastidious bacteria that need blood or serum added to their culture medium. They are non-motile and do not produce spores. Most are facultative anaerobes, which means they can grow on enriched media.

Streptococcus pyogenes - it's a nutrient-concious bacteria that ferments glucose to make lactic acid and has stringent growth needs. This section explains the growth and maintenance of S. pyogenes to help in the research of this organism.Can Grow In Salt :

On the basis of their salt tolerance, the salt tolerance test is used to identify enterococcal group D Streptococcus. Several bacteria, notably viridians streptococci, have been classified based on their capacity to thrive in the presence of a varying quantity of sodium chloride (NaCl).

The non-beta hemolytic streptococci (viridans, and non-enterococcal group D) do not grow in 6.5% NaCl broth; but some of the beta-hemolytic strains may grow in the broth.Can Grow In Acid :

Some streptococci can create acids, grow in acidic surroundings (acidophilia), make acids at low pH levels (aciduric capability), and synthesis intracellular and external polysaccharides.

Dental caries is associated mainly with acid production at pH values below 5 by nongrowing bacteria in dental plaque. Oral streptococci cannot grow at pH above about 5, although they can lower the pH of suspensions or biofilms to values of 4 or lower.Normal Flora of The Skin:

Bacteria make up the vast bulk of typical flora. Skin and nasal membranes are typically infected with Staphylococcus epidermidis.

Staphylococcus epidermidis is a Gram-positive bacterium that belongs to the Staphylococcus genus, which has around 40 species. It is found in marine sponges and is part of the normal human flora, most usually the skin flora and less commonly the mucosal flora.

Sources: ( https://www.cdc.gov/ )

In which of these does a chemical change take place?
mixture
compound
solution
none of the above

Answers

Mixture because it’s reacting to a chemical change

What causes STI's & how are they transmitted?

Answers

Answer

I think the cause would be unprotected sex and well that would also be how its transmitted.

Explanation:

in this investigation the independent (or tested) variable is a. the speed of the rat b. letting the rat 10 times c. adding the rat's favorite treat at the end d. using the same maze

Answers

The cas because they are not vegan and they are not good enough for me and I’m not like that what

An area that has been sampled to have a large population of organisms. Does this represent high biodiversity? Why or why not?

Answers

An area that has been sampled to have a large population of organisms is

regarded as having a high biodiversity.

Biodiversity is defined as the condition in which areas have a high amount

of plant and animal species present there. Any place with a large population

of organisms is said to have a high biodiversity while places with low

population of organisms have low biodiversity.

The stated facts therefore makes an area that has been sampled to have a

large population of organisms represents high biodiversity.

Read more on https://brainly.com/question/18727662

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

4. What is the molecule used by cells to store energy?

Answers

Answer:

What is the molecule used by cells to store energy?

Explanation:

Adenosine 5'-triphosphate, or ATP, is the principal molecule for storing and transferring energy in cells. It is often referred to as the energy currency of the cell and can be compared to storing money in a bank.

Did you know that your bum can make three states of matter? Solid, Liquid, ad Gas

Answers

Answer:

Nope

Explanation:

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

thrips are insects that feed on rose

Answers

Answer:

????????????????????????

As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably?

Answers

Use resources responsibly and don’t waste resources for things you don’t need.

Answer it correctly please

Answers

The first. One will be Guard cell

4. How does the life of a sperm cell vary among the mosses, ferns, gymnosperms and angiosperms?

Answers

Answer:

They evolved on land to begin with from earlier now extinct groups groups so there was no need to adapt to life on land, other than to adapt to different terrestrial environmental pressures. Land can be everything from next to a river to a hot desert to rocks to Antarctica, and plants grow in all those places.

As well, there are thousands of species that are floating aquatics or submerged aquatics, including many ferns, and even some gymnosperms grow as marginals, and many species of angiosperms, mosses, ferns, and even some gmnosperms grow as epiphytes, or as parasites, or other ways.

Why are there not many vaccines for fungal & parasite disease as we have for viral and bacterial disease?

Answers

Answer:

it is very easy to kill the pathogen by vaccination but it is very difficult to detoxify the toxins produced in the host.

Explanation:

Hopefully this helped!

Most Americans/Canada say they hope to die __________.

Answers

i think they hope to die at home

g The hormone __________ induces is lipolysis, whereas the hormone __________ inhibits the process. insulin; norepinephrine glucagon; insulin insulin; glucagon epinephrine; adrenocorticotropic hormone epinephrine; glucagon

Answers

1)noradrenaline
2) adenosine

7. In an ecosystem, which is the most likely reason for an increase in the producer
population if there is an increase in the carnivore population?

Answers

If there is an increase in coronavirus that means that the animals that eat the producers will be less which causes more producers

1. The burning of fossil fuels contributes to all of the following ecological problems except for:
A. ozone depletion
B. global warming
C. acid rain
D. air pollution

Answers

The burning of fossil fuels does not contribute to ozone layer depletion.

The burning of fossil fuels leads to the release of gases such as oxides of nitrogen, sulfur, and carbon as well as particulate matter such as smoke, ashes, etc.

The oxides released from fossil fuel burning can cause global warming (carbon dioxide), acid rain (SO2), and air pollution (particulate matter).

Ozone layer depletion is caused by pollutants such as halocarbons, solvents, etc.

More on ozone layer depletion can be found here: https://brainly.com/question/1285852?referrer=searchResults

Which phrase best describes what a soil horizon is?
A the bottom layer of a soil profile
B each layer of a soil profile
C the place where two soil profiles meet
D the place where a soil profile meets bedrock​

Answers

Answer:

I suppose the answer is C

Each layer of a soil profile best describes a soil horizon.

What is a soil horizon?

A soil horizon is a layer of soil within a soil profile. A soil profile is a vertical section through the soil, showing the different layers, or horizons, of soil that make up the soil. Soil horizons are typically classified based on their physical, chemical, and biological properties, and they can vary in thickness and composition depending on factors such as climate, vegetation, and the underlying geology.

Some common soil horizons include the surface horizon, the subsoil, and the parent material.

Learn more about soil horizon, here:

https://brainly.com/question/2416348

#SPJ5

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

2. In IVF the fertilization is : a) Always External b) Always Internal c) Can be any one of the two d) Fertilisation does not occur ​

Answers

Answer:

option a) is correct.

Explanation:

in IVF the fertilisation is always external.

IVF involves combining eggs and sperm outside the body in a laboratory.

Which of the following does NOT happen during the light-dependent reactions of
photosynthesis?
ATP is produced
Oxygen is produced
Glucose is produced
NADPH is produced

Answers

Answer:

Glucose

Explanation:

Only glucose is produced in the light independent stage of the reaction

what is chloride shift ​

Answers

The chloride shift is an exchange of ions that takes place in our red blood cells in order to ensure that no build up of electric change takes place during gas exchange.

1. What is the major source of energy for the brain

Answers

Explanation:

glucose

The mammalian brain depends on glucose as its main source of energy. In the adult brain, neurons have the highest energy demand [1], requiring continuous delivery of glucose from blood.

hope its helpful to you #

The major source of energy for the brain is glucose. Metabolism of glucose provides energy to the brain.

What is the brain?

The brain is a body part that operates the various functions of the body. It is present in the head of the body. It is divided into two parts, the left brain, and the right brain.

Energy is something that is produced by the metabolism of food. Energy7 is required to carry out all the processes of the body. To walk, run, work, eat, everything requires energy.

The main source of the energy in animals and plants is glucose. The food we eat converts into energy by the process of respiration. The energy is transported into all parts of the body by blood circulation.

Thus, glucose is the major source of energy for the brain.

To learn more about energy, refer to the link:

https://brainly.com/question/781388

#SPJ2

Which of the following statements is FALSE?

Answers

Answer:

I'll wait for some possible answers...

Answer the following qs :
1- Mention three uses or benefits of fungi ?

Answers

Answer:

Humans use fungi for many purposes, including as food or in the preparation of food. Humans also use fungi for pest control. In addition, fungi can be used to produce citric acid, antibiotics, and human hormones. Fungi are model research organisms as well.

Explanation:

Humans use fungi for many purposes, including as food or in the preparation of food. Humans also use fungi for pest control. In addition, fungi can be used to produce citric acid, antibiotics, and human hormones. Fungi are model research organisms as well.

How can carbon can be stored for a short time in the natural cycle?

Answers

Answer:

The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again. Most carbon is stored in rocks and sediments, while the rest is stored in the ocean, atmosphere, and living organisms.

What does fat become after the chemical process?

Answers

Answer:

uR mOtHeR

Explanation:

dUnno im sorry and very bored

After we eat food, the digestive system uses enzymes to: break proteins down into amino acids. turn fats into fatty acids. turn carbohydrates into simple sugars (for example, glucose)

help please asap!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Basidiomycotes

the second one

Explanation:

Other Questions
Will mark brainliest and 30 points!! thankyouWhich choice best supports an interpretation that like the child, the adult narrator feels compelled to speculate about his mother?A."why this picture" (paragraph 3)B. "Courage alone could not get me past that heavy door (paragraph 4)C. But for a four-year-old, everything is sacred and ordinary (paragraph 5)D. the metaphors of her faith were also the metaphors of medicine (paragraph 5)E. When are you coming? (paragraph 5) A 0.24 kg mass with a speed of 0.60 m/s has a head-on collision with a 0.26 kg mass that is traveling in the opposite direction at a speed of 0.20 m/s. Assuming that the collision is perfectly inelastic, what is the final speed of the combined masses? what time are the kennedy center honors on tonight Find three consecutive odd integers whose sum is 45 What is the following sum in simplest form? StartRoot 8 EndRoot 3 StartRoot 2 EndRoot StartRoot 32 EndRoot 3 StartRoot 8 EndRoot 3 StartRoot 2 EndRoot 5 StartRoot 42 EndRoot 9 StartRoot 2 EndRoot 5 StartRoot 2 EndRoot StartRoot 32 EndRoot. I am going to order that soup again, it is the best soup I've ever had!Which revision corrects the sentence?a) I am going to order that soup again; it is the best soup I've ever had!Ob) I am going to order that soup again it is the best soup I've ever had!c) I am going to order that soup again! it is the best soup I've ever had!Thingd) I am going to order that soup again. It is the best soup, I've ever had!Bc An artificial soccer pitch is 91 meters long and 43 meters wide. If the cost of the pitch is AED 20 per square meter. What is the cost of installing the pitch???? Why might pork barrel spending be popular with constitution?Plz help meeee Marshall wants to buy a picture frame. The original price is $15,How much will Marshall pay if he buys it during the sale?SALE25% offoriginal price the ratio to boys to girls in sixth grade is 5:3 if their are 400 sixth graders how many boys are their How many moles are there in 10 dm3 of sulfur dioxide gas What role do plants play in reducing carbon dioxide in the atmosphere? How can plants play a role in combating climate change? Please help!!? ASAP Men to women working for a company ie 2 to 3 if there are 80 employees total how many men work for the company A water tank is filled at a constant rate. After 36 minutes, there are 648 gallons of water in the tank. How many gallons of water flowed into the tank each minute? Use the model. Please help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! How do depreciating assets hurt your financial health? a. They decrease your net worth. b. They increase your discretionary spending. d. They lower your FICO score. c. They increase your equity. Chlorophyll creates___and recycle oxygen. Read the excerpt from "Tools of the Spymaster. " General Clinton, concerned about what General Howe was planning and doing, made use of a mask to write a secret message in a letter to General Burgoyne. Before writing the letter, Clinton had placed an hourglass-shaped mask on a piece of paper and then had formed the secret message within that shape. The unmasked letter had enough false information in it to fool any American who happened to see it. But when Burgoyne viewed the letter with the mask, he read Clinton's view of the real situation: Howe has made a bad move; I don't have enough men to do anything about it. Which statement best expresses the central idea of the excerpt? Generals were able to send secret messages to each other using a mask. General Howe failed to help the other generals defeat the Americans. The British were better at using codes than the Americans. False information in a letter could cause problems for the Americans. are kay and peter able to provide Deming a better life than polly would have been able to provide him Which of the following is the contrapositive of the conditional below?If 3 + 4 = 6, then 2 5 = 10.If 2 5 = 10, then 3 + 4 = 6.If 2 5 10, then 3 + 4 6.If 3 + 4 6, then 2 5 10.If 3 + 4 6, then 2 5 = 10.