Answer:
Biodiversity is defined as “the variability among living organisms from all sources including, inter alia, terrestrial, marine and other aquatic ecosystems and the ecological complexes of which they are part; this includes diversity within species, between species and of ecosystems.” The importance of this definition ...
List 3 variable that Anurag should keep the same
Answer:
seawater ,upside-down funnel and seaweed
Explanation:
g dGDP is made from ________ by the ribonucleotide reductase. This enzyme is inactive when ______ is bound to its master regulatory pocket.
Answer:
1. GTP dephosphorylation
2. hydrolyzed or removed
Explanation:
GDP, (Guanosine diphosphate) is a biological term, that is made of composition including pyrophosphate group, a pentose sugar ribose, and the nucleobase guanine and it is made from GTP ( Guanosine triphosphate ) dephosphorylation by the ribonucleotide reductase. This enzyme is inactive when hydrolyzed or removed, and then eventually bound to its master regulatory pocket.
what is economic importance of honey bee
Answer:
1. They are one of the most important pollinators for both wild and domestic plants.
2. Their most important product, honey, is used in baking, meals, and drinks. It is also used for shooting sore throat and suppressing the urge to cough. It also reduces the ravages of the aging process and it is an antioxidant that may help in the prevention of cancers. It is a mild salve for treating skin conditions and abrasions.
3. Propolis, a material made when bees mix resin with honey, is used to treat minor wounds and abscesses.
4. Bee pollen which are pollen balls are excellent source of amino acids and vitamins for humans.
5. Royal jelly, which is a milky secretion secreted by worker honey bees is used for asthma, hay fever, pancreatitis, insomnia, premenstrual syndrome, and other diseases.
A mutation causes a sequence of DNA that has the nucleotides TTG to be changed to TCG. The resulting protein has a different sequence of amino acids. Which type of mutation is this? a. missense b. nonsense c. silent d. frameshift
Answer:
The correct answer would be - a) missense.
Explanation:
A missense mutation is a type of a point mutation that is caused by the alteration or change in the a nucleotide of a triplet codon in a DNA sequence. This leads to a altered mRNA and incorporate different amino acid and ultimately different protein than usual.
This type of mutation can produce non functional protein by translation in most of the case and did not make any big change in the individual.
Thus, the correct answer would be - a) missense.
Answer:
A. Missense
Explanation:
edge 2020 100%
explain why germinating seeds were used in this investigation cellualr respiration
Explanation:
As oxygen is consumed to provide energy, germinating seeds release carbon dioxide. ... HYPOTHESES: The experimental hypothesis is that germinating seeds will show a greater rate of respiration than control glass beads. Additionally, that at higher temperatures, the rate of cellular respiration in the seeds will increase.
Protein that accounts for why water can cross a membrane more quickly than expected is Group of answer choices
Answer:
The correct answer is "Aquaporin".
Explanation:
The missing options of this question are:
A. ATP synthetase
B. Aquaporin
C. The sodium-potassium pump
D. Integrin
The correct answer is option B. "Aquaporin".
Aquaporins are microscopic channels that belong to a family of proteins that form pores. Aquaporins are also known as water channels for its specific biological role of allowing water to cross the cell membrane. The presence of aquaporins explains why water can cross cell membrane more quickly than expected, since they function as regulators of water transference.
Which of the following does NOT describe rotation?
spin
counter-clockwise
flip
clockwise
turn
Answer:
I think it's flip if not turn
Which multicellular clade arose first in the history of life on Earth? View Available Hint(s) Which multicellular clade arose first in the history of life on Earth? Land plants Animalia Fungi Protista
Answer:
Protista
Explanation:
Protista is the first class of multicellular organism that arose in history. The first of this member is cyanobacteria.
Cyanobacteria is large group of photosynthetic organism that produce their own food by using light energy from sun and carbondioxide.
The first evidence of multicellularity is from cyanobacteria-like organisms that lived 3–3.5 billion years ago.
They help to can convert inert atmospheric nitrogen into an organic form, such as nitrate or ammonia.
The multicellular clade that appeared first in the history of life on Earth is ANIMALIA.
The Kingdom Animalia (also known as Metazoa) is a clade that consists of multicellular-heterotrophic organisms, which cannot synthesize their own food.
It has been estimated that the first animals evolved around 800 million years ago.
The first animals that appeared on the Earth were sponges or sponge-like animals.
In conclusion, the multicellular clade that appeared first in the history of life on Earth is ANIMALIA.
Learn more in:
https://brainly.com/question/9031447?referrer=searchResults
if a wild game animal is slaughtered under usda guidelines can it be prepared and served A:No. A wild game animal can never be served B:Yes a wild game animal can be served C:No wild game animals cannot be eated D:Maybe if you seek usda permission
Answer: C:) No wild game animals cannot be eated
Explanation: hope that helps (:
What part of the brain is known as the pleasure center?
A. Brain stem
B. Hypothalamus
C. Thalamus
D. Midbrain
SUBMIT
Answer:
B. Hypothalamus
Explanation:
The hypothalamus contains the pleasure center of the brain, the nucleus accumbens. The hormone dopamine is released from this part of the brain in response to or anticipation of pleasurable activities such as eating good food, monetary rewards as well as when taking psychoactive drugs.
The release of dopamine affects other feelings such as happiness, focus, being alert as well as staying motivated. it also affect some voluntary actions as well.
Constantly seeking out activities that stimulate dopamine release may lead to addiction to such activities as in drug addiction.
Why are G protein only found in Eukaryote cell ?
Answer:
they bind to protein-coupled transmembrane receptors with higher complexity than those found in prokaryotes
Explanation:
G-proteins are proteins found inside the cells that function as molecular switches which are activated by binding to guanosine triphosphate (GTP), while they are inactive by binding to guanosine diphosphate (GDP). The G-proteins bind to G-protein-coupled transmembrane receptors (GPCRs) in the cytoplasmic region. The GPCRs are a very diverse group of proteins that are activated by extracellular molecules ranging from small peptides to large proteins, including pheromones, neurotransmitters, light-sensitive compounds, etc, thereby allowing them to respond to diverse stimuli from the extracellular environment. In consequence, it is reasonable to suppose that the signaling pathways in which G proteins are involved have a higher complexity level than those observed in primitive prokaryotic organisms.
Which of the following is true?
a. Extinctions of past species has happened gradually and on a small scale.
b. Bacteria represent a newer form of life, not present during the early prehistory of Earth.
c. Most organisms present early in Earth's prehistory were more complex than modern organisms.
d. Species on Earth today are but a fraction of all species that ever lived.
e. The number of species existing at one time has decreased throughout history.
Answer:
D
Explanation:
So many species on the Earth have gone extinct throughout it's years. Many species have died out over the 4.543 billion years that the earth has existed, and new species are introduced throughout the decades whilst some fade out.
which of the following would differ if you compared the same reaction taking place with and without an enzyme
a. the chemical energy of the reactants
b. the chemical change of the product
c. the energy required to the reaction
Answer:
The correct answer is - option C.
Explanation:
Chemical energy is the energy that every substance or chemical have and its not affected by the presence or absence of the enzyme, while the activation energy is the required energy to initiate for a chemical reaction. If the energy of the chemical reaction is less than the activation energy reaction will not take place.
Presence of a enzyme lowers the amount of the energy for the initiating the reaction which is activation energy and the chemical reaction takes place.
Thus, the correct answer is - option C.
DNA is negatively charged. Therefore, it is
O hydrophilic
O hydrophobic
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG
Answer:
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
Explanation:
The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20 nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:
Schematically:
The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:
5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'
The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:
3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'
Biologists designed an experiment to test the effects of compost on the development of root crops
Answer:
The crop has good yield because Compost has a good effect on root crops.
Explanation:
Compost has a great effect on the development of root crops such as onion, potato, garlic and ginger etc. Compost provide nutrients to these crops as well as soften the soil due to which they grow rapidly. It also improved ventilation, soil structure and soil texture which is very necessary for the crop. Due to ventilation, oxygen gas is available to the roots which increases growth and yield of these crops. Compost also retain water and nutrients so they are available to the roots. So those plots where compost is applied observed increase in yield as compared to other plots.
define factors affecting enzyme action:temperature
Answer:
I am secondary level student and this doesn't belongs to my coure till yet however..i have written this through google.....you may search there as well..
Explanation:
Enzyme activity occurs within a narrow range of temperatures compared to ordinary chemical reactions. As you have seen, each enzyme has a certain temperature at which it is more active. This point is called the optimal temperature, which ranges between 37 to 40C°...
what is a radical a group of ions
Answer:
A radical is a group of atoms of elements carrying a charge. radicals or ions are formed by gaining or loosing ions. positive radical ions are called radical cations whereas negative radical ions are called radical anions.
hope this helps you u :)
What is the process of
evaporation?
A. The process in which plants release vapor into
the atmosphere
B. Any process that returns water from the
atmosphere to the earth
C. The process in which liquid water turns to
water vapor
Climate change and succession both result in a change to the ocean ecosystem. What is succession?
a. Succession is a gradual change to ocean temperatures.
b. Succession is a gradual change to ocean communities.
c. Succession is a rapid change in ocean temperatures.
f
d. Succession is a rapid change to ocean communities.
Answer:
b. Succession is a gradual change to ocean communities
Explanation:
An ecosystem can undergo changes in it's structure and composition over a particular period of time. This term is called ECOLOGICAL SUCCESSION. Succession is the gradual change that occurs to a community over time. Succession is of two types; primary and secondary succession.
According to the question, climate change and succession are causes of change to the ocean ecosystem. Hence, succession there represents the gradual change that occurs to the structural composition of ocean ecosystem over time.
Answer:
The answer is B - Succession is a gradual change to ocean communities
Explanation:
Think of primary and secondary succession, these processes take time.
Which is NOT a function of magnesium in the body?
znutritio acting as a cofactor for enzyme systems in the Irody
regulating bone and mineral status
protecting teeth from acid-forming bacteria
making up one component in bone mineral
Answer: I think it is the third one which states, "Protecting teeth from acid-forming bacteria".
Explanation:
The pygmy shrew is the smallest mammal in North America. However, when comparing the amount of
food eaten to its body weight, the pygmy shrew eats more food than any other mammal. It will
consume two to three times its own body weight in food daily. One explanation is that the pygmy
shrew uses energy at a high rate. In fact, its heart beats over one thousand times per minute.
What is the best explanation for what happens to the food's mass and energy when it is consumed by
the pygmy shrew?
A. The mass is mostly excreted as waste. The
energy is burned up and destroyed by the
pygmy shrew's high rate of cellular respiration.
B. The mass is all used for creating new mass in
growth. The energy is stored, used in cellular
respiration, or lost to the environment as heat.
C. The mass is used for growth, stored, or excreted
as waste. The energy is stored, used in cellular
respiration, and lost to the environment as heat.
D. The mass is used for growth, stored, or excreted
as waste. The energy is burned up and
destroyed by the shrew's high rate of cellular
respiration
Answer:
C. The mass is used for growth, stored, or excreted
as waste. The energy is stored, used in cellular
respiration, and lost to the environment as heat.
Explanation:
I got it right on the quiz.
Mass used for growth, stored or excreted as waste. Energy is stored that is used in cellular respiration which is lost to the environment in the form of heat. So, the correct option is (C).
How Pygmy shrew uses its food for energy?The pygmy shrew has a large appetite which is a result of small body mass, rapid heat loss and high metabolic rate. It is kept in captivity which provides some idea of the energy requirements of the species.
The pygmy shrew has such a high metabolism that it must eat at least every 30 minutes otherwise it will die. This can be explained by food mass and energy is that due to very high metabolism most of the food mass which is rapidly used up to form shrew, and a large proportion of the food is lost from the body surface because of its very small size.
The combination of these two factors are
1. A very high metabolism which is rapidly utilizes food material, and generates large amounts of heat in a very short period of time.
2. Very small size due to which high surface area to volume ratio leading to heat loss.
Thus, Mass used for growth, stored or excreted as waste. Energy is stored that is used in cellular respiration which is lost to the environment in the form of heat. So, the correct option is (C).
Learn more about Metabolism, here:
https://brainly.com/question/29763323
#SPJ2
what is angiology????
Explanation:
Angiology is the medical specialty dedicated to studying the circulatory system and of the lymphatic system, i.e., arteries, veins and lymphatic vessels. In the UK, this field is more often termed angiology, and in the United States the term vascular medicine is more frequent
Answer:
- study of blood vessels and lymphatic system..
Explanation:
this is the medical term...is the study of blood vessels and lymphatic system.
Which location is least likely to experience a volcanic eruption? Α. an island hot spot, such as the island of Hawaii B. Hamilton County on the plains of central Texas с. a convergent boundary, as in the Ring of Fire D a volcanic island arc, such as the Aleutian Arc in Alaska
Answer:
i think that the answer is B. Hamilton County on the plains of central Texas i took the test
Explanation:
Hamilton County on the plains of central Texas is least likely to experience a volcanic eruption. Therefore, option (B) is correct.
What are volcanoes?Molten rock and gases stored under the surface erupt through a volcano, generating a hill or mountain.
Active, inactive, or extinct volcanoes. Active volcanoes are likely to erupt again. Dormant volcanoes may erupt again. Extinct volcanoes won't erupt.Magma collects inside active volcanoes. The magma chamber's pressure forces it through rock channels and onto the planet's surface.
Volcanic eruptions can be violent or slow-moving. Volcanoes erupt through vents on the sides or a primary entrance at the top. The volcano's morphology depends on eruption rate and magma chemistry. Land and sea volcanoes exist. As lava cools and hardens, underwater volcanoes build mountains and ranges. When volcanoes rise above the ocean, they create islands.
Learn more about volcano, here:
https://brainly.com/question/18058649
#SPJ5
explain what perlemoen are?
Answer:
Also known as "abalone" which is a
Explanation:
Answer:
any of various edible marine gastropod mollusks of the genus Haliotis
Explanation:
hope this helps
a body may have zero velocity even though its speed is 10m/s. give reason.
Explanation:
because speed is time rate at which an object is moving along a bath, while velocity is the rate and direction of object's movement .
What are two major drivers of surface ocean current and deep ocean current? 1. Surface ocean current 2. Deep ocean current The choices are: A. Differences in water density, resulting from the variability of water temperature and salinity B. Global wind systems
Answer:
1-B 2-A
Explanation:
this is because the wind blowing over the water causes motion whereas deep water is effected by Differences in water density, resulting from the variability of water temperature and salinity
A layer of cells called the endodermis surrounds the stele. Xylem is found towards the center of the stele and phloem towards the outside of the stele. 18) How does this compare to their arrangement in the stem? 19) The meristematic region is protected in the root by the presence of a root cap. How is the meristematic region protected in the stem tip? 20) In which of these regions would you expect to find the specialized cells of vascular tissue? 21) In which of these regions are the cells genetically identical? 22) Why?
Answer:
Epidermis layer is responsible for the protection of meristematic region.
Explanation:
Meristematic region is protected in the stem tip by epidermis which consist of dead layer of cells. Epidermis is the outer layer of stems, leaves, flowers and fruits which is responsible for the protection of inner part from damage. Vascular bundle such as phloem present near the boundary of the stem while the xylem is present in the inside of the stem. In the inside layer of the stem, all the xylem cells are genetically identical while the layer that is present at the edge of the stem is phloem in which all the cells are genetically identical to each other.
the origin of a muscle is generally
explain the question more
Answer: The stable and proximal attachment
Explanation:
When sweat cools on the skin, removing heat and cooling the body, what process is occurring? A. Parasympathetic nerve conduction B. Respiration C. Homeostasis D. Dehydration
Explanation: it has to be C because i got it right on my test