Which of the following decreases when credited?
Revenue
Inventory
Wages payable
Loans payable

Answers

Answer 1
Revenue decreases with Dr.
Inventory decreases with Cr.
Wages Payable decreases with Dr
Loans Payable decreases with Dr

So only inventory decreases with Cr

Asset has a normal balance of a Dr
Liabilities have a normal balance of a Cr
Revenue has a normal balance of a Cr

Related Questions

Discussion 3 - Fiat Money vs Bitcoin
Must post first.
Context Information: Money is anything that is accepted in exchange for goods and services or for the payment of debts. Our current form of money, the dollar, is considered Fiat Money, because it does not have any intrinsic value but is accepted as money because the US government has made it legal tender. The Fiat Monetary system is regulated by the Federal Reserve (The Fed) which is the United States Central Bank. The Fed regulates financial institutions such as banks, and issues the currency. In other words, the Fed controls the amount of money in circulation. It can increase it, or decrease it. This feature makes the Fiat Monetary system a centralized system. In contrast, Bitcoin is a consensus network that enables a new payment system and a completely digital money. It is the first decentralized peer-to-peer payment network that is powered by its users with no central authority or middlemen. From a user perspective, Bitcoin is pretty much like cash for the Internet. Nobody owns the Bitcoin network much like no one owns the technology behind email. Bitcoin is controlled by all Bitcoin users around the world.

Instructions and Steps:

1. Review the Ongoing Discussion Topic General Instructions > Select this link to Open

2. Access this introductory video on blockchain and cryptocurrencies.



TEDInstitute. (2017, September 22). Blockchain and the Middleman | TED Institute. [Video].



3. View the following TED Talk (video presentations). As you watch the video, take notes of any relevant information.



TEDx. (2020, January 10). What is Money? And Could Bitcoin Be the Best One? | Jad Mubaslat. [Video].

4. In 500 words or more produce an original post that answers the following questions:

According to Jad Mubaslat what are the benefits of a decentralized currency like Bitcoin?

If you had to choose one, which system (centralized fiat money or decentralized Bitcoin) would prefer to have as a form of currency? Explain your rational with examples.

Answers

The essay based on Jad Mubaslat that are the benefits of a decentralized currency like Bitcoin is given below

The benefits of a decentralized currency like Bitcoin

According to Jad Mubaslat, the benefits of a decentralized currency like Bitcoin are numerous. One of the main benefits is that it eliminates the need for intermediaries such as banks, which reduces the cost and time of transactions.

Furthermore, Bitcoin is transparent and has a fixed supply, which makes it less susceptible to manipulation or inflation. The transparency of the system allows for greater accountability and reduces the likelihood of fraud. The fixed supply also helps to prevent hyperinflation, which can occur when governments print excessive amounts of money, thereby reducing its value.

In terms of choosing between the two systems, I would prefer a decentralized system like Bitcoin. The benefits of a decentralized system far outweigh those of a centralized system. Centralized systems like the Fiat Monetary system, which is regulated by the Federal Reserve, can be manipulated by the government and the central authority.

In addition, the centralized nature of the Fiat Monetary system makes it easier for governments to manipulate the economy. For example, the Federal Reserve can increase or decrease the money supply to control inflation, which can have unintended consequences for the economy and the average citizen.

In conclusion, while there are benefits to both centralized and decentralized systems, I believe that a decentralized system like Bitcoin offers greater security, transparency, and control for users. With its numerous benefits, it is clear that Bitcoin is an innovative and promising solution for a modern currency system.

Learn more about Bitcoin from

https://brainly.com/question/9170439
#SPJ1

write the difference between crucial aming get profit maximization and sharing the market​

Answers

Crucial gaming for profit maximization is a strategy that focuses on maximizing profits by taking advantage of market opportunities. This strategy involves making decisions that will increase the company's profits, such as pricing, product development, and marketing.

Sharing the market is a strategy that focuses on increasing market share by competing with other companies in the same market. This strategy involves making decisions that will increase the company's market share, such as pricing, product development, and marketing.

As indicated in the topic all this government agencies required for a mandatory membership for employed individuals. In your own opinion is it necessary to mandate employees to pay contributions to these agencies? Why or why not?

Answers

In India, it is illegal for a government worker to operate a company.

What do you think of as business?

A person is conducting business when they create goods or render services with the goal of making a profit. Business Definition. A creative team or group that works on commercial projects is called a firm. They might be commercial, industrial, or of another kind.

What precisely is business?

A corporation's nature identifies the organization's type and primary objectives. It details the company's organizational structure, sector, range of goods and services, as well as each action done to achieve its objectives. It perfectly captures both the issue facing the business and the key features of what it has to offer.

To know more about business visit:

https://brainly.com/question/15826604

#SPJ1

A 10 percent increase in income allows Eileen to go out for dinner now 6 instead of 5 times a month. Her income elasticity of demand for dining out is:​

Answers

With a 10% boost in income, Eileen can now have supper out six times per month as opposed to only once. Her demand for eating out is 1.0 income elastic.

when a 4% rise in quantity requested of a good results from a 10% increase in income?

The good is a typical good, and the income elasticity is 0.4. Because demand increases as income increases, the good is a typical good.

What is the formula used to determine the demand elasticity of income?

Income elasticity of demand is calculated using the following formula: income elasticity of demand = (percent change in quantity demanded/percent change in income).

when a 3�crease in the amount requested of a good results from a 5% rise in income?

The good is a subpar good, and the income elasticity is 0.6.

To Know more about income elastic.

https://brainly.com/question/13691796

#SPJ1

The informal organization does NOT:
A.improve salary levels
B.transmit information
C.help orient new employees
D.improve job performances
offer friendship opportunities and social contact to new employees

Answers

For support and to promote social interaction, informal groups don't rely on any true hierarchy or structure.

What does the informal organization do?The term "informal organization" refers to a system of links and communication channels based on unofficial contacts between people inside an organization. Informal connections can exist between employees at the same level of the hierarchy or between people in various departments and levels.In informal organizations, hierarchical structure may not exist because of short-term objectives or because the group is solely social in nature.An informal organisation, as contrast to a formal one, does not rely on rank connections per se. Even a person's functions do not indicate where they are in the organization. In informal organizations, interpersonal interactions are governed by individual attitudes, prejudices, and likes and dislikes.

To learn more about informal refer to:

https://brainly.com/question/30095152

#SPJ1

21/25
What is a health insurance copay?

Answers

A health insurance copayment The portion of the amount due that the policyholder is required to pay out of pocket under a health insurance plan is known as a co-pay (co-payment).

What does copay in medical insurance mean?

A co-pay provision in a health insurance policy states that the insured will be responsible for paying a certain percentage of any incurred medical costs. When filing a claim, the policyholder often pays a specified percentage of the total claim amount.

What is a copay of $25?

A copay, also known as a copayment, is the set amount you must pay at the moment of treatment for medical care. For instance, you might be required to pay a $10 charge for each monthly prescription and a $25 copay each time you visit your primary care physician and a $250 copayment for an ER visit.

To know more insurance about :

https://brainly.com/question/27822778

SPJ1

Task 3: Sources of Financing
Evaluate on the following points.

At what point in your projections will you need outside capital, and how much?

What sources will you use to finance your company?

Type your response here:

Answers

is the answer Answer:

the answer

Explanation:

Consider an economy which produces and sells, among a host of other things, 100 million T‑shirts a year. The average T‑shirt begins life when a farmer plants seeds she put away last year, waters them, and harvests the cotton, then sells the cotton to a mill for $0.75, which sells the fabric to a T‑shirt factory for $1.50, which sells its T‑shirts to a wholesaler for $5, who sells it to Nordstrom for $10, which finally sells it to you for $17. Determine the impact of T‑shirts on annual GDP by calculating the value added of the entire production process.

Answers

The impact of T‑shirts on annual GDP by calculating the value added of the entire production process is $1,625,000,000.

How do you determine the added value?

The value added of the entire production process for T-shirts can be calculated by summing the value added by each stage of the production process.

Value added by the farmer = $0.75 (sale of cotton to mill)

Value added by the mill = $0.75 (sale of fabric to T-shirt factory) - $0.75 (cost of cotton from farmer) = $0

Value added by the T-shirt factory = $5 (sale of T-shirts to wholesaler) - $1.50 (cost of fabric from mill) = $3.50

Value added by the wholesaler = $10 (sale of T-shirts to Nordstrom) - $5 (cost of T-shirts from factory) = $5

Value added by Nordstrom = $17 (sale of T-shirts to customer) - $10 (cost of T-shirts from wholesaler) = $7

Therefore, the total value added by the entire production process is $0.75 + $0 + $3.50 + $5 + $7 = $16.25

The impact of T-shirts on annual GDP is $16.25 * 100 million T-shirts = $1,625,000,000.

learn more about GDP: https://brainly.com/question/1383956

#SPJ1

All infrastructure is underground.
A. True
B. False

Answers

All infrastructure is underground. This is a false statement because infrastructure can not be underground.

What is Infrastructure?

Roads, communications, transportation hubs, businesses, bridges, dams, power, medical facilities, and educational institutions make up the infrastructure.

Infrastructure is referred to as the fundamental physical framework of an organization, region, or country. It frequently pertains to the creation of public goods or industrial activities. Transportation, communication, sewage, water, and educational infrastructure are a few examples.

The two primary categories of infrastructure investments are as follows: Social infrastructure consists of institutions including hospitals, affordable housing, and schools. Infrastructure for the economy, including power, sewage, water, airports, and highways.

Therefore, The statement is false.

Learn more about Infrastructure, here;

https://brainly.com/question/14527131

#SPJ2

From 1960 to 2019, both U.S. imports and exports have increased, _ have grown more, leading to large excess of ___

Answers

From 1960 to 2019, both U.S. imports and exports have increased, economy have grown more, leading to large excess of revenue.

What are imports and exports?

Because import transactions involve payments to sellers in another country, there is an outflow of funds from the country. Exports are goods and services produced in the United States but sold to customers in other countries.

The import and export activity of a country can affect its GDP, exchange rate, inflation, and interest rates. Rising imports and a growing trade deficit can have a negative impact on a country's currency.

Therefore, an increase in imports and exports have led to an excess of revenue.

To learn more about import and export, click here:

https://brainly.com/question/14908412

#SPJ1

Which appeal is used in the following quote?

Hostilities exist. There is no blinking at the fact that our people, our territory, and our interests are in grave danger.

Ethos
Kairos
Logos
Pathos

Answers

Answer:

WRITE CARE FULLY

Explanation:

Pathos

Hostilities exist. There is no blinking at the fact that our people, our territory, and our interests are in grave danger. Pathos appeal is used in the following quote. The correct option is D.

What is pathos appeal?

Your audience's emotions must be manipulated in order to use pathos effectively. Pathos is a strong method of persuasion since emotions are a great motivator for people. Consider all of the potential human emotions when deciding whether to use pathos in your writing.

The quote appeals to the emotions of the audience by emphasizing the danger and urgency of the situation. This is an example of a pathos appeal. There is no blinking at the fact that our people, our territory, and our interests are in grave danger.

Thus, the ideal selection is option D.

Learn more about Pathos here:

https://brainly.com/question/26294668

#SPJ5

Which of the following organizations might help you learn how to be financially literate?
A. the IRS
B. the Department of the Treasury
C. Goldman Sachs
D. The Finance Bar

Answers

The Department of the Treasury organizations might help you learn how to be financially literate. The correct option is (B).

What do you mean by the Department of the Treasury?

The Department of the Treasury manages systems that are essential to the country's financial infrastructure, including those that produce coin and currency, distribute payments to Americans, collect taxes, and borrow money needed to sustain the federal government.

Government cash flow, debt management, and accountancy. drafting and enforcing tax and tariff legislation. Internal revenue evaluation and collection. coin and money production.

In addition to advising the President on economic and financial matters, the Department is also in charge of promoting sustainable economic growth and better financial institution governance.

Therefore, the Department of the Treasury organizations might help you learn how to be financially literate.

To know more about the Department of the Treasury, visit:

https://brainly.com/question/24538705

#SPJ1

All of the following are essential professional skills and personality traits except

negotiation
patience
problem-solving
self-assertion

Answers

Answer:

Well I'm pretty sure the answer is A: Negotiation bc it means to achieve something hope it helps :)

Explanation:

A

Why do individuals buy insurance policies?

Answers

Answer:

Managing risks

Explanation:

Why do you need insurance? Insurance is a way of managing risks. When you buy insurance, you transfer the cost of a potential loss to the insurance company in exchange for a fee, known as the premium.

Aisha is a qualified hairdresser. She opened her own salon, as a sole trader, five years ago. At first business was very slow due to competition from other salons and the fact that Aisha was unknown in the area. Aisha knew that the first year was going to be about survival. Aisha survived her first six months and within a year she was making profit. Aisha wants to grow her business. She thinks that adding beauty treatments to the services she offers will be a profitable option. She has a friend, Christine, who is a trained beauty therapist. She is thinking of asking Christine to become a partner in the expanded business.

Answers

Advantages of sole trading include that: Aisha will be the boss, and keep keep all the profits. The start-up costs are also low.

Who is a sole trader?

A sole trader is a self-employed person who owns and operates their own business on their own. Because a sole trader business lacks a legal identity separate from its owner, many people believe that you are the business.

In a sole trading, we have maximum privacy, establishing and operating the business is simple. It's easy to change your legal structure later if circumstances change you can easily wind up your business.

Therefore, Aisha should be a sole trader.

To learn more about sole trader, click here:

https://brainly.com/question/29445261

#SPJ1

Your question is incomplete, but most probably the full question was

Explain TWO advantages to Aisha operating as a sole trader

One of the highest-paying career groups where being knowledgeable is a key job skill is what classification?

a
professional
b
certified
c
certificated
d
service

Answers

Professionals are one of the highest-paying career groups, and knowledge is a crucial job qualification in this category.

Who are Professionals?

A person who engages in a specific professional activity or a member of a profession is both considered professional. The phrase also refers to the requirements for education and training that give professionals the precise knowledge and abilities required to carry out their particular roles within that profession. Additionally, the majority of professionals are bound by strong codes of conduct that establish high standards of morality and ethics. A given field's professional standards of conduct and ethics are often established and upheld by well-known professional bodies, such as the IEEE.

To learn more about Professionals visit;

https://brainly.com/question/3396195

#SPJ1

Money and Banking HW #1
Is this correct?

I would appreciate a response at your earliest convenience.

Answers

In addition to money which is a financial asset, people also hold stocks and some other assets called bonds, stocks unlike money represent part ownership. The solution is correct

What are financial assets?

A financial asset is a non-physical item, such as a bank deposit, a bond, or a stake in a company's capital, that derives its value from a contractual claim. Generally speaking, financial assets are more liquid than other types of tangible assets, such commodities or real estate.

The term "bond" refers to a type of security in finance where the issuer (debtor) owes the holder (creditor) a debt and is required, depending on the terms, to provide cash flow to the creditor (e.g., repay the principal (i.e., amount borrowed) of the bond at the maturity date as well as interest over a specified amount of time).

In the world of finance, stock (sometimes known as capital stock) refers to all of the shares that constitute a corporation's or company's ownership.

Learn more on financial assets here https://brainly.com/question/24085182

#SPJ1

Laws regarding taxes

regulate employee rights to compensation resulting from job-related injuries
regulate employee rights to a safe work environment and reasonable minimum wage
require employers and employees to contribute to the Social Security fund
require employers to disregard gender, race, and ethnicity during the hiring process

Answers

The laws regarding taxes can be defined as require employers and employees to contribute to the Social Security fund. So the correct answer is C.

In economic and business, law generally can be defined as the discipline and profession concerned with the customs, practices, and rules of conduct of a community. Law is an obligation for anyone and bust be paid that are recognized as binding by the community. Enforcement of the body of rules is through a controlling authority. In workspace and economic, Employment laws generally can be defined as a set of rules that govern employees' rights and employers' duties.

Here you can learn more about employment law https://brainly.com/question/30269429

#SPJ4

Higher education typically has a positive return on investment because
many of the classes you will take will help you see the world in a new way
jobs and careers that require a degree or certificate generally earn higher
salaries
you can earn credits over the summer and finish school early
you will form some long lasting friendships that will have a positive impact on
your life

Answers

Over the course of your career, the salary that will earn with such a degree will cover your college expenses. To pay for postsecondary education, you can seek grants and scholarships.

What 3 categories of scholarships are there?

Merit-based scholarships, demand scholarships, & athletic scholarships are typical types of college financial aid.

How do I become a full scholarship winner?

full-ride financial aid for education: Have the highest GPA in your class, enroll in AP and honors courses, and achieve perfect (or really near to flawless) SAT as well as ACT scores. Having leadership qualities or community involvement is advantageous in addition to academic achievement (see below).

To know more about scholarships visit:

https://brainly.com/question/9958317

#SPJ1

In your business plan, you note that investors can expect to gain 110 percent of their investment back after three years. The time frame here provides your:
Group of answer choices

turnover.

point-of-sale.

rate of return.

return on interest.

Answers

In your business plan, you note that investors can expect to gain 110 percent of their investment back after three years. The time frame here provides your: rate of return. Option C

What is meant by the rate of return?

The percentage change in an investment's value is represented by the yearly rate of return. For instance, if you estimate a 10% annual rate of return, you're anticipating that your investment's value would rise by 10% annually.

By dividing the total gain or loss at the end of the year by the initial investment made at the beginning of the year, the annual rate of return is determined. The annual rate of return or nominal annual rate are other names for this approach.

Read more on rate of return here: https://brainly.com/question/24301559

#SPJ1

Romance Novels, Inc, located in Cheektowaga, NY, has gradually increased the number of contingent workers (full-time, temporary) from 10 percent of the workforce to about 28 percent today. Why might they do this? Also, what equity problems can arise from hiring contingent workers, especially when they work alongside regular employees?

Answers

Due to the increased adaptability, Romance Novels, Inc. could have increased the percentage of unexpected to 28%. Representative advantage costs are around 50 percent less for unforeseen specialists.

What exactly is a specialist? 

Professionals with specialised knowledge are known as specialists. A professional who is accountable for certain responsibilities within their specialization or department is referred to as a "specialist" in general terms.

Why do specialists demand such high prices?

Specialists may be able to demand high rates even in locations with adequate supply because they profit from established referral patterns. In other words, local doctors' offices, clinics, and hospitals may refer patients to specific experts nearly automatically without considering the costs they modify.

To know more about specialists, visit-

https://brainly.com/question/29689293

#SPJ1

Distinguish between
Supplementary compensation
with
Base
Compensation
with
citation from books-

Answers

Basic pay in the form or wages and salary is referred to as base or primary compensation. It is a set, non incentive payout based on the amount of time spent working. Incentives and variable rewards that are based on either an individual's productivity or the output of the collective as a whole make up supplemental compensation.

What exactly is a supplementary payment?

Compensation that is provided in addition to an employee's regular salary or wages is known as supplemental pay. Bonuses, tips, paid vacation or sick leave, prizes, retroactive pay hikes, and other types of extra compensation are all examples of supplemental pay.

What does base pay mean?

The most popular ways to describe base pay are as a hourly basis, monthly payment, or annual salary. It excludes benefits and extra money including commission, tips, overtime, and bonuses. In light of all this, base pay might only make up a small portion of an employee's overall salary.

To know more about Supplementary compensation visit:

https://brainly.com/question/13755469

#SPJ1

The head of the attractions team at a theme park leaves a voice message for the maintenance staff to let them know that the lights are not working at one of the rides. This is an example of ___________ communication.

companywide
departmental
interdepartmental
interpersonal

Answers

The head of the attractions team at a theme park leaves a voice message for the maintenance staff that the lights are not working at one of the rides. This is an example of interdepartmental communication.

What is interdepartmental communication?

The majority of interdepartmental communication takes place in a formal setting between various organizational departments. When interdepartmental communication is facilitated by effective infrastructure, it is effective.

A memorandum is a record or note that will be used later. It is practical and beneficial for casual contact. The majority of interdepartmental communication occurs over the phone, although memoranda are utilized when the information needs to be conveyed in writing.

Memos are also sent out when employees need to face disciplinary action. Employees provide suggestions. They are occasionally given from one department to another.

It aids in the creation of novel concepts and strategies. However, its success is based on the management's mentality.

Learn more about interdepartmental communication, here

https://brainly.com/question/29109217

#SPJ1

Erin Murdoch, an architect, organized Modern Architects on January 1, 20Y4. During the month modern Architects completed the following transactions

Answers

The journal entries to record these transactions would be:

1. Cash 25,000, Capital 25,000

2. Insurance Expense 800, Cash 800

3. Equipment 5,000, Cash 5,000

4. Rent Expense 1,400, Cash 1,400

5. Service Revenue 2,000, Accounts Receivable 2,000

6. Salaries Expense 1,000, Cash 1,000

7. Accounts Payable 2,000, Supplies Expense 2,000

What is the journal entry?

In the accounts of your company, a record of a commercial transaction is referred to as a "journal entry."

When you maintain your books using the double-entry method, you record every transaction in at least two different journal entries.

Journal entries are used by a bookkeeper to keep track of all of the many changes that are brought about in a firm as a result of transactions.

Read more about journal entry

https://brainly.com/question/14958718

#SPJ1

CQ

Erin Murdoch, an architect, organized Modern Architects on January 1, 20Y4. During the month modern Architects completed the following transactions

1. Erin contributed $25,000 cash to start the business

2. Paid $800 for insurance

3. Purchased office equipment for $5,000 cash

4. Paid $1,400 rent for the month

5. Earned $2,000 in design fees

6. Paid $1,000 in salaries

7. Purchased supplies on account for $2,000

What is the jounal entry

A marketing plan

analyzes the need for marketing in a command economy
identifies a business challenge
estimates costs to run a business
creates a roadmap for the overall business

Answers

A marketing plan is used by businesses as a strategic road map to plan, implement, and track their marketing strategy over a set period of time.

Which principles underpin marketing?

To meet the demands of your clients, marketing involves organizing and carrying out the development, pricing, distribution, and advertising of products and services. Marketing's main objective in attracting new customers and keeping existing ones is to provide value to them.

What in marketing is most crucial?

The most crucial and ongoing task for any marketer is to understand their target audience. It's important to record what you've discovered about your consumer over the year, even though it's something you should work on every day of the year.

To know more about marketing plan visit:-

https://brainly.com/question/1438675

#SPJ1

Describe the key elements in managing operations, quality, and productivity, with the reflection and analysis on your work/life/managerial experiences.

Answers

Some of the key elements in managing operations, quality, and productivity with the reflection and analysis on your work/life/managerial experiences includes:

Setting clear goals and objectivesEffective communicationPlanning and organization\Continuous improvement

How do these key elements help in managing operations, quality, and productivity?

By setting clear goals and objectives, we can establishing clear targets for what needs to be achieved helps ensure that everyone is working towards the same vision. Through communication, we can be coordinating efforts, providing direction and feedback, and resolving issues.

By using planning and organization, we can develop detailed plans and schedules, and maintaining a well-organized system for tracking progress helps ensure that tasks are completed on time and within budget. Also, with use of continuous improvement, the regularl reviewing and analyzing processes to identify areas for improvement helps to enhance efficiency and productivity.

Read more about elements

brainly.com/question/20096027

#SPJ1

Which outcome is the most likely result of the government lowering taxes on a particular good?

A. Supply of the good will increase

B. Demand for the good will remain the same

C. Demand for the good will decrease

D. Supply of the good will decrease

Answers

Answer: A. Supply of the good will increase

Explanation: Lowering taxes on a particular good makes it less expensive for producers to manufacture and sell it.  As a result, the producers can make more of the good because they can do so more profitably with the lower taxes, which in turn increases the supply of the good. This is the basic concept of the law of supply: the higher the price of a good, the more of it producers will be willing and able to supply, and the lower the price, the less they will be willing and able to supply. In contrast, demand is driven by the price of the good as well as other factors such as consumer tastes, needs, and preferences, income, and availability of substitutes. Lowering taxes does not directly affect demand for the good.

Learn more about supply and demand here: https://brainly.com/question/32830463.

The childcare center that your niece attends is beginning to offer extracurricular activities for children. What does this
suggest?
O
The childcare center is scaling its business.
O
The childcare center is going out of business.
The childcare center is attempting to recruit.
The childcare center is changing their niche.

Answers

Your kid will benefit from engaging in creative activities as they learn to pay attention, explore new textures, identify new odours, and build a knowledge of their surroundings.

What exercises can you perform to aid in a child's physical development?

Make time for a trek, a stroll, or a trip to a neighboring park with the family. Play sports that require hopping, throwing, catching, and running together. Change things up! Encourage your child to kick the ball with one foot and bat with the other when playing baseball.

What are the top five areas where child development needs to be strengthened?

They are social, emotional, physical, cognitive, and linguistic realms. The JBSA CDPs' method to preschool education is based on the five important domains, but parents can use them as a guide to help their children develop.

To know more about activities visit:

brainly.com/question/30029400

#SPJ1

A manager hires labour and rents capital equipment in a very competitive market. Currently the wage rate is $9 per hour and capital is rented at $10 per hour. If the marginal product of labor is 50 units of output per hour and the marginal product of capital is 60 units of output per hour, should the firm increase, decrease or leave unchanged the amount of of capital used in the production process?.

Answers

The firm should decrease the amount of capital used because the ratio is greater for capital.

What is the calculation?

The wage rate is $9 per hour and capital is rented at $10  per hour.

The marginal product of labor is 50 units of output per hour and the marginal product of capital is 60 units of output per hour.

A manager hires labor and rents capital equipment in a very competitive market.

The ratio of marginal product of labor and wage rate

= 50/9

= 5.5

The ratio of marginal product of capital and rent

= 60/10

= 6

Since the ratio is greater for capital, it means that the manager should decrease the amount of capital used in the production process.

Learn more about ratio, here:

https://brainly.com/question/13419413

#SPJ1

A listing agreement establishes a fiduciary relationship between a

Answers

Answer: The listing agreement creates an agency and fiduciary relationship between the seller and the broker.

Explanation:  The relationship with the seller being the principal and the broker as his agent. The broker generally has salespeople working for her to provide the services, consisting mainly of finding buyers for the property. However, the salespeople work for the broker and not the seller. Only the broker represents the seller.

A listing agreement establishes a fiduciary relationship between - Broker and principal (Seller).

What does a listing agreement's main objective?

An employment contract between a real estate broker and a property owner is known as a listing agreement. It gives the broker the ability to act as the seller's listing agent and find a buyer who will buy the house on their conditions. A listing agreement essentially gives your real estate agent the go-ahead to find a buyer for your home.

Agency connections are established through written contracts. An agreement known as a listing agreement establishes the connection between a broker and a seller. A purchaser agency agreement establishes the connection between a broker and a buyer. No agency relationship is established by a sales agreement; it is between a buyer and vendor.

To know more about broker's fiduciary responsibility visit:

https://brainly.com/question/28342358

#SPJ1

Other Questions
HELP ASAP!!!!! What is the value of the following expression?[6 4 + 50 (12 + 13) + 2] 3 What professional can help you prepare your income tax return? Read Voluntourism: an opportunity too good to be true and The Opportunity of a Lifetime and answer the questions.How are points developed? What is the claim? Is there a counterclaim? If so, what is it? How is it refuted or weakened? What is the effect of the identified devices or appeals? How does this device or appeal help achieve the purpose of the speech or text? What is the authors attitude toward the topic? How does the tone affect the audience? How does the tone help achieve the authors purpose? Which details are emphasized in each medium? What does the different emphasis reveal about the authors position and purpose? What is the effect of the different elements emphasized? a co-worker is to employee as a (n) is to a (n) What are the benefits brought by technology and explain why is it beneficial in the field of healthcare? A computer is performing a binary search on a sorted list of 20 items. What is the maximum number of steps it needs to find the item? the patient is sweating profusely. this would be documented as: select one: a. ceruminous b. diaphoresis c. keratitis d. dermatitis. Which DNA strand matches the strand AATGACT?TTACTGAGGCAGTCCCATCAGAACGATC Demonstrate at least two different ways how to solve the equation 5(2x-1)=25 Work out the equation of the line shownbelow.Give your answer in the form y = mx + c,where m and c are integers or fractions intheir simplest forms.Y-160-140--120--100-80-60-40-20--80 -70 -60 -50 -40 -30 -20 -10 0-20--40--60-80--100-120--140---160-10 20 30 40 50 60 70 80 x A 2kg block is attached to a spring for which k=200N/m, it is hold at an extension of 5cm and then released at t=0. Find the displacement as a function of time. The velocity , acceleration and total energy when x=+_ A/2. the lowest prices. the most product options. the fewest product options. superior value for the price. the bloch sphere geometric representation of a quantum state is parameterized by two angles and such that . what are the values of the angles and for the state Evaluate the expression for x = -8.x = 16, and x = 4.X 4 which nursing action is appropriate when providing care to a patient who experiences apiration because of enteral feedings A. I hiked on mountain paths, biked on wooded trails, and kayaked on clear ponds.B. These drones can soar, swoop, hover, and even make the buzzing sound of a housefly.C. Mr. Patel improves our school every day by teaching his classes well, he coaches his team well, he even gives personal advice and counseling to students who need it.D. We are kinder, more thoughtful, more conscientious, better students. The first category of evaluation and management codes is? Which of these is a new form of payment that has been recently accepted in some companies?A. CashB. CheckC. Credit CardD. Cryptocurrency 9800 workers in Arizona retired in 2010 as compared to 23,430 in 2009. What is the absolutechange in the number of workers that retired? evaluating a company's performance not only by its ability to generate economic profits but also by its impact on people and the planet. Triple bottom line