Answer:
A. transmission electron microscope.
g UV radiation causes covalent dimerization of two subsequent ______ bases in DNA. This dimer is recognized and repaired by ______.
Answer: The options are not given.
Here are the options.
a. C and C ;;;; DNA photolyase
b. T and T ;;;;; DNA photolyase
c. C and C ;;;; DNA photoisomerase
d. T and T ;;;;; DNA photoisomerase
e. None of the above
Explanation:
UV light damages the DNA of cells that are exposed by making bonds to be formed between adjacent pyrimidine bases, usually thymines, in the DNA chains. The thymine dimers inhibit or hinder the DNA correct replication during reproduction of the cell.
UV radiation causes covalent dimerization of two subsequent T and T because Thymine bases of DNA directly absorbs a UVB photon . UVB light causes thymine base pairs close to each other in genetic sequences to bond together into pyrimidine dimers, thereby causing a disruption in the strand, which reproductive enzymes cannot copy.
UV-induced thymine dimers can be repaired by photoreactivation, in a process where energy from visible light is used to split the bonds forming the cyclobutane ring through the action of DNA photolyase, an enzyme that repaired damaged cause by uv radiation to dna.
The basal metabolism of a human adult is the total rate of energy production when a person is not performing significant physical activity.
a. True
b. False
True
Metabolism refers to the countless chemical processes going on continuously inside the body that allow life and normal functioning.The amount of kilojoules your body burns at any given time is affected by your metabolism.Your metabolic rate is influenced by many factors – including age, gender, muscle-to-fat ratio, amount of physical activity and hormone function.Hope this helps you ❤️MaRk mE aS braiNliest ❤️^_^Answer:
Explanation:
FALSE
C. If you combined the elements in the product of this reaction, what type of
reaction would it be? Hint: What is the reverse of the equation you just
balanced? (1 point)
Answer:
Reversible reaction
Explanation:
If the elements of the product combine together in a chemical reaction, this reaction is called reversible reaction because the reaction moves in backward or reverse direction. For example, if acid i. e. HCl combine with base i. e. NaOH which are the reactants, it produces two products salt (NaCl) and water (H2O). If salt (NaCl) and water (H2O) combine again with each other, it produces acid i. e. HCl and base i. e. NaOH, such type of reaction is called reversible reaction.
Growers often wrap potted plants in plastic sleeves prior to shipping. If plants remain in these sleeves too long, their leaves curl and fall off. Imagine you are working at a garden center and have been asked to make a presentation to a local garden club. Unit 5 DQ Question: Explain the processes that may cause the leaves to drop and fall.
Answer:
Shock, age and climate.
Explanation:
The processes that may cause the leaves to drop and fall are shock, age and climate. The plants drop their leaves due to shock when they experience by transplanting from place to another. When the leaves get older having yellow colour so due to no function it falls. The climatic condition is also responsible for the dropping of leaves. Those plants which can't grow in cool season so when the winter comes they shed their leaves and wait for the summer season.
g The ____ ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the ______ bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.
Answer:
The purine ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the pyrimidine bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.
Explanation:
Purines are produced as bases attached to the ribose 5-phosphate (pentose sugar). The adenine and guanine nucleotides derive from inosine monophosphate (IMP), which is synthesized on an existing ribose-phosphate. Thus, purine bases are built on a ribose sugar that is directly attached to the pyrimidine ring. On the other hand, pyrimidines are produced from the carbamoyl phosphate precursor. In this case, the ribose-5-phosphate pentose sugar is attached after the pyrimidine ring is made.
The gene encoding VEGFR2, the main receptor that binds and is activated by VEGF-A, is transcribed in almost every tissue type, but the VEGFR2 protein is rarely present. List and describe one mechanism that cells could use to reduce VEGFR2 protein levels despite high levels of transcription.
Answer:
The RNA interference (RNAi) mechanism
Explanation:
RNA interference (RNAi) is a biological process by which endogenous non-coding RNAs (ncRNAs) sequences target messenger RNAs in order to inhibit gene expression and translation. The regulatory ncRNAs bind by complementary base pairing to specific mRNAs and thus promote gene silencing by both posttranscriptional (mRNA degradation, block translation, etc) and by transcriptional (recruiting of histone/DNA modifying enzymes) pathways. The most common types of evolutionarily conserved ncRNAs found in plant and animal cells are 1-small interfering RNAs (siRNAs), 2-microRNAs (miRNAs), 3-piwi interacting RNAs (piRNAs, only present in animal cells) and 4-long noncoding RNAs (lncRNAs).
Why do roosters hibernate?
Answer:
The answer is
Explanation:
Roosters hibernate to escape the harsh seasonal variations as it cannot fly to different lands and is a flightless bird.
Hope this helps....
Have a nice day!!!!
A cross-sectional view of a log shows a concentric pattern. Which part of the stem gives rise to this pattern?
A cross-sectional view of a log shows a concentric pattern. Which part of the stem gives rise to this pattern?
B. Xylem
as it contribute for most of a tree's growth in diameter.
what is the formula for net primary productivity
Gross Primary Production or GPP minus the carbon that is lost to respiration
Explanation:
NP = GPP - RESPIRATORY LOSS
Help .....plz help me
Answer:
Where is question. Hope you understand me
Explanation:
Please mark me brainliest thanks
The first place that the reabsorption of water is not automatically coupled to the reabsorption of filtered solutes occurs in the PCT.
a. True
b. False
Answer:
False
Explanation:
The correct answer is false because Reabsorption of water and other filtered solutes like vitamins, sodium e.t.c. take place in the proximal convoluted tubules.
Reabsorption is when water and solutes in the PCT are removed and moved back into the blood and it's a process that take place through bulk transport.
The solutes and water are transported from the PCT to the interstitium and then move into peri-tubular capillaries and reabsorption in PCT is isosmotic i.e solutes have the same osmotic pressure.
List three protozoan infections of the circulatory system that are transmitted by arthropods. Include the disease name, specific organism (genus species), vector that is the intermediate between hosts, and disease progress in humans.
Answer:
List three protozoan infections of the circulatory system that are transmitted by arthropods:
Malaria
Toxoplasmosis
Chagas disease (American trypanosomiasis)
Explanation:
Malaria is a prozotoan infection, that can be produced by several protozoan, in the genus Plasmodium. This Plasmodium infect red blood cells and the vector that trasmites it is the Anopheles mosquitoe. In this disease, red blood cells can have severe damage in different organs because of the hemolysis.
Toxoplasmosis is a disease caused by the protozoan Toxoplasma gondii. The main vector of them are domestic cats. When cats are infected, T. gondii oocysts is found in their feces and it can spread to humans. This disease is generally asymptomatic, except when the patient has AIDS or in pregnancy, which can be very dangerous and fatal.
Chagas disease, or American trypanosomiasis is caused by protozoan Trypanosoma cruzi and is generally transmitted to people thanks to the feces of triatomine bugs. Some of the acute symptoms include fever, vomiting, headache, and in severe cases people can develop a chronic disease. In the worst cases it can produce flaccid cardiomegaly (enlargement of the heart) leading to heart failure and death.
You believe that the cytosolic protein p007 is involved in mediating growth hormone-stimulated proliferation in cells. You wish to establish a cell model using your cultured fibroblasts. Provide clear explanations to the following, each worth 2.5 pts each. a) Describe how you would transfect the growth hormone receptor DNA into your cells to create stable cell lines, and include a description of the benefits of using stable cell lines versus transiently transfected cell line. b) Describe how you would measure specific receptor binding of GH to your stable cell line. c) Describe how you would measure growth hormone-induced proliferation in your stable cell line. Make sure to include controls. d) Describe how you would use RNAi to demonstrate the requirement for p007 in growth-hormone stimulated proliferation. Make sure to include controls.
Answer:
Following are the answer to this question:
Explanation:
In option a:
There are many ways, which can be defined as follows:
It keeping cells "qualified," use heat shock and handle ions like Ca and ice incubating.It uses Micro-injection with DNA. It uses the biolistics or even the process of gene-gun.The stable cell charts indicate simple and definitive outcomes when their relationship to specific results. Moreover, relative to temporary cell lines, findings are more reliable and error-free. These lines also easily break and much less.
In option b:
Radio tests including linking tests could be used
The Ligand Binding Assays is an analysis, that is based on the binding of ligands to antibodies, or other macromolecules. Its existence and distance of formed ligand-receptor complexes are defined using a system of measurement that is usually electrical or fluorescent.
In option c:
The method for measuring the levels of cell growth is accessible and the Another way is to measure the metabolism within the same cell. So many color pigments were also accessible that can permeate an organism as well as react with some proteins as well as other factors, and that can effectively identify a color final product.
Throughout relation to the amount of metabolism exercise, cell proliferation could be evaluated by researching one or even more cell markings. The BrdU limited liability assessment is a very well-published illustration.
Its specific antibody can detect BrdU and high BrdUincorporations levels are linked to high levels of cell proliferation. Command cell without DNA receptor growth hormone.
In option d:
The cell growth will stop after each use of RNA interference ( RNAi). The p007 formation as well as the effect on growth caused by the intrusion will be a goal. If development is delayed effectively, the theory will be tested successfully to a cell without any of the required DNA. The RNAi is the free cell
Give five differences in the alimentary canal of flatworms earthworm and cockroaches
Answer:
Animals are adapted to the complex chain food since when they were no manufactured to the their food system. Without breakdown this complex food chain can not digest without breakdown.
Explanation:
Earthworm alimentary canal:
Earthworm have a segmentation of well developed characteristics of all animals. The alimentary canal of earth worm as well as flatworm consists of buccal cavity, mouth, esophagus, crop, intestines', gizzard, and anus. The digestion occur extracellular that means the digestion occur outside the cells. Cockroach is an omnivores. It ranging from starchy to the sweet things to the paper and clothes etc. It suits its diet. Its alimentary canal consists of Foregut, midgut and the hindgut. Both are different in their structure as well as in their alimentary canal.Discuss Connell and Slatyer three mechanisms of succession. Start your answer with a definition and an example of what is succession, and describe how succession begins.
Answer:
Facilitation, tolerance and inhibition models
Explanation:
J. H. Connell and R. O. Slatyer stated three different ecological succession models that explain how species composition may change by the effects of disturbances in the ecosystem. These models are as follow:
1- Tolerance model: in this model, the new species don't affect the growth and success of existing species, thereby the process of succession is purely associated with life-history strategies.
2- Facilitation model: only 'ideal traits' found in colonizing species lead to the initial succession. These ideal traits include for example effective mechanism of dispersal, water storage tissues to survive in dry regions, long-term seed dormancy, etc.
3-Inhibition model: Species that appeared during early succession are capable of inhibiting growth of species appeared in later stages, as well as reduce colonizing species abundance.
Where is DNA found in the cell??????
The DNA is found in the nucleus of the cell
whats the answer guys help me out
Answer:
Read Exp:
Explanation:
1st one - Attracts Pollinators.
2nd one - Prevents water loss.
3rd one - Traps insects.
During the 1800's, what country was a leader of world exploration and placed at the center of most maps?
A. Britain
B. Spain
C. Morocco
D. USA
Answer:
B. Spain
Explanation:
Portugal and Spain are the western European nations that were the primary players in the age of discovery in 18th century. Under the leadership of prince henry the navigator. With the spread of missionary activities, Christianity becomes the world's largest religion. Exploration of the Americas and other nations started from this place.For every 100ml of deoxygenated blood delivers approximately _____ml of CO2 to the alveoli.
Answer:
For every 100ml of deoxygenated blood delivers approximately __4___ml of CO2 to the alveoli.
Answer:
4ml
Explanation:
For every 100ml of deoxygenated blood delivers approximately 4 ml of CO2 to the alveoli.
Hope it is helpful....Give four reasons why th toe operating system pivotal in teaching and learning
The correct answer to this open question is the following.
The four reasons why the operating system is pivotal in teaching and learning are the following.
1) Operating systems are the foundation of the computer. Without the operation system in place, you could not run any program.
2) The operating system presents an interface that allows users to perform many tasks at the same time, with all degrees of complexity.
3) The operating system permits the installation of all kinds of software so the user could work on practically anything.
4) Applications for sound, video, graphics, mathematics, and many other activities can be run due to the operating system.
In these times of digital education, the operation system of a computer allows users to do all the needed activities to fulfill the goals of teaching and learning. From video classes, team meetings, corporate dates, continuing training activities, and many more, the capacity of a good operating system is what makes it easy for you to accomplish your goals.
After the centromeres separate during mitosis, the chromatids, now called _______, move toward opposite poles of the spindle.
Answer:
Daughter chromosomes
Explanation:
All of the following statements concerning homeotic genes is correct except Group of answer choices They are responsible for determining the general body plan. They act as master control genes. They code for DNA-binding proteins. They are highly variable across species the animal kingdom.
Answer:
They are responsible for determining the general body plan.
They act as master control genes.
They code for DNA-binding proteins.
Explanation:
The homeotic genes are master regulators in development found both in animals and plants. In animals, Homeobox (HOX) genes encode for transcription factors containing a DNA binding domain of 60 amino acids which is evolutionarily conserved in species ranging from Drosophila to humans. In plants, MADS-box homeotic genes encode for proteins containing a conserved DNA-binding domain (in this case, referred to as MADS-box of 60 amino acids), which is capable of controlling developmental pathways in a similar mode to Hox genes in animals. Moreover, it is important to note that MADS-box genes are conserved not only in plants but also in other phyla including animals, fungi and protists.
explain where the pericardium is found and what it does for the heart
Answer:
the pericardium is found in your heat Problems can occur when the pericardium becomes enflamed or fills with fluid.
The client has experienced a stroke, and her speech is now garbled. The client may have experienced damage to which of the following?
A. Brainstem
B. Medulla oblongata
C. Frontal lobe
D. Cerebellum
Answer:
C
Explanation:
A person with garbled speech may have experienced damage to the frontal lobe portion of the brain.
This is because the left portion of the frontal lobe of the brain is an area that has been touted to be responsible for the control of speech in humans. Research in the past has shown that damage to that region of the brain affects the formation of spontaneous speech as well as motor speech control.
Hence, garbled speech in someone that has experienced stroke can be attributed to damage to the frontal lobe.
Correct option: C.
Restriction digest A:
ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC
How many bases are in the second fragment?
Answer:
This question seem incomplete
Explanation:
This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51
This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below
A ⇆ T
G ⇆ C
Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).
Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51
What's the main characteristic of porosity?
A. Porosity is a description of how pores are shaped and connected.
B. Porosity is the location at which aquifers are located for water flow.
C. Porosity describes the material found within soil and classifies the absorption capacity of that material.
D. Porosity is how much space there is in rocks and soil to hold water.
Answer:
The answer should be D
Explanation:
because poroslty of a rock is a measure of its ability to hold a fluid. mathematically, it is the open space in rock divided by the total rock volume.
How do simple organisms exchange substances?
O A. Directly across the alveoli.
OB. Through spiracles.
C. Directly across the external membranes.
D. Through specialized gas exchange systems.
Which occurs when the body responds to the environment by maintaining a stable internal environment despite changing
external conditions?
spontaneous generation
homeostasis
growth and development
reproduction
Answer:
homeostasis
Explanation:
Homeostasis is the biological process by which living organisms maintain a stable internal environmetal condition despite changes in their external environment. Homeostasis is an important phenomenon for the optimal functioning of any living organism.
A vivid example of homeostatic process is the regulation of temperature in humans or some animals. Self-r regulating mechanisms help keep their temperature at a stable state irrespective of temperature changes in the external environment i.e. hot or cold external conditions. The steady state of internal temperature is very important for some physiological processes in living systems.
Answer:
B
Explanation:
Provide one example of quantitative data that can be collected when using a microscope?
Answer: there 3 ducks by the pond
Explanation:
Quantitative is numbers. how many.
What is the frequency of a wave that has a wavelength of .20 m and a speed of 22 m/s
Answer:
110 Hz
Explanation:
Find the frequency of the wave using the formula, frequency = speed / wavelength.
Plug in the speed and wavelength, and solve:
frequency = speed / wavelength
frequency = 22 / 0.2
frequency = 110
So, the frequency of the wave is 110 Hz