Answer:
Do video games negatively impact mental health?
Are vegetables good for growing strong bones?
Explanation:
A scientific question is one that can be subjected to experimental verification. Experimentation is then used to obtain valid data which can be used to answer the question.
A good scientific question must contain a dependent and an independent variable. The independent variable is manipulated and its effect on the dependent variable is observed.
In the two options chosen;
Effect of video games on mental health can be observed by conducting a research experiment on people who play video games and those who do not play video games.
Effect of vegetables on strong bones can be studied by conducting a research experiment using people who eat vegetables and those who do not eat vegetables.
Which is NOT a function of magnesium in the body?
znutritio acting as a cofactor for enzyme systems in the Irody
regulating bone and mineral status
protecting teeth from acid-forming bacteria
making up one component in bone mineral
Answer: I think it is the third one which states, "Protecting teeth from acid-forming bacteria".
Explanation:
a body may have zero velocity even though its speed is 10m/s. give reason.
Explanation:
because speed is time rate at which an object is moving along a bath, while velocity is the rate and direction of object's movement .
DNA is negatively charged. Therefore, it is
O hydrophilic
O hydrophobic
Vị trí các cacbon trong cấu trúc của đường đềôxyribô trong 1 nuclêôtit được thêm dấu phẩy vì:
Answer:
hi please answer my questions.
When sweat cools on the skin, removing heat and cooling the body, what process is occurring? A. Parasympathetic nerve conduction B. Respiration C. Homeostasis D. Dehydration
Explanation: it has to be C because i got it right on my test
what is economic importance of honey bee
Answer:
1. They are one of the most important pollinators for both wild and domestic plants.
2. Their most important product, honey, is used in baking, meals, and drinks. It is also used for shooting sore throat and suppressing the urge to cough. It also reduces the ravages of the aging process and it is an antioxidant that may help in the prevention of cancers. It is a mild salve for treating skin conditions and abrasions.
3. Propolis, a material made when bees mix resin with honey, is used to treat minor wounds and abscesses.
4. Bee pollen which are pollen balls are excellent source of amino acids and vitamins for humans.
5. Royal jelly, which is a milky secretion secreted by worker honey bees is used for asthma, hay fever, pancreatitis, insomnia, premenstrual syndrome, and other diseases.
Protein that accounts for why water can cross a membrane more quickly than expected is Group of answer choices
Answer:
The correct answer is "Aquaporin".
Explanation:
The missing options of this question are:
A. ATP synthetase
B. Aquaporin
C. The sodium-potassium pump
D. Integrin
The correct answer is option B. "Aquaporin".
Aquaporins are microscopic channels that belong to a family of proteins that form pores. Aquaporins are also known as water channels for its specific biological role of allowing water to cross the cell membrane. The presence of aquaporins explains why water can cross cell membrane more quickly than expected, since they function as regulators of water transference.
what is angiology????
Explanation:
Angiology is the medical specialty dedicated to studying the circulatory system and of the lymphatic system, i.e., arteries, veins and lymphatic vessels. In the UK, this field is more often termed angiology, and in the United States the term vascular medicine is more frequent
Answer:
- study of blood vessels and lymphatic system..
Explanation:
this is the medical term...is the study of blood vessels and lymphatic system.
What is the process of
evaporation?
A. The process in which plants release vapor into
the atmosphere
B. Any process that returns water from the
atmosphere to the earth
C. The process in which liquid water turns to
water vapor
Help anyone please????!
Biologists designed an experiment to test the effects of compost on the development of root crops
Answer:
The crop has good yield because Compost has a good effect on root crops.
Explanation:
Compost has a great effect on the development of root crops such as onion, potato, garlic and ginger etc. Compost provide nutrients to these crops as well as soften the soil due to which they grow rapidly. It also improved ventilation, soil structure and soil texture which is very necessary for the crop. Due to ventilation, oxygen gas is available to the roots which increases growth and yield of these crops. Compost also retain water and nutrients so they are available to the roots. So those plots where compost is applied observed increase in yield as compared to other plots.
what is a radical a group of ions
Answer:
A radical is a group of atoms of elements carrying a charge. radicals or ions are formed by gaining or loosing ions. positive radical ions are called radical cations whereas negative radical ions are called radical anions.
hope this helps you u :)
Which part of the cell functions to recognize other cells? (1 point)
O nucleus
O cytoplasm
O cell wall
O plasma membrane
Answer:
cell wall maybe it may be wrong also
Plasma membrane of the cell functions to recognize other cells. Thus option D is correct.
What is Plasma membrane?The plasma membrane which is an outer covering of cell present in both prokaryotic and eukaryotic cell.
It is a thin selectively semi-permeable membrane which enclose the cytoplasm along with other organelle.
Proteins and lipids are the major components of membrane, beside this carbohydrate are also present in cell membrane.
The most common lipid in membrane is phospholipid, other lipids are glycolipid, sphingolipid.
The function of cell membrane is to provide protection and maintain the integrity of the internal environment of the cell,
It act as a base of attachment for the cytoskeleton for cell-cell communication.
It involve in transport of materials like nutrients, toxic substances.
Thus option D is correct.
Learn more about plasma membrane, here:
https://brainly.com/question/14727404
#SPJ2
define factors affecting enzyme action:temperature
Answer:
I am secondary level student and this doesn't belongs to my coure till yet however..i have written this through google.....you may search there as well..
Explanation:
Enzyme activity occurs within a narrow range of temperatures compared to ordinary chemical reactions. As you have seen, each enzyme has a certain temperature at which it is more active. This point is called the optimal temperature, which ranges between 37 to 40C°...
explain what perlemoen are?
Answer:
Also known as "abalone" which is a
Explanation:
Answer:
any of various edible marine gastropod mollusks of the genus Haliotis
Explanation:
hope this helps
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG
Answer:
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
Explanation:
The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20 nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:
Schematically:
The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:
5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'
The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:
3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'
Which of the following small GTPases are NOT involved in vesicle budding or docking? A. ARF B. Rab1 C. Ras D. Sar1p
Answer:
option c is correct that is Ras
Explanation:
What are two major drivers of surface ocean current and deep ocean current? 1. Surface ocean current 2. Deep ocean current The choices are: A. Differences in water density, resulting from the variability of water temperature and salinity B. Global wind systems
Answer:
1-B 2-A
Explanation:
this is because the wind blowing over the water causes motion whereas deep water is effected by Differences in water density, resulting from the variability of water temperature and salinity
if a wild game animal is slaughtered under usda guidelines can it be prepared and served A:No. A wild game animal can never be served B:Yes a wild game animal can be served C:No wild game animals cannot be eated D:Maybe if you seek usda permission
Answer: C:) No wild game animals cannot be eated
Explanation: hope that helps (:
What part of the brain is known as the pleasure center?
A. Brain stem
B. Hypothalamus
C. Thalamus
D. Midbrain
SUBMIT
Answer:
B. Hypothalamus
Explanation:
The hypothalamus contains the pleasure center of the brain, the nucleus accumbens. The hormone dopamine is released from this part of the brain in response to or anticipation of pleasurable activities such as eating good food, monetary rewards as well as when taking psychoactive drugs.
The release of dopamine affects other feelings such as happiness, focus, being alert as well as staying motivated. it also affect some voluntary actions as well.
Constantly seeking out activities that stimulate dopamine release may lead to addiction to such activities as in drug addiction.
which climate does sparrow live hot or cold
Answer:
Hot ok please give me brilliance
Explanation:
please
what is the key to the recognition of a trait whose expression is determined by the effects of two or more genes
Answer:
Explanation:
Polygenic inheritance occurs when many loci of a gene contributes to it genetic make up.
No particular allele can be selected for contributing to a particular traits all the allele are equally expressed.
Over expressitivity example is pleiotrophy effect have more than 5 fingers or toes
The offspring express more dominant traits that the normal mendelian principle
This signs indicate polygenic inheritance.
Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin. What kind of a cell is this?
Answer:
An animal cell in the telophase
Explanation:
Telophase is one of the stages of cell division in animal cell .
In the animal cell during telophase, Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin because the nuclear membrane and nucleoli reform, cytokinesis is almost coming to completion and the chromosomes eventually uncoil to chromatin. Usually cytokinesis occurs during telophase.
b) How will you describe any three (3) major components of the environment to a named
class puyil?
Answer:
Hydrosphere, atmosphere and biosphere are the three major components of the environment.
Explanation:
Hydrosphere, atmosphere and biosphere are the three major components of the environment. hydrosphere refers to water bodies such as ocean, sea, ponds and lakes etc that is present in our environment. atmosphere refers to the gaseous layer which is present above the earth surface. in this layer oxygen, nitrogen and carbondioxide etc are present. biosphere refers to all living organisms such as human, animals, plants and microbes etc which are present on earth surface..
the origin of a muscle is generally
explain the question more
Answer: The stable and proximal attachment
Explanation:
use the numbers 12345 to place the protien creations steps below in the correct order
Use the numbers 1, 2, 3, 4, and 5 to place the protein creation steps below in the correct order. Ribosome attaches to the mRNA. Information is transcribed in DNA to mRNA. tRNA anticodon carries an amino acid that compliments the mRNA codon. mRNA leaves the nucleus. The chain of amino acids forms a protein.
if it is helpfull please mark as brainlist
Answer:
please list numbers 12345 and then i will
Explanation:
explain why germinating seeds were used in this investigation cellualr respiration
Explanation:
As oxygen is consumed to provide energy, germinating seeds release carbon dioxide. ... HYPOTHESES: The experimental hypothesis is that germinating seeds will show a greater rate of respiration than control glass beads. Additionally, that at higher temperatures, the rate of cellular respiration in the seeds will increase.
In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.
1. The phenotype of the heterozygous plant is_________.
2. The genotype of the heterozygous plant is_________.
3. The genotype of the plant with yellow pods is________.
4. The genotypes of gametes produced by a heterozigous plant is______.
5. The genotypes of gametes produced by a yellow plant is_______.
A. Green pods
B. 75% AA and 25% Aa
C. AA
D. 100% A
E. Yellow pods
F. 50%
G. 25%
H. 100% a
I. 50% A and 50% a
J. Aa
K. 0%
L. 75%
M. 75% A and 25% a
Answer:
1. Green
2. Aa
3. aa
4. A and a
5. a and a
Explanation:
1. The phenotype of the heterozygous plant (Aa) would be green since the allele responsible for green color (A) is dominant over the allele responsible for yellow color (a).
2. The genotype of a heterozygous plant would be Aa. Heterozygous individuals have different alleles for the same gene.
3. The genotype of the plant with a yellow pod would be aa. Since the allele for green color (A) is dominant over the allele for yellow color (a), the yellow color can be expressed only in the absence of the (A) allele. Hence, the genotype fo yellow color has to be aa.
4. The genotypes of gametes produced by a heterozygous plant would be (A) and (a) because heterozygous individuals have two different alleles for a gene.
5. The genotypes of gametes produced by a yellow plant would be (a) and (a) because a yellow plant has the genotype (aa).
g dGDP is made from ________ by the ribonucleotide reductase. This enzyme is inactive when ______ is bound to its master regulatory pocket.
Answer:
1. GTP dephosphorylation
2. hydrolyzed or removed
Explanation:
GDP, (Guanosine diphosphate) is a biological term, that is made of composition including pyrophosphate group, a pentose sugar ribose, and the nucleobase guanine and it is made from GTP ( Guanosine triphosphate ) dephosphorylation by the ribonucleotide reductase. This enzyme is inactive when hydrolyzed or removed, and then eventually bound to its master regulatory pocket.
ASAP When ______ is hydrolyzed, it forms _______. A. protein, amino acids B. ATP, ADP C. polysaccharide, monosaccharide D. lipid, triglyceride
Answer:
The answer is ATP, ADP
Explanation:
When protein is hydrolyzed, it forms amino acids. Thus, the correct option is A.
What is Hydrolysis?Hydrolysis may be defined as a chemical process that utilizes the molecules of water that involve the chemical breakdown of a compound.
Amino acids are the monomers of protein. These amino acids are linked together by peptide bonds. But the process of hydrolysis breaks the peptide bond between the amino acid sequences and released them significantly in free form.
Therefore, when protein is hydrolyzed, it forms amino acids. Thus, the correct option is A.
To learn more about Hydrolysis, refer to the link:
https://brainly.com/question/4352413
#SPJ5