6. If the time period were extended to 6 hours, what would be the expected blood sugar level for
Person B?

6. If The Time Period Were Extended To 6 Hours, What Would Be The Expected Blood Sugar Level ForPerson

Answers

Answer 1

According to the graph, the blood sugar level for person B is 130 mg/dL after 6 hours of eating meal.

The blood sugar level is highest just after eating the meal but with the passage of time, the concentration of blood sugar level decreases due to absorption by the body. One hour after eating the meal, the blood glucose level is slightly decreases but after 6 hours, the blood glucose level tends to very low due to more consumption of the body or storing by the body in different parts.

https://brainly.com/question/24378328


Related Questions

The opposable thumb is a trait that connects us to other primates; allowing us to grab and use tools and increasing chances for survival. This means it is a(n) __________.

Answers

Answer:

The options to this question are;

A. genotype

B. adaptation

C. selective pressure

D. stabilizing pressure

The answer is B) Adaptation

Explanation:

Adaptation is the process whereby an organism becomes well suited to survive in its natural environment, which is aided by the possession of certain traits called adaptive features. For example, the fins of a fish makes it fit to survive in an aquatic environment, likewise the opposable thumbs of humans make us well suited to survive in our environment.

As stated in the question, the opposable thumb i.e. movement of the thumb independently of the other four fingers, is a characteristics of primates. This unique feature (opposable thumb) allows us to grab things, get a good grasp of tools, use tools effectively, write things, etc. All these ability due to the possession of opposable thumb increases our chances of survival. Hence, the possession of opposable thumb is regarded as an ADAPTATION

How do I work this question out I’m struggling

Answers

I think the best thing to do is use a ruler maybe.

Protects the cell and controls what enters and leaves the cell

Answers

Answer:

- Endoplastic reticulum

-cell membrane

-ribosomes

-mithocondrion

^ all the ansers

Explanation:

Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

What is Cell Membrane?

The cell membrane is also called the plasma membrane. It is composed of a semipermeable lipid bilayer that regulates the transport of materials into and out of the cell. It protects the cell and provides a stable environment within the cell, and this membrane serves many functions.

The main function of the cell membrane is to transport nutrients into the cell, while another is to remove toxins from the cell. Cellular membranes are composed of glycerophospholipids, which are molecules composed of glycerol, a phosphate group, and two fatty acid chains.

Thus, Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

Learn more about Cell Membrane, here:

https://brainly.com/question/11906743

#SPJ2

Your question is incomplete, most probably complete question is:

_____Protects the cell and controls what enters and leaves the cell

A) cell wall

B) lysosomes

C)cell membrane

D)Vacuole

Help!!!
I'll give brainliest the brainliest. ​

Answers

Answer:

resists the turgor  pressure of the cell:  A : cell wall

controls the activities of  the cell : C : nucleus

site of the chemical  reactions of the cell  including synthesis of  proteins:  D : cytoplasm

Answer:

1. A -  Cell Wall

2. C - Nucleus

3. B. Mitochondria

Give brainliest

1. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. A phylogenetic tree containing two main branches for evolutionary relationships among the animals.
B. The first branch leads to Drosophila.
C. The second branch divides into two branches, 2a and 2b. Branch 2a leads to Lancelet.
D. Branch 2b divides into two branches: 3a and 3b. Branch 3a leads to Zebrafish.
E. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Frog.
F. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Chicken.
G. Branch 5b divides into two branches leading to Human and Mouse, respectively.
2. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.
B. The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.
C. A frog is the ancestor of both a mouse and a chicken.

Answers

The figure shows a tree diagram with two main branches. The first branch leads to Drosophila. The second branch divides into two branches 3a and 3b. Branch 3a leads to Lancelet. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Zebrafish. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Frog. Branch 5b divides into two branches: 6a and 6b. Branch 6a leads to Chicken. Branch 6b divides into two branches leading to Human and Mouse, respectively.

This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.

The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

A frog is the ancestor of both a mouse and a chicken.

The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.

Answer:

The answer is below

Explanation:

Given the information above, and from the available pictures which showed the detailed analysis of the information presented in the question. It can be concluded that, the nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

Hence, the right answer is option B.

why is it necessary yo separate oxgynated and deoxgynated blood in livng oranisum

Answers

Explanation:

it is necessary in mammals and birds to separate oxygenated and deoxygenated blood because this makes their circulatory system more efficient and helps in maintaining a constant body temperature

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:


Mention the types of bees​

Answers

Answer:

ok thus very good percent few Mohammad khan

john is testing the effect of temperature on the solubility of sugar in water

Answers

Answer:

As John is testing the effect of temperature on the solubility of sugar in water. To test this, he will measure the amount of sugar dissolved at different temperature level.

HELP
In humans, ventilation, digestion, and blood flow are important biological processes. Explain the relationship between the structure of tissues or organs and one of these processes.

Answers

Answer:

I am assuming the question is asking how do the processes relate to one another.

Explanation:

Ventilation happens in the lungs, where carbon dioxide and oxygen are exchanged in the alveoli. This is done via cappilaries that surround the alveoli. Cappilaries are small blood vessels, which are collecitelvy part of the blood flow system (circulation) of the body. In reguards to the digestion, there are capillaries in the vili (which are tiny finger-like structures) so that they can pick up the nutrients during digestion. Another way blood flow and digestion are connected is because the stomach is a muscle, thus is moves and requires energy. That energy comes from the oxygen and nutrients that is supplied by the blood. These are just some examples.

carbohydrate are store in animal cell in the form of​

Answers

Answer:

molecule glycogen

Plants store carbohydrates in long polysaccharides chains called starch, while animals store carbohydrates as the molecule glycogen.

Glycogen molecule, which is found in the cytosol of the cell

1. Viruses such as avian (bird) flu and swine flu that mutate and can spread from animals to human populations are known as what?
O A. Vectors
O B. Transmuting viruses
O C. Epidemics
O D. Zoonoses

Answers

Answer:

B

Explanation:

they are transmuting viruses

B. Transmuting viruses is the answer

Which of the following are all examples of pollution
Pesticide Run-off
Desertification
Global Warming
Poaching
Burning of Fossil Fuels

Answers

Burning fossil fuels

if you think about fat as old stuff,what new stuff can be made from it

Answers

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

Fat is derived from plant and animal sources. They include seeds, fruits, fatty fish.

Fats serve as a source of energy in organisms and also serve as insulation.

If you think about fat as old stuff,what new stuff can be made from it means of the things fats can be made from and they include Paints, Lubricants, Biofuel, Face cream, Soap etc. These products are manufactured in industries on a large scale due to their high demand.

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

A possible answer to a scientific question that can be tested is a

Answers

The key to a good and manageable investigation is to choose a topic of interest, then ask what is called a “testable question.” Testable questions are those that can be answered through hands-on investigation by the student.

Which of the following statements is true?

Photosynthesis is a type of homeostasis.
Unicellular organisms have differentiated cells.
Respiration is a type of metabolism.
Multicellular organisms are made of only one cell.

Answers

Answer:

Respiration is a type of metabolism.

Answer:

C. Respiration is a type of metabolism

Explanation:

Both B and D are incorrect because:

Multicelluar organisms have more than one cell; while singlecelled organisims only have one cell.

Also, homeostasis is a natural way an organisms body reacts to different situations, like when you sweat, your body is realising a way to lower the heat in your body. Therfore, A. is also incorrect.

Hope this helped!

A molecule will become an ion when which of the following happens?

Answers

Loses or gains a charge

The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the likelihood that an organism could become extinct. Which of the following could also increase an organism's chances of extinction? A. an increase in predation, competition, and/or disease B. a lack of genetic diversity in an organism's species C. the inability to reproduce D. all of these

Answers

Answer:

D

Explanation:

all of those are likely to increase an organisms chances of extinction

how does the cell wall contributes towards maintaining homeostasis in the cell​

Answers

Answer:

The water wants to flow from the higher concentration, which is outside of the cell, to the lower concentration, which is inside of the cell. The cell membrane helps to regulate and slow down the flow of water into the cell. This is yet another way that the cell membrane helps maintain homeostasis.

I hope it helps ❤️

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

Why is it necessary to separate oxgynated blood and deoxgynated blood in living organisums?

Answers

Answer:

For efficient transportation of blood.

Explanation:

-gene 1
-gene 2
-gene 3
How are these three genes related?

Answers

Answer:

Depends on the locations of these gene segment on the chromosome whether it be found on the same or different.

It can either be linked or unlinked.

Name 2 features/tools in Drive that makes it easy to collaborate on assignments?

Answers

1. Live action
It shows what people are editing on your assignment so that you know what they have changed on it
2. Comments
When people have a suggestion, all they simply do is comment
Hope this helped! If it did, please mark as brainiest!

What factor about cellular respiration are you testing? ( what makes the three bottles different?)

Answers

Answer:

Gas.

Explanation:

Gas which is present makes the three bottles different from one another. There are three factors which is used for testing of cellular respiration such as amount of oxygen consumed during this process, amount of glucose used and amount of carbondioxide produced during cellular respiration. During cellular respiration, oxygen used in order to break down glucose and releases high amount of energy with the waste materials such as carbondioxide gas.

What can you learn about by studying DNA?

Answers

Answer:

Explanation:

                  The study of human DNA and genetics can be intellectually fascinating, but it also has plenty of practical applications. From the use of DNA in court cases to the discovery of new therapies for genetic diseases, a thorough understanding of the human genome can have important medical, social and legal impacts.

When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. glycolysis; dihydroxyacetone phosphate the electron transport system; coenzyme Q glycolysis; fructose-6-phosphate the citric acid cycle; pyruvate the citric acid cycle; acetyl CoA

Answers

Answer:

 glycolysis; dihydroxyacetone phosphate

When fats are used as an energy source, the glycerol portion enters the glycolysis when it has been converted to dihydroxyacetone phosphate. Thus, the correct option is A.

What is the Glycolysis?

Glycolysis may be defined as the process in which glucose (sugar) is partially broken down by cells in enzyme reactions that do not need oxygen.

In order to obtain energy from fats, triglycerides must be broken down into fatty acids and glycerol through hydrolysis. The fatty acids enter to Krebs cycle and are converted into acetyl CoA.

While the glycerol portion enters into glycolysis and is converted into dihydroxyacetone phosphate.

Therefore, the correct option for this question is A.

To learn more about Glycolysis, refer to the link:

https://brainly.com/question/737320

#SPJ2

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Why does the land around a once active coal mine remain barren?
A: Toxic nitrous oxides were released into the soil killing all plants.
B: C: Ozone is formed from hydrocarbons which prevent the growth of plants.
Please don't just take points. Thank you and have a good day

Answers

Hello!!

The answer is A. Toxic nitrous oxides were releassed into the soil killing all plants

Answer:

Empty coal mines are flooded with acid rain so no life forms can survive.

Explanation:

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

Other Questions
The law of conservation of momentum states that the total momentum of interacting objects does not _____. This means the total momentum _____a collision or explosion is equal to the total momentum _____ a collision or explosion. Poetry _____. appeals to the reader's emotions tends to say a lot in a small space uses metaphors to make comparisons between unlike thing all of these Celine is Drakes granddaughter. Her age is 4 years greater than of Drakes age. If Celine is 28 years old, how old is Drake? The distance between two points on a number line can be found by taking the ____A_____ of the ____B_____ of the coordinates. Fill in the blanks in the previous sentence by matching the letter for each blank with the correct answer. A company purchased 400 units at $75 per unit. The company sold 385 units. what is the cost of goods sold and ending inventory Add :-a+2b-3c, -3a+b+2cand 2a -3b+c 1, 1, 1, 1, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 89, 89, 89, 89, 89 At what percentile is 34? Please write 2 sentences. 1. Shows an example of 1st person point of view. 2. Shows an example of 3rd person point of view. critically discuss the rise of Afrikaaner Nationalism in SA Michael Bilkman has an opportunity to buy a perpetuity that pays $12,450 annually. His required rate of return on this investment is 13.25%. At what price would Michael be indifferent to buying or not buying the investment? Round off to the nearest $1.Select one:a.$170,877b.$93,962c.$83,470d.$121,709 Certain closing costs will be prorated to account for the period of time during which the seller occupied the house. If a transaction is scheduled to close on September 21 (236 days into a 365-day year), calculate the amount that the buyer will be credited if the particular closing cost in question is estimated to be $1,569 for the entire year Line f has a slope of 6/3, and line g has a slope of 8/4. What can be determined about distinct lines f and g a.The lines are parallel. b.Nothing can be determined about the lines from this information. c.The lines have proportional slopes. d.The lines will intersect. There are 25 peanut candies in a bowl. 4 red, 3 orange, 4 yellow, 5 green, 6 blue and 3 brown. what is the probability of randomly choosing a blue candy from the bowl? Socialism solution to all problems out of the 444 Fridays Rebecca has been driven to school, only 12/37 of the time did she ever choose to sit in the back seat. How many times did she sit in the front seat? "A prospective customer has been solicited by a registered representative, and prior to opening an account, the customer wishes to check on the disciplinary background of that registered representative. Which statement is TRUE?" What were the reasons the French Natives were fighting the British during the Frenchand Indian War? Explain in one paragraph. 2. A parallel-plate capacitor has a capacitance of C. If the area of the plates is doubled andthe distance between the plates is doubled, what is the new capacitance?A) C/4B) C/2C)CD) 4C Find the value of the expression x3y3+x2+y2+3 by substituting x=2 and y=1. How do I solve this?