Answer:
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
Explanation:
The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20 nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:
Schematically:
The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:
5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'
The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:
3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'
What happen to the cell if nucleus is removed?
If the nucleus is removed from the cell, the cell will die as the nucleus is the living component of the cell.
Hope you understand❣
Answer:
Nucleus is the boss of the cell who control all the activities take place in the cell . so if the nucleus is not there no process will be taken and the cell will die .
Hope i helped u mate.
The field of inquiry that studies human culture and evolutionary aspects of human biology; includes cultural anthropology, archeaology, linguistics, and physical, or biological anthropology. __________
Answer:
physical, or biological anthropology.
Explanation:
When there is a need to study human kind through the X-ray of relationships between human biology, its cultural diversity, and evolution ,the aspect anthropology for this is Biological anthropology.
Therefore biological anthropology is concerned about how the interaction between the cultural diversity and biological process results in the adaptations of mankind to different environments.The influence of these on growth, behaviours, existence.
The primary focus of biological anthropologists is to study in details the concept of ,mechanism of variation, adaptation.and how these lead to evolution and origin of mankind.
Sequel to this ,most evidences for this concept are obtained from the study of fossil materials,study of other related primates to man, and components of functional biology and genetics.
In prokaryotic cells, regulator proteins bind to a section of DNA called alan (1 point)
O repressor
o promoter
O chromatin.
o operon.
Answer:
promoter
Explanation:
Answer: Operon
Explanation:
How green is green energy?
Answer:
Green energy is important for the environment as it replaces the negative effects of fossil fuels with more environmentally-friendly alternatives. Derived from natural resources, green energy is also often renewable and clean, meaning that they emit no or few greenhouse gases and are often readily available.
A client reports extremely frequent urination, sometimes urinating 10 to 12 times each day.
What fluid balance disorder would be expected with these symptoms?
Answer:
Lack of Antidiuretic hormone.
Explanation:
Antidiuretic hormone is a type of hormone which is responsible for controlling urination. It is produced in hypothalamus which is a part of a brain. Antidiuretic hormone is responsible to tell the kidney how much water in the body should be conserve to avoid dehydration. If less antidiuretic hormone is produced by the body so more urine is produced. Frequent urination is also occurs due to Diabetes insipidus. This disease produce more urination in order to control the concentration of glucose in the blood.
Which statement applies only to the axial skeleton not the appendicular skeleton
If the Gulf Stream stopped running, how would the climates of North America and Europe be affected?
Answer: Land would become infertile, habitat loss, & environmental changes
Explanation:
Because there wouldn't be alot of water to keep the soil moist, therefore the ground would begin to harden and get dry. :)
If the Gulf Stream stopped, the climates of North America and Europe would be colder and drier.
The gulf stream is a huge current of warm and fast-moving ocean water. This ocean current plays a key role in regulating temperatures across the globe and has an impact on the frequency and intensity of storms and rainfall. The collapse and stoppage of this stream will cause an array of problems, including but not limited to:
Reduced rainfallLower temperaturesFewer stormsAreas that would be particularly affected by this are North America and Europe. This is due to the direction that the gulf stream flows, carrying warm water along these boundaries.
The vast amount of warm water carried by this stream explains how it is able to affect the average temperatures of these coastal areas, with the disappearance of the stream, temperatures in North America and Europe would initially decrease.
The warm water carried by this current is also responsible for increased rainfall. Warm water on the surface of the ocean is heated by the sun and evaporates, creating clouds, which then provide rain. The absence of this current would dramatically affect cloud formation and reduce the amount of rain severely. This can lead to droughts and reduced agriculture.
Though Fewer storms may seem like a positive impact, it is not entirely. Storms play a crucial part (together with ocean currents) in regulating global temperatures, as well as provide a source of rainfall to end droughts and promote biodiversity in areas that depend on water and humid climates.
The gulf stream is important for maintaining climates and rainfall. If it were to stop, climates in North America and Europe would be colder and drier.
For more information on ocean currents visit:
https://brainly.com/question/377571?referrer=searchResults
what are the advantage of the presence of hydrogen in large scale in the sun ?
hydrogen is essential to nuclear fusion. hydrogen is the fuel the sun burns. we don't have to burn solar energy, so there's no smoke and pollution
Answer:
Hydrogen fusion reaction is the one which provides so much light and heat (in short, energy) which escapes into space and spread. If Hydrogen on sun ends, It will lose its warmth (and may be soon become a planet, but will surely be a dead star).
Explanation:
Answer from Gauth math
Please help me with this.
Answer:
natural selection is the answer
In the DNA isolation process, cells are mixed with sodium chloride (i.e. NaCl) because the sodium (Na ) neutralizes the negative charge of DNA.
a. True
b. False
Answer:
this is true it neutralise easily
It is true that in the DNA isolation process, cells are mixed with sodium chloride (i.e. NaCl) because the sodium (Na ) neutralizes the negative charge of DNA.
What is DNA isolation?DNA extraction is a method of separating DNA from cell membranes, proteins, and other cellular components using physical and/or chemical methods from a sample. In 1869, Friedrich Miescher isolated DNA for the first time.
The ability to extract DNA is critical for studying the genetic causes of disease and developing diagnostics and drugs.
It is also required for forensic science, genome sequencing, detecting bacteria and viruses in the environment, and determining paternity.
Because sodium (Na+) neutralizes the negative charge of DNA, cells are mixed with sodium chloride (i.e. NaCl) during the DNA isolation process. It makes homogenization easier.
Thus, the given statement is true.
For more details regarding DNA isolation, visit:
https://brainly.com/question/13126093
#SPJ2
Squamous cells specialize in what function? A) the secretion of enzymes B) diffusion of gasses C) the absorption of nutrients D) none of the above
Answer:
The abosbton of nutrients
Como harías para ver microorganismos del suelo con plantas y del suelo sin plantas
Answer:
i didn't understand what you told
What type of transmission occurs when a pathogen is spread though sneezing or coughing
Answer:
air transmission
Espero que te sirva
Imagine that plaque uniformly coats the walls of the blood vessel in the diagram. Based on the diagram, what is the reduced area inside the blood vessel? Round your answer to the nearest tenth. The equation for the area of a circle is A = πr2, where A is area, π ≈ 3.14, and r is the radius. Recall that the radius is half of the diameter.
Hello. You forgot to put the image that complements this question.
The image is attached below:
Answer:
A = 38.465.
Explanation:
To arrive at the result you will have to perform a very simple calculation, using the fromula shown in the question above.
First, it will be necessary to find the diameter of the figure, to
therefore, you will have to divide, which will result in 3.5.
You can now replace the values in the formula: A = (3.14) (3.5) ² = (3.14) (12.25)= 38.465.
Answer:
12.56
Explanation:
Which two Neolithic activities came about because of climate change?
Answer:
1. Domesticating animals
2. Farming grains
Explanation:
Poeple started doing these without machines because of climate change.
The maps below represent the same area of the Amazon rainforest over an 8-year period as humans moved into the rainforest. Forested areas are shown in deep green, and cleared areas are tan (bare ground) or light green (pasture land). Which of the following statements is best supported by evidence from the maps? A. This area became more densely populated with trees between 2000 and 2008. B. Humans living in this area began an extensive forest restoration program between 2000 and 2008. C. Humans began leaving this area to find jobs in nearby cities between 2000 and 2008. D. This area changed appearance between 2000 and 2008 because trees were cleared.
Answer:
D.)
Explanation:
am smart
Answer:
D. This area changed appearance between 2000 and 2008 because trees were cleared
Explanation:
I got it right on study island
Consider that a certain gene is a maternal effect gene and that the allele for dark brown pigment is incompletely dominant to the allele for no pigment (white). The incomplete dominant phenotype is light tan. If a white female is crossed with dark brown male, what will be the phenotypic ratio of the progeny?
A) all white
B) all dark brown
C) all light tan
D) either all white or all light tan
E) either all light tan or all dark brown
F) none of the above choices (cannot be determined)
Answer:
The correct answer is C. All light tan
Explanation:
You will find the answer and explanation in the attached file due to technical problems.
I 4. Rewrite the sentence correctly. “All the organelles shown in the typical plant or animal cell will exist in every cell”.
All the genetic materials shown in the typical plant or animal cell will exist in every cell”.
HOPE SO IT HELPS YOU
The backbone vertebrae, skull, and rib cage make up the _______ skeleton. Among other types of cells, bone marrow produces _______ blood cells, which carry oxygen in the blood. _______ can eventually become osteocytes. If bones rapidly deconstruct faster than new bone tissue grows, this can lead to less dense and more fragile bones. When severe, this condition is called _______. _______ such as the MCL and ACL connect bone to other bone at joints.
ANSWERS :
1.axial
2. red
3. Osteoblasts
4. osteoporosis
5. Ligaments
6. Osteoblasts are cells that build bone tissue, and are called osteocytes when they become surrounded by the bone that they have built. Osteoclasts are cells that break down bone tissue. The building and breaking down of bone tissue continues throughout a person’s lifetime and makes bones strong. If osteoclasts break down more bone than osteoblasts build, this can lead to osteopenia and osteoporosis, causing bones to be fragile and break more easily.
Answer:
1. axial
2. red
3. Osteoblasts
4. osteoporosis
5. Ligaments
Explanation:
The axial skeleton consists of the bones of the head and trunk of a vertebrate including skull, and rib cage.
Bone marrow produces red blood cells, which carry oxygen in the blood.
Osteoblasts can become osteocytes, which are the third type of bone cells.
Osteoporosis is a bone resorption disease in which bones rapidly deconstruct faster than new bone tissue grows, and decreases the mechanical strength of bones.
Ligaments connects one bone to other at joint such as medial collateral ligament (MCL) and anterior cruciate ligament (ACL) that joins knee.
Hence, the correct answer for the question is as follows:
1.axial
2. red
3. Osteoblasts
4. osteoporosis
5. Ligaments
Answer:
1. axial
2. red
3. Osteoblasts
4. osteoporosis
5. Ligaments
6. Osteoblasts are cells that build bone tissue, and are called osteocytes when they become surrounded by the bone that they have built. Osteoclasts are cells that break down bone tissue. The building and breaking down of bone tissue continues throughout a person’s lifetime and makes bones strong. If osteoclasts break down more bone than osteoblasts build, this can lead to osteopenia and osteoporosis, causing bones to be fragile and break more easily.
Explanation:
Penn Foster
Match each term with the best description.
a. Membrane-bound structure that supports energy production.
b. Semi-permeable, living covering of the cell.
c. Long, whip-like appendage used for locomotion.
d. Membrane-bound structure containing the hereditary material of the cell.
e. Gel-like substance encompassing the contents of the cell
f. Basic structural and functional unit of living orgaisms
1. Cell
2. Cell membrane
3. Cytoplasm
4. Flagellum
5. Mitochondrion
6. Nucleus
Answer:
a) 5. mitochondrion
b) 2. cell membrane
c) 4. flagellum
d) 6. nucleus
e) 3. cytoplasm
f) 1. cell
ASAP Why is ATP used as an active energy source over glucose? A. It is more abundant in food sources. B. It releases its energy quickly in a single reaction. C. It releases its energy slowly through multiple reactions, allowing it to last longer. D. It has more energy.
Answer:
B.
Explanation:
Glucose is an organic molecule that stores ATP or energy while Adenosine triphosphate (ATP) is an energy-carrying molecule.
ATP used as an active energy source over glucose because ATP is a shorter process and releases energy in a single reaction as glucose first converted into ATP and then used as energy in cellular respiration.
Hence, the correct option is "B".
Describe at least 2 benefits and 2 drawbacks there might be for animal cells (including humans) to make their own food through photosynthesis.
Answer:
Explanation:
Benefits
Animals will not depend on plant source again for their food but have it produced directly by themselves because photosynthesis will allow animal produce their own food
Animal will get a direct source of energy for their activities. Energy is derived from food consumed after the food has been broken down in the body system of animal. Animal photosynthesis will give animals access to direct source of energy as the product their food.
Demerit
Animal lacks chlorophyll the green. Pigment in plant that light hit on absorption that will enable them to photosynthesis.
Animal lacks ways or mechanism of regulating Carbondioxide in take as in the case of C4 plant and crassulacean metabolic pathway (CAM).
Animals such as human will not have access to varieties of food but stick to photosynthate produced by them.
Given the gene sequence GGACCGTCGATCTTC, which of the following choices would represent an inversion mutation? A. GGACTCGATCTTC B. CCACCGTCGATCTTC C. GGACCGTCGATCTTC D. GGACCGTCGATCCTT
Answer:
D. GGACCGTCGATCCTT
Explanation:
Mutation refers to any change in the nucleotide sequence of a gene. Mutation can be of different types depending on how it occurs. According to the question, an INVERSION mutation is a type of mutation in which a segment of a gene gets broken off and reattached in another way on the same DNA. Hence, the only change in inversion mutation is the arrangement of the nucleotide bases on the gene.
Considering the nucleotide sequence: GGACCGTCGATCTTC, the sequence that describes an occurrence of inversion mutation is: GGACCGTCGATCCTT because the segment TTC in the original sequence has been rearranged as CTT in the mutated sequence.
Answer: GGACCGTCGATCCTT
Explanation: mutation means change and there is change in the gene sequence
While cooking, Lisa spills boiling water on her hand. Her skin turns blotchy with blisters. Which type of burn does she have? A. first-degree burn B. second-degree burn C. third-degree burn
Answer:
B
Explanation: First degree only makes the skin turn red
Which of the following can a chemical bond do?
A. Change element properties
B. Store energy
OC. All of these
D. Release energy
The following can a chemical bond do is all of these. The correct option is C. All of these.
What is a chemical bond?A chemical bond is a bond formed between two elements. The energy of the reaction is stored in the bonds when the reaction happens, the energy is released from the bonds. It also changes the chemical properties of the elements.
Thus, the correct option is C. All of these.
Learn more about chemical bond
https://brainly.com/question/26176140
#SPJ2
You perform a test cross of the dihybrid AaBb and score the phenotypes of 1000 progeny. Assuming independent assortment, how many of the progeny do you expect to display the dominant phenotype for both the A and B genes?
Answer:
4
Explanation:
The number of progeny expected to display the dominant phenotype for both the A and B genes should be 4.
A test cross usually involves crossing an individual whose zygosity is in doubt with an individual that is recessive for both alleles so as to ascertain the zygosity of the former. Hence, for a test cross involving AaBb:
AaBb x aabb
Progeny:
4 AaBb
4 Aabb
4 aaBb
4 aabb
Therefore, the number of progeny expected to display the dominant phenotype for both the A and B genes is 4.
How are red blood cells able to move through narrow vessels to carry oxygen throughout a multicellular organism? (1 point) a)They are flexible because they lack a plasma membrane. b)They are small because they lack a nucleus. c)They are long and thin with a tail-like end. d)They are small because their organelles are smaller than those of other cells.
Answer:
The correct answer is - option B. They are small because they lack a nucleus.
Explanation:
Red blood cells or erythrocytes are specialized cell that produce in bone marrow and have specific role such as carrying oxygen from lungs to deliver it to the various organs and carry out carbon dioxide.
In mammals these cells lack cell organelles such as nucleus and mitochondria, a major factor that determined its smaller size. The size of RBC are move through narrow vessels throughout a organism because of its specific size and shape that provide it space for hemoglobin and allow to be flexible and bend to move through narrow vessels.
Thus, the correct answer is : option B. They are small because they lack a nucleus.
Professor George Palade’s elegant experiment to follow protein synthesis and trafficking, published nearly 60 years ago, provided us with a great deal of information and has been used as a tool by several investigators. If you had access to all the reagents needed to repeat the in vitro experiment, describe what you would need to do to see the progression of newly synthesized proteins and their transport in the cell.
Answer:
The interpretation including its particular topic is demonstrated in the following portion on the interpretation.
Explanation:
After experiments with Guinea Pigs, Palade transitioned to anything in vitro research in which sections of pancreatic tissue had all been subjected to a pulsed radioactive lysine for something like a shorter amount of time. The radiation leucine pulse must have been subsequently adopted with nonradioactive leucine, as well as the pieces have been fixed but instead analyzed besides electron microscopy as well as transmission line during some different points in time.Effects from either the radioactive elements with leucine throughout the reflective coating surrounding the tissue fragments formed autoradiographic particles.Such granules eventually passed forward towards the Golgi throughout corresponding different points in time, as well as subsequently towards the cell membranes, whereby they seemed equipped for induction as established zymogen granulates.What is the function of bile in the digestion of fats in the small intestine?
Answer:
Bile is a fluid that is made and released by the liver and stored in the gallbladder. Bile helps with digestion. It breaks down fats into fatty acids, which can be taken into the body by the digestive tract.
Explanation:
When digesting fats, bile acts as an emulsifier to break the large fat globules into smaller emulsion droplets. Emulsified fats provide a larger area for the fat-digesting enzymes (lipase) to act, making the process quicker. Bile acts as a good solvent.
This category of plants does not have vascular tissue or seeds. Question 3 options: Angiosperms Gymnosperms Ferns Mosses
Answer:
Mosses
Explanation:
Mosses are the category of plants that does not have vascular tissue or seeds while angiosperm, gymnosperms, and ferns have vascular tissues and seeds.
Due to absence of vascular bundles or veins, the mosses also lack stems, true roots, and leaves. some of the examples of mosses are: liverworts, hornworts, and Ricceia natans etcetera.
Hence, the correct answer is "Mosses".
Answer:
Mosses
Explanation:
Mosses are the category of plants that do not have vascular tissue or seeds. Ferns do not have seeds, but do have vascular tissues. Angiosperms and gymnosperms have vascular tissue and seeds.