Christina has $103 earned from babysitting saved at home, and the amount is modeled by the function h(x) = 103. She reads about a bank that has savings accounts that accrue interest according to the function s(x) = (1.03)^(x-1). Explain how Christina can combine the two functions to model the total amount of money she will have in her bank account as interest accrues after she deposits her $103. Justify your reasoning.

Answers

Answer 1

Answer:

→To combine the two functions, you have to multiply them together, like so:

h(x) · s(x)

→This can also be shown as:

[tex](103)(1.03)^x^-^1[/tex]

The reason as to why you would multiply the two functions together, and not add, is because of the words accrues. Based on the information given, the interest amount of money, which is $103, accrues, which basically means that the money will increase in a pattern, over time. In addition, when a world problem involves a bank and money, multiplication is usually occurring.

Answer 2

The total amount of money Christina will have in her bank account as interest accrues after she deposits her $103 is g(x) = (103)(1.03)^(x-1).

What is simple interest?

Simple interest is the amount charged on the principal amount with a fixed rate of interest for a time period. Simple interest calculated only on the principal amount.

Christina has $103 earned from babysitting saved at home, and the amount is modeled by the function,

[tex]h(x) = 103[/tex]

She reads about a bank that has savings accounts that accrue interest according to the function,

[tex]s(x) = (1.03)^{(x-1)}[/tex]

This function means that the interest amount is 3% in value per year in which x represent the number of years.

Now the total amount of money she will have in her bank account as interest accrues will be equal to the product principal and interest rate.

Let the amount of money she will have in her bank account as interest accrues is represented by function g(x). Thus,

[tex]g(x) = (103)(1.03)^{(x-1)}[/tex]

Thus, the total amount of money Christina will have in her bank account as interest accrues after she deposits her $103 is.

[tex]g(x) = (103)(1.03)^{(x-1)}.[/tex]

Learn more about the simple interest here;

https://brainly.com/question/2294792


Related Questions

If the production rate is 975 brownies per hour at a bakery, how many brownies will be produced in an 8 hour shift?

Answers

Answer:

7800 brownies will be produced in an 8 hour shift

Step-by-step explanation:

Given : The production rate is 975 brownies per hour at a bakery

To Find :  how many brownies will be produced in an 8 hour shift?

Solution:

No. of brownies produced in 1 hour = 975

We are supposed to find No. of brownies produced in 8 hour

No. of brownies produced in 8 hour =  975 x 8=7800

Hence 7800 brownies will be produced in an 8 hour shift

Hope this helps ФωФ

PLS HELP ME ON THIS QUESTION I WILL MARK YOU AS BRAINLIEST IF YOU KNOW THE ANSWER!!

Answers

Answer: will be A

Step-by-step explanation:

The most reasonable answer would be A

Mary spent $45 at the mall. She bought lunch for $9. She bought 3 shirts at
each. Which of the following equations could be used to find x ?

Answers

Answer:

x = 12

Step-by-step explanation:

If Mary spent $45 altogether,

then she bought lunch for $9

so our equation now is

$45 = $9 + 3x

It is 3x because he bought 3 shirts and we used x because we didnt

now how much the price of those shirts were

$45 = $9 +3x

$45 - $9 = 3x

$45 - $9 = $36

$36 = 3x

$36 / 3 = 12

x = 12

Please mark this answer as the brainliest

How do I write a verbal expression for each algebraic expression?

23f

Answers

Answer:

Twenty three times f

Step-by-step explanation:

Given 4,7,10,13. Determine a rule to describe the general term, Tn.​

Answers

Answer:

[tex]T_{n}[/tex] = 3n + 1

Step-by-step explanation:

There is a common difference between consecutive terms, that is

7 - 4 = 10 - 7 = 13 - 10 = 3

This indicates the sequence is arithmetic with nth term

[tex]T_{n}[/tex] = a₁ + (n - 1)d

where a₁ is the first term and d the common difference

Here a₁ = 4 and d = 3 , then

[tex]T_{n}[/tex] = 4 + 3(n - 1) = 4 + 3n - 3 = 3n + 1

Simplify 18-2[x + (x - 5)].
O8-4x
28 - 4x
28 - 2x

Answers

Answer:

28-4x

Step-by-step explanation:

Step 1: Open most inner bracket and simplify

=18-2(x+x-5)

=18-2(2x-5)

Step 2: Expand brackets by multiplying 2 in and simplify

=18-2(2x)-2(-5)

=18-4x+10

=28-4x

Therefore the answer is 28-4x

Wo commondities A and B cost 070 and D80 respe
with 26 kg of B and the mixture issold at 085 per kg: calo
The weight (in kg) of 50 contenstants at a competition is
65 66 67 66 64 66 65 63 65 68
64 62 66 64 67 65 64 66 65 67
65 67 66 64 65 64 66 65 64 65
66 65 64 65 63 63 67 65 63 64
66 64 68 65 63 65 64 67 66 64
a. construct a frequency table for the discrete data
b. calculate, correct to 2 decimal places, the
mean,
ii. standard deviation of the data​

Answers

Answer:

b) 65.08

ii) 0.75

Step-by-step explanation:

x(Kg):                  62      63     64     65     66     67     68

Frequency(f):      1          5        11       15      10     6        2

           xf:           62       315    704    975  660  402    136

b) mean(X) = ∑xf/N = 3254/50 = 65.08

c) x - X :          -3.08    -2.08    -1.08    -0.08        0.92   1.92    2.92

   (x - X)²:        9.49     4.33      1.17       0.0064    0.85   3.69    8.53

ii) Standard deviation(S.D.):  √(∑(x - X)²/N = √(28.0664)/50 = √0.5613

 ∴ S.D.= 0.75

Geometry, please answer my question ASAP

Answers

Answer:

98 degrees

Step-by-step explanation:

The angles of a quadrilateral add up to 360 degrees, therefore:

(25x+1)+(25x-2)+(20x-1)+82=360

70x +80=360

70x=280

x=4

the angle at C:

25*4-2 = 98 degrees

I WILL GIVE U BRAINLIST AND A THANK YOU PLS ANDWER!!!!!!!!!

Answers

Answer:

yes it is proportional because you don't buy the popcorn

Answer:

A. Yes.

Step-by-step explanation:

Since you never buy popcorn, the only thing you buy are movie tickets. The only thing contributing to the total price are the movie tickets, so the total price is proportional to the number of movie tickets purchased.

Hope this helps!

lowkey need help with this.

Answers

9514 1404 393

Answer:

  c = 14

  no extraneous solutions

Step-by-step explanation:

You can subtract the right-side expression, combine fractions, and set the numerator to zero.

  [tex]\dfrac{c-4}{c-2}-\left(\dfrac{c-2}{c+2}-\dfrac{1}{2-c}\right)=0\\\\\dfrac{c-4}{c-2}-\dfrac{1}{c-2}-\dfrac{c-2}{c+2}=0\\\\\dfrac{(c-5)(c+2)-(c-2)^2}{(c-2)(c+2)}=0\\\\\dfrac{(c^2-3c-10)-(c^2-4c +4)}{(c-2)(c+2)}=0\\\\\dfrac{c-14}{(c-2)(c+2)}=0\\\\\boxed{c=14}[/tex]

__

Check

  (14 -4)/(14 -2) = (14 -2)/(14 +2) -1/(2 -14) . . . . substitute for c

  10/12 = 12/16 -1/-12

  5/6 = 3/4 +1/12 . . . . true

There is one solution (c=14) and it is a solution to the original equation. There are no extraneous solutions.

If a quadratic equation is written in intercept form, y = (x-3)(x+5), then vertex is at...

Answers

Answer:

The vertex is at (-1, -16).

Step-by-step explanation:

We are given the quadratic equation:

[tex]y = (x-3)(x+5)[/tex]

And we want to find its vertex.

Recall that the x-coordinate of the vertex is also the axis of symmetry. Since a parabola is symmetric about the axis of symmetry, the axis of symmetry is halfway between the two roots.

From the equation, we can see that our two roots are x = 3 and x = -5.

Hence, the axis of symmetry or the x-coordinate of the vertex is:

[tex]\displaystyle x = \frac{(3) + (-5)}{2} = -1[/tex]

To find the y-coordinate of the vertex, evaluate the equation at x = -1:

[tex]\displaystyle \begin{aligned} y(-1) &= ((-1)-3)((-1)+5)\\ &= (-4)(4) \\&= -16\end{aligned}[/tex]

Hence, the vertex is at (-1, -16).

The function f is defined by the following rule
f (x) - 5+1
Complete the function table.
-5
-1
0
2
3​

Answers

Answer:

The answer to your question is given below.

Step-by-step explanation:

1. f(x) = 5x + 1

x = – 5

f(x) = 5x + 1

f(–5) = 5(–5) + 1

f(–5) = –25 + 1

f(–5) = –24

2. f(x) = 5x + 1

x = – 1

f(x) = 5x + 1

f(–1) = 5(–1) + 1

f(–1) = –5 + 1

f(–1) = – 4

3. f(x) = 5x + 1

x = 1

f(x) = 5x + 1

f(1) = 5(1) + 1

f(1) = 5 + 1

f(1) = 6

4. f(x) = 5x + 1

x = 2

f(x) = 5x + 1

f(2) = 5(2) + 1

f(2) = 10 + 1

f(2) = 11

5. f(x) = 5x + 1

x = 2

f(x) = 5x + 1

f(3) = 5(3) + 1

f(3) = 15 + 1

f(3) = 16

Summary

x >>>>>>>> f(x)

–5 >>>>>> – 24

–1 >>>>>> – 4

1 >>>>>>>> 6

2 >>>>>>> 11

3 >>>>>>> 16

For a data set of the pulse rates for a sample of adult​ females, the lowest pulse rate is 31 31 beats per​ minute, the mean of the listed pulse rates is x overbar x equals = 71.0 71.0 beats per​ minute, and their standard deviation is s equals = 12.6 12.6 beats per minute.

Answers

Complete question is;

For a data set of the pulse rates for a sample of adult​ females, the lowest pulse rate is 31 beats per​ minute, the mean of the listed pulse rates is x over bar equals 71.0 beats per​ minute, and their standard deviation is s equals 12.6 beats per minute.

a. What is the difference between the pulse rate of 31 beats per minute and the mean pulse rate of the​ females?

b. How many standard deviations is that​ [the difference found in part​ (a)]?

c. Convert the pulse rate of 31 beats per minutes to a z score.

d. If we consider pulse rates that convert to z scores between minus 2 and 2 to be neither significantly low nor significantly​ high, is the pulse rate of 31 beats per minute​ significant?

Answer:

A) 40 beats per minute

B) 3.1746

C) z = -3.17

D) the pulse rate of 31 beats per minute is significantly low.

Step-by-step explanation:

A) The mean pulse rate is given as x bar = 71

Thus difference between this and pulse rate of 31 beats per minute is;

Difference = 71 - 31 = 40 beats per minute

B) number of standard deviations of the difference found in part a is given as;

number = difference/standard deviation(s)

number = 40/12.6

number = 3.1746

C) The z-score is calculated from;

z = (x - xbar)/s

z = (31 - 71)/12.6

z = -3.17

D) from the question we are told that the z scores between minus2 and 2 to be neither significantly low nor significantly​ high. However, we have a Z-score of -3.17 which doesn't fall into that range. Thus, the pulse rate of 31 beats per minute is significantly low.

Help me with this question please‼️‼️

Answers

Answer: 1/2  (choice C)

Explanation:

The gradient is the same as the slope

m = slope

m = rise/run

m = (change in y)/(change in x)

m = (y2-y1)/(x2-x1)

m = (6-1)/(6 - (-4))

m = (6-1)/(6+4)

m = 5/10

m = 1/2

In decimal form, this becomes 0.5

A slope of 1/2 means we move up 1 and to the right 2 units each time to generate points along the diagonal line.

A positive slope goes uphill as we move to the right (due to the positive rise value).

Answer:

One way to find the gradient is using the expression :

[tex]m = \frac{y_{2} - y_{1}}{x_{2} - x_{1}} = \frac{y_{B} - y_{A}}{x_{B} - x_{A}}[/tex]

So [tex]m = \frac{6 - 1}{6- (-4)} =\frac{5}{10} =\frac{1}{2}[/tex]

(3)/(22)+(-(1)/(11) find the sum without use of a number line

Answers

Answer:

1/22

Step-by-step explanation:

Simplify it.

It becomes 3/22-1/11

Change the denominator to 22 becasue that is the LCM.  

It becomes 3/22-2/22 which is 1/22. :)

Does 8in to 1ft reduce it or enlarge it

Answers

Answer:

enlarge it

Step-by-step explanation:

I ft = 12 inches

Thus 8 in → 12 in makes the transformation larger.

Thus going from 8 in to 12 in is an enlargement

A biology class has a total of 35 students. The number of females is 11 less than the number of males. How many males and how many females are in the class?

Answers

Answer:

23 males and 12 females

Step-by-step explanation:

x = # of females

y = # of males

x + y = 35

x + x + 11 = 35

2x + 11 =35    (SUBTRACT 11 FROM BOTH SIDES)

2x = 24          (DIVIDE BOTH SIDES BY 2)

x = 12 females

x + y =35

12 + y = 35     (SUBTRACT 12 FROM BOTH SIDES)

y = 23 males

23 males + 12 females = 35 students

S=n/2(2a+(n-1)d). If d=5, n=13, S=585 find the value of a.​

Answers

Answer:

15

Step-by-step explanation:

Sum of 'n' terms formula is given by:-    

s=n/2(2a+(n-1)d)  

s=13/2[2xa+(13-1)5]    

s=13/2(2xa+12x5)    

s=13/2(2a+60)    

585=13/2(2a+60)    

585 x (2/13) = 2a + 60

90 = 2a + 60  

90-60 = 2a

30 = 2a

a = 15

Both please please :)…….,,,,,

Answers

Answer:

Step-by-step explanation:

One - 44

88% of 50 is 44

Two - 55296 60,000-4%-4%=55296

which is a true statement about an exterior angle of a triangle

Answers

Answer:

D

Step-by-step explanation:

The exterior angles are out of the triangle at all times and it adds up to make 180 with anyone of the inside angle of the triangle.

The pair also rests on the same flat/straight line and that makes a pair.

Therefore we can say that it is formed by a linear pair/group with one of the interior/inside angles of the triangle.

So, the correct answer would be D.

The true statement about an exterior angle of a triangle is C; It forms a linear pair with one of the interiior angles of the triangle .

What is the Exterior Angle of a Triangle Property?

An exterior angle of a triangle is equal to the sum of the opposite interior angles.

We know that the exterior angles are out of the triangle at all times and it adds up to make 180 with anyone of the inside angle of the triangle.

The pair also rests on the same straight line and that makes a pairs.

Therefore we can say that it is formed by a linear pair with one of the interior angles of the triangle.

So, the correct answer would be C.

Learn more about exterior angles;

https://brainly.com/question/14164971

#SPJ2

Complete the table. At least the first few so I understand how to do it

Answers

Answer:

What we need to do is simply multiply the values in both columns e.g 4 * 3/36 = 12/36

Please check explanation for complete answer

Step-by-step explanation:

Here, we are concerned about filling the empty columns of the table.

What we want to do here is simply straightforward. All we need to do is to

multiply the values of x by the values of P(x) in each of the individual rows.

Also recall, we do not need to reduce the fractions.

So we have;

2. 3 * 2/36 = 6/36

3. 4 * 3/36 = 12/36

4. 5 * 4/36 = 20/36

5. 6 * 5/36 = 30/36

6. 7 * 6/36 = 42/36

7. 8 * 5/36 = 40/36

8. 9 * 4/36 = 36/36

9. 10 * 3/36 = 30/36

10. 11 * 2/36 = 22/36

11. 12 * 1/36 = 12/36

Mary wants to get spray foam insulation in her attic space. Shown here is a diagram of her attic - how much spray foam does she need to buy

Answers

Answer:

455

Step-by-step explanation:

(1/2(10)(70))13

Mary needs to buy [tex]455~m^3[/tex] spray foam.

The correct answer is an option (B)

What is the volume of the triangular prism?

"Volume = base area × length,

where, Base area = area of triangle

Length = length(or height) of the triangular prism"

For given question,

Mary wants to get spray foam insulation in her attic space.

To find the amount of spray foam she needs to buy, we need to find the volume of the given triangular prism.

First we find the base area of the given triangular prism.

For a triangular base,

base = 7 m and height =  10 m

Using the formula of the area of the triangle,

[tex]A=\frac{1}{2}\times 7\times 10\\\\ A=7\times 5\\\\A=35~sq.m.[/tex]

Now, we find the volume of the triangular prism.

[tex]V=A\times l\\\\V=35\times 13\\\\V=455~m^3[/tex]

Therefore, she needs to buy [tex]455~m^3[/tex] spray foam.

The correct answer is an option (B)

Learn more about the volume of triangular prism here:

https://brainly.com/question/17004095

#SPJ2

If the distance between the points (2, -2) and (-1, x) is 5, one of the values of x is

Answers

We know

[tex]\boxed{\sf Distance=\sqrt{(x_2-x_1)^2+(y_2-y_1)^2}}[/tex]

ATQ

[tex]\\ \sf\longmapsto \sqrt{(-1-2)^2+(x+2)^2}=5[/tex]

[tex]\\ \sf\longmapsto \sqrt{(-3)^2+x^2+4x+4}=5[/tex]

[tex]\\ \sf\longmapsto \sqrt{9+x^2+4x+4}=5[/tex]

[tex]\\ \sf\longmapsto \sqrt{x^2+4x+13}=5[/tex]

[tex]\\ \sf\longmapsto x^2+4x+13=5^2=25[/tex]

[tex]\\ \sf\longmapsto x^2+4x+13-25=0[/tex]

[tex]\\ \sf\longmapsto x^2+4x-12=0[/tex]

[tex]\\ \sf\longmapsto x^2+6x-2x-12=0[/tex]

[tex]\\ \sf\longmapsto x(x+6)-2(x+6)=0[/tex]

[tex]\\ \sf\longmapsto (x-2)(x+6)=0[/tex]

[tex]\\ \sf\longmapsto x=2\:or\:x=-6[/tex]

Select the answer choice that is equivalent to the expression given belon.
9(2x - 3) + 5y + 17
0) O-4% - 10
O 23% - 10
0 0 -4% + 17
0 0 -49% + 17
O 16% + 23

Answers

Answer:

[tex] 23x - 10 [/tex]

Step-by-step explanation:

To the find the equivalent of [tex] 9(2x - 3) + 5x + 17 [/tex], evaluate the expression. Start by opening the bracket.

[tex] 9*2x - 9*3 + 5x + 17 [/tex]

[tex] 18x - 27 + 5x + 17 [/tex]

Pair like terms

[tex] 18x + 5x - 27 + 17 [/tex]

[tex] 23x - 10 [/tex]

The equivalent of [tex] 9(2x - 3) + 5x + 17 [/tex] is [tex] 23x - 10 [/tex]

find the surface area of the cylinder and round to the nearest tenth​

Answers

Answer: A = 833.66 in^2

Step-by-step explanation:

Area of the base = (7^2)(pi) = 49 pi = 153.9 in^2

Height of the cylinder = 12 in

Circumference of the base = (2)(pi)(r) = 44in

Surface area = (2)(pi)(7)(12) + (2)(pi)(7) = 833.66 in^2

PLEASEEEEEEE HELP with this question

Answers

Answer:

second table

Step-by-step explanation:

Out of the 8 options on the spinner, 2 of them are 0's, 1 of them is a 1, 2 of them are 2's and 3 of them are 3's so the probability of spinning a 0, 1, 2 or 3 is 2/8, 1/8, 2/8 or 3/8 which becomes 0.25, 0.125, 0.25 or 0.375 respectively. Therefore, the answer is the second table.

How does a globe represent the fact that there are no parallel lines in elliptical geometry? A. The equator is not parallel to any other latitudinal lines. B. The north and south poles are never connected by a geodesic. C. The geodesics connecting the Nortj and South poles never intersect. D. The geodesics connecting the north and south poles intersect at both of the poles.

Answers

Answer:

The correct option is;

D. The geodesics connecting the North as South poles intersect at both of the poles

Step-by-step explanation:

As an analog to the straight line, the geodesic of a curved surface is the shortest path between two points on the curved surface

Whereby the Earth is assumed to be spherical, the geodesics around the Earth would then be closed circles and like the longitude and latitude, will meet at the North and South poles

However given that the Earth is an Oblate ellipsoid, Euclid's parallel postulate is not in effect and the geodesics connecting the North and South Poles Intersect at both poles.

The answer is Option D, option D is correct.

BRAINLIEST, THANKS AND 5 STARS IF ANSWERED BOTH CORRECTLY. What is the 7th term in this geometric sequence? 3, 12, 48, 192.. ---------- What is the ratio (multiplier) of the following geometric sequence? 4, 2, 1, 0.5

Answers

Answer:

see below

Step-by-step explanation:

3, 12, 48, 192

We are multiplying by 4 each time  (12/3 =4)

The 5th term

192 *4 =768

The 6th term

768 *4 =3072

The th term

3072 *4 =12288

To find the common ratio, take the second term and divide by the first

2/4 = 1/2

The common ratio is 1/2

Problem 1

Answer: 12288

---------------------------

Explanation:

The first term is a = 3 and the common ratio or multiplier is r = 4. We start with 3 and multiply each term by 4 to get the next one. The nth term of this geometric sequence is

a(n) = a*(r)^(n-1)

a(n) = 3*(4)^(n-1)

Plug in n = 7 to get the seventh term

a(7) = 3*(4)^(7-1)

a(7) = 3*(4)^6

a(7) = 3*4096

a(7) = 12288

====================================================

Problem 2

Answer:  1/2 or 0.5

----------------------

Explanation:

To find the common ratio, we pick any term but the first one and divide it over its previous term

r = common ratio

r = (second term)/(first term) = 2/4 = 1/2 = 0.5

r = (third term)/(second term) = 1/2 = 0.5

r = (fourth term)/(third term) = 0.5/1 = 0.5

Each term is cut in half to get the next one.

solve for each of the following equations. /2x+3/=10

Answers

Answer:

/2x+3/=10

2x+3=10 or 2x+3=-10

2x=10-3 or 2x=-10-3

2x=7 or 2x=-13

X=7÷2 or X=-13÷2

X=3.5 or X=-6.5

Given that MTW = CAD, which segments are corresponding parts of the congruent triangles? MT CD MW CA TW. AD​

Answers

Answer:

TW correspondant to AD

Step-by-step explanation:

That's the right answer

Segments TW and AD are corresponding parts of the congruent triangles.

What are congruent triangles?

Two triangles are called congruent if their corresponding sides and angles are congruent.

Given that,  Δ MTW ≅ Δ CAD

The congruent parts are;

MT = CA

TW = AD

MW = CD

∠ M = ∠ C

∠ T = ∠ A

∠ W = ∠ D

Hence, Segments TW and AD are corresponding parts of the congruent triangles.

For more references on congruent triangles, click;

https://brainly.com/question/12413243

#SPJ2

Other Questions
What are words used in place of nouns, such as "T" and "him"?A. Personal pronounsB. SimileC. Rule of ThreeD. Rhetorical question regional disparity must be ended for proportionate natinal development An expensive vacuum system can achieve a pressure as low as 1.53 107 N/m2 at 26C. How many atoms are there in a cubic centimeter at this pressure and temperature? What is one way that Henrys speech uses gurative language QuestionConsider these functions.f(x) = -9x + 14g(x)=-3x2Select the correct answer from each drop-down menu.iIf x = 6, then f(6)If g(x) -48, then x =and x =Submit Question 2 of 10While writing a persuasive piece, which appeal should you use to get youraudience to believe and trust you?A. PathosB. ToneC. EthosD. SimileSUBMIT A horizontal spring with spring constant 85 N/m extends outward from a wall just above floor level. A 2.5 kg box sliding across a frictionless floor hits the end of the spring and compresses it 6.5 cm before the spring expands and shoots the box back out. How fast was the box going when it hit the spring Rearrange the equation so x is the independent variable. y+6=5(x-4) The following unadjusted trial balance is prepared at fiscal year-end for Nelson Company. 1.NELSON COMPANY Debit Credit2. Cash $1,000 3. Merchandise Inventory 12,500 4. Store supplies. 5,800 5. Prepaid Insurance. 2,400 6. Store equipment. 42,900 7. Accumulated depreciation - Store equipment $15,2508. Accounts payable 10,0009.J. Nelson, Capital 32,00010.J. Nelson, Withdrawal 2,200 11. Sales. 111,95012. Sales discounts 2,000 13. Sales returns and allowances 2,200 14. Cost of goods sold 38,400 15. Depreciation expense- Store equipmen 0 16. Salaries expense 35,000 17. Insurance expense 0 18. Rent expense 15,000 19. Store supplies expense 0 20. Advertising expense 9,800 21. Totals $169,200 169,200Nelson company uses a perpetual inventory system. It categorizes the following accounts as selling expenses: Required:1. Prepare adjusting journal entries to reflect each of the following:a. Store supplies still available at fiscal year-end amount to $1,750.b. Expired insurance, an administrative expense, for the fiscal year is $1,400.c. Depreciation expense on store equipment, a selling expense is $1,525 for the fiscal year.d. To estimate shrinkage, a physical count of ending merchandise inventory is taken. It shows $10,900 of inventory is still available at fiscal year-end.2. Prepare a multiple-step income statement for fiscal year 2015.3. Comple the statement of retained earnings and the balance sheet.4. Compute the current ratio, acid-test ratio, and gross margin ratio as of January 31, 2015. (Round ratios to two decimals.) What part of the brain is known as the pleasure center?A. Brain stemB. HypothalamusC. ThalamusD. MidbrainSUBMIT A sprinkler system is being installed in a newly renovated building on campus. The average activation time is supposed to be at most 20 seconds. A series of 12 fire alarm/sprinkler system tests results in an average activation time of 21.5 seconds. Do these data indicate that the design specifications have not been met? The hypotheses to be tested are H0: m = 20 versus Ha: m > 20, where m = the true average activation time of the sprinkler system. Assume that activation times for this system are Normally distributed with s = 3 seconds. (a) What is the value of the observed test statistic? (b) What is the value of the P-value? (c) Are the data statistically significant at the 5% significance level? Explain briefly. (d) What does the decision you made mean with respect to the question "Do these data indicate that the design specifications have not been met?" (e) If the true average activation time of the sprinkler system is, in fact, equal to 20 seconds, what type of error would you have made? [09.01]Identify the domain of the equation y=x2 - 6x + 1. (1 point) You are in charge of paying claims submitted by providers. You notice a certain diagnostic provider ("Doe Diagnostics") requested a substantial payment for a large number of members. Many of these claims are for a certain procedure. You review the same type of procedure for other diagnostic providers and realize Doe Diagnostics' claims far exceed any other provider you reviewed. What should you do? Morganton Company makes one product and it provided the following information to help prepare the master budget:The budgeted selling price per unit is $70. Budgeted unit sales for June, July, August, and September are 8,500, 16,000, 18,000, and 19,000 units What is the accounts receivable balance at the end of July? Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why