Combine like terms to simplify the expression: -5.55-8.55c+4.35c

Answers

Answer 1

Answer:

-5.55 - 4.2c

Step-by-step explanation:

-5.55 - 8.55c + 4.35c

'-8.55c' and '4.35c' are like terms because of them containing the same variable of 'c'.

Combine:

-5.55 - 8.55c + 4.35c

-8.55 + 4.35 = -4.2

-5.55 - 4.2c

Hope this helps.


Related Questions

If x-a is a factor of polynomial x3-mn2-2nax+na2 prove that a=m+n and a is not = 0

Answers

Step-by-step explanation:

hope this helps

pls mark me brainliest

find the number whose 13% is 65.​

Answers

Answer:

500

Step-by-step explanation:

A = the unknown number that we need to find

A x 13/100 = 65

=> A x 13 = 6500

=> A = 6500 / 13

=> A = 500

13% of 500 is 65.

Let's check whether the answer is correct or not.

=> 500 x 13/100

=> 5 x 13

=> 65.

So, the number whose 13% is 65 is 500

Answer:

Step-by-step explanation:

Let the number be x,

Then,

13% of x =65

Or, 13/100 of x =65

Or,x=6500/13

:.x=500

Find the values of the missing sides. You must use exact answers! PLEASE HURRY AND HELP

Answers

Answer:

x=4sqrt3 a=4 b=3  ,y=8sqrt3 c=8 d=3

Step-by-step explanation:

because this is a 30-60-90 triangle, it is easy to find the side lengths. the longer leg is sqrt(3) times the shorter leg so x= 12/sqrt(3) or 4sqrt(3). the hypotenuse is 2 times the shorter leg so y= 8sqrt(3)

name four points that are not coplanar​

Answers

Answer: U, W, Z and Y

Step-by-step explanation:

4 points are not coplanar if there does not exist any plane that contains the 4 points.

So, a plane is formed by a line and one point outside of it.

Then, we want to select the last point in such a way that it lies outside of the plane generated by the first 3 points selected.

For example:

If first we select Point U and Point W, we will have a line, as shown in the image.

Now we can select the Point  Z, that is outside the line, and now we have the plane M that you can see in the image.

Now we need to select a point that is not in the plane, the only two options are Point X and Point Y, we can select any of those two, let's take the Point Y.

So, here we have that:

Points U, W, Z and Y are not coplanar.

Easton is going to invest $340 and leave it in an account for 8 years. Assuming the interest is compounded quarterly, what interest rate, to the nearest tenth of a percent, would be required in order for Easton to end up with $420?

Answers

Answer:

100.7%

Step-by-step explanation:

Since the interest is compounded quarterly, and there are 4 quarters per year, that would leave us with 32 quarters total where interest is acquired. Now, we need to find the interest rate, that would be required in order to end up with 420 dollars after 32 quarters.

We can setup a formula using our period of time and the money he invested into the bank:

[tex]340(x)^{32}=420[/tex]

We can divide 340 from both sides, and simplify the right side to 21 divided by 17:

[tex]x^{32}=\frac{21}{17}[/tex]

Taking the 32th root of 21/17 is equal to 1.00662, which is equal to 100.0662%. To the nearest tenth of a percent, this is equal to 100.7%.

Question 6 of 10 The triangles shown below may not be congruent. 1) 25° 55° 100° 100° 66° 25° O A. True O B. False​

Answers

Answer:

True, they may not be congruent

Step-by-step explanation:

A figure cannot be determined as congruent from three angles alone. In order  for two shapes to be congruent, all corresponding parts must be congruent. This means all the sides and angles of the two shapes must be the same in order for the two shapes to be congruent. If we know all the angles are the same, the sides could still be different lengths, so this does not prove congruency.

The triangles shown below may not be congruent is True statement.

What is Congruency?

Two geometric figures are said to be congruent, or to be in the relationship of congruence, if one can be superimposed on the other and they correspond throughout.

In both Triangle we can see that

2 Angles measures 25.

2 Angles measures 100.

and, 2 angles measures 55.

As, we know there no Congruence rule for AAA.

Thus, both triangles are not Congruent.

Learn more about Congruency here:

https://brainly.com/question/7888063

#SPJ7

if 3x=y-5 and x=-4 then y =

Answers

Answer:

-7 = y

Step-by-step explanation:

3x=y-5

Let x = -4

3(-4) = y-5

-12 = y-5

Add 5 to each side

-12 +5 = y-5+5

-7 = y

if it takes a half of a cup of oil to make 20 cookies how much oil is needed to make 5 cookies?? please help.​

Answers

Answer:

We need 1/8 cup

Step-by-step explanation:

We can use ratios to solve

1/2 cup         x cups

------------  = -----------------

20 cookies     5 cookies

Using cross products

5 * 1/2 = 20x

Divide each side by 20

5/2 * 1/20 = 20x/20

5/40 =x

1/8 =x

We need 1/8 cup

Answer:

Step-by-step explanation:

step 1: you know that 1/2 c of oil makes 20 cookies.

step 2: if you only have 1/4 c (half of 1/2 cup), then you can make 10 cookies.

Step 3: 1/8 c would make 5 cookies.

What is the measure of DG?
Enter your answer in the box.

Answers

Answer:

Step-by-step explanation:

∠DHG is an inscribed angle. This angle, by definition, measures half the measure of its intercepted arc. The intercepted arc is arc DG, the one in question. This means that, by the rule, if the angle is 85 degrees, the arc is 2(85) = 170°

Answer:

it's actually  110, i took the test and got 170 wrong

Step-by-step explanation:

p
o
q
s
RM
'Ns
In the diagram, O is the centre of the circle. If PQII
RS and LONS = 140°, find the size of ZPOM.
ono​

Answers

Answer:

where is the diagram

3/v=2/4? i need help plz

Answers

Answer:

v = 6

Step-by-step explanation:

3/v = 2/4

We can use cross products to solve

2v = 3*4

2v = 12

Divide each side by 2

2v/2 = 12/2

v =6

Answer:

v=6

Step-by-step explanation:

If this is making them equal, then you should know that 2/4 is 1/2 , so you could just multiply 3 by both the 1 and the 2 in 1/2 and 1 times 3 is 3 which is what we have and 2 times 3 is 6 which is v.

Can anyone please help?

Answers

Answer:

i don't know

( lol )

heheeeee

pls help :: geometry summer assignment

Answers

42/12 = 3.5, 63/18 = 3.5, therefore we will be multiplying the last time by 3.5. 40x3.5= 140, and therefore, the number of pencils produced in 40 seconds is 140

Answer:

140

Step-by-step explanation:

Left column = x

Right column = y

Rule = 3.5x = y

Because 42/12 = 3.5

3.5 * 40 = 120 + 20 = 140

If my answer is incorrect, pls correct me!

If you like my answer and explanation, mark me as brainliest!

-Chetan K

Please tell me whats the number?

Answers

Answer:

5/6

Step-by-step explanation:

15/18

Divide the top and bottom by 3

15/3 = 5

18/3 = 6

5/6

[tex]\frac{5}{6}[/tex]

I have simplified:)

To simplify, you have to divide the numerator & denominator by 3

BTW,I am also an Acellus student!:)

Chad and his family went to the beach. First, they swam in the ocean for 1 hour and 15 minutes. Then they built sand castles for 45 minutes and played volleyball for 1 hour and 30 minutes. When they finished playing volleyball, it was 3:30 P.M. What time did Chad's family get to the beach?

Answers

Answer:

12:00

Step-by-step explanation:

so if you add up all the time they were there like this 1 hour + 15 +45+1 hour +30 you will get 3 hours and 30 minutes so then you subtract the the time from the  time like this 3:30 so they went at 12:00

Find the midpoint of the segment with the given endpoints.
(3,- 9) and (4, -8)

Answers

(3,-9)(4,-8)

[tex]\boxed{\sf (x,y)=\left(\dfrac{x_1+x_2}{2},\dfrac{y_1+y_2}{2}\right)}[/tex]

[tex]\\ \sf\longmapsto \left(\dfrac{3+4}{2},\dfrac{-9+8}{2}\right)[/tex]

[tex]\\ \sf\longmapsto \left(\dfrac{7}{2},\dfrac{-1}{2}\right)[/tex]

Question 6(Multiple Choice Worth 4 points)
(02.05 LC)
Which of the following statements best describes the effect of replacing the
graph of y = f(x) with the graph of y = f(x) + 20?
The graph of y = f(x) will shift left 20 units.
The graph of y = f(x) will shift down 20 units.
The graph of y = f(x) will shift up 20 units.
The graph of y = f(x) will shift right 20 units.

Answers

Answer:

the graph will shift 20 units up

Gena wants to estimate the quotient of –21.87 divided by 4.79. Which expression shows the estimate using front-end estimation?

Answers

Answer:

–21.87 ÷ 4.79

≈ -20 ÷ 5

≈ -4

Step-by-step explanation:

front end estimation means to round off to the most left digit.

eg 12 ≈ 10

which of the following best describes the effect of replacing the graph of y = f(x) with the graph of y= f(x) - 9? a. the graph of y = f(x) will shift up 9 units b. the graph of y = f(x) will shift down 9 units c. the graph of y = f(x) will shift left 9 units d. the graph of y = f(x) will shift right 9 units

Answers

Answer:

B

Step-by-step explanation:

If you were to have an equation y = x.

Then, x - 9 shifts it down 9.

If you were to have an equation y = 2x.

Then, 2x - 9 shifts it down 9.

Using this pattern, we deduce that  f(x) - 9, shifts the graph down 9 units.

So, our answer is B>

solve for x.
a. 2
b. 5
c. 0
d. 7

Answers

Answer:

x=0

Step-by-step explanation:

Tangent Chord Angle = 1/2 Intercepted Arc

A circle is 360 degrees

The missing arc is

360 - (2x+260)

360 -2x-260

100 -2x

Using the formula

50 = 1/2(100-2x)

50  = 50 -x

Subtract 50 from each side

0 = -x

x=0

A polynomial has one root that equals 2 + i. Name one other root of this
polynomial.

Answers

Answer:

sorry

Step-by-step explanation:

polynomial is not given

question is incomplete

Please answer thanks!

Answers

Answer:

see explanation

Step-by-step explanation:

tan x = -1

[tex]x = tan^{-1}(-1)[/tex]

x = -45

tan x = 5

[tex]x = tan^{-1}(5)[/tex]

x = 78.69

Answer:

See below.

Step-by-step explanation:

So we want to find the solutions to the two equations:

[tex]\tan(x)=-1 \text{ and } \tan(x)=5[/tex]

I)

[tex]\tan(x)=-1\\x=\tan^{-1}(-1)[/tex]

Recall the unit circle. First, note that the number inside tangent is negative. Because of this, we can be certain that the x (in radians) must be in Quadrant II and/or IV (This is because of All Students Take Calculus, where All is positive in QI, only Sine is positive in Q2, only Tangent is positive in Q3, and only Cosine is positive in QIV. Tangent is negative so the only possible choice are QII and QIV).

From the unit circle, we can see that x=3π/4 is a possible candidate since tan(3π/4)=-1.

Since tangent repeats every π, 7π/4 must also be an answer (because 3π/4 + π = 7π/4). And, as expected, 7π/4 is indeed in QIV.

Therefore, for the first equation, the solutions are:

[tex]x=3\pi/4 \text{ and } 7\pi/4[/tex]

II)

For the second equation, there is no exact value for which tangent of an angle would be equal to 5. Thus, we need to approximate.

So:

[tex]\tan(x)=5\\x=\tan^{-1}(5)\\x=\tan^{-1}(5) \text{ and } \tan^{-1}(5)+\pi[/tex]

We got the second answer because, like previously, tangent repeats every π, so we only need to add π to get the second answer.

In approximations, this is:

[tex]x\approx1.3734 \text{ and } x\approx4.5150[/tex]

Note: All the answers are in radians.

What is the value of the expression below when y = 5? Show your work and write your answer in a complete sentence.
Y exponent 2-3y+6

Answers

Answer:

y=1

Step-by-step explanation:

5=2-3y+6

3y=2-5+6

3y= -3+6

3y= 3

3y÷3=3÷3

y=1

Answer:

16

Step-by-step explanation:

Substitute y = 5 into the expression

y² - 3y + 6

= 5² - 3(5) + 6

= 25 - 15 + 6

= 16

draw a graph of 2x - 3y = 6​

Answers

Answer:

Slope:[tex]\frac{2}{3}[/tex]

y-intercept:-2

Step-by-step explanation:

Find the mean.
20, 5, 45, 90, 60, 45, 30, 10, 20, 45, 15,25

Answers

Answer:

34.166

Step-by-step explanation:

Mean=(Sum of all the numbers)/12=410/12=34.166

[tex]\huge\textsf{Hey there!}[/tex]

[tex]\bullet \large\textsf{ Finding the mean you have to add up all of your numbers \& divide it}\\\large\textsf{by the total numbers in your data plot}[/tex]

[tex]\mathsf{\dfrac{20 + 5 + 45 + 90 + 60 + 45 + 30 + 10 + 20+ 45 + 15 + 25}{12}}[/tex]

[tex]\mathsf{20 + 5 + 45 + 90 + 60 + 45 + 30 + 10 + 20+ 45 + 15 + 25}[/tex]

[tex]\mathsf{= 25 + 45 + 90 + 60 + 45 + 30 + 10 + 20 + 45 + 15 + 25}[/tex]

[tex]\mathsf{= 70 + 90 + 60 + 45 + 30 + 10 + 20 + 45 + 15 + 25}[/tex]

[tex]\mathsf{= 160 + 60 + 45 + 30 + 10 + 20 + 45 + 15 + 25}[/tex]

[tex]\mathsf{= 220 + 45 + 30 + 10 + 20 + 45 + 15 + 25}[/tex]

[tex]\mathsf{= 265 + 30 + 10 + 20 + 45 + 15 + 25}[/tex]

[tex]\mathsf{= 295 + 10 + 20 + 45 + 15 + 25}[/tex]

[tex]\mathsf{= 305 + 20 + 45 + 15 + 25}[/tex]

[tex]\mathsf{= 325 + 45 + 15 + 25}[/tex]

[tex]\mathsf{= 370 + 15 + 25}[/tex]

[tex]\mathsf{= 385 + 25}[/tex]

[tex]\mathsf{= \bf 410}[/tex]

[tex]\mathsf{= \dfrac{410}{12}}[/tex]

[tex]\mathsf{\dfrac{410}{12} \approx \bf 34.1667}[/tex]

[tex]\boxed{\boxed{\huge\textsf{Thus, your ANSWER is: \boxed{\mathsf{ \bf \underline{{\star 34.1667\star}}}}}}}}\huge\checkmark[/tex]

[tex]\huge\textsf{Good luck on your assignment \& enjoy your day!}[/tex]

~[tex]\frak{Amphitrite1040:)}[/tex]

88 feet/second = 60 miles/hour. How many feet per second is 1 mile/hour? (Hintdivide both sides of the equation
by the same amount.)
Round to the nearest thousandth.
One mile per hour is equivalent to
ao feet/second.

Answers

Answer:

1 miles/hour = 1.467·feet/second

Step-by-step explanation:

The given measurement unit are;

88 feet/second = 60 miles/hour

The number of feet per second that is equal to one mile per hour is found as follows;

88 feet/second = 60 miles/hour

To have a unit measure of one mile per hour , we divide both sides of the equation by 60 to get

(88 feet/second)/60 = (60 miles/hour)/60

Which gives;

(88/60 feet/second) = (60/60 miles/hour) = 1 miles/hour

22/15 × feet/second =  1 miles/hour

1.46667·feet/second =  1 miles/hour

Rounding to the nearest thousandth gives;

1.467·feet/second =  1 miles/hour

The number of feet per second that is in 1 mile per hour is 1.467·feet/second.

Marcus is shopping for pants. The available styles are boot cut (B), skinny (S), and relaxed fit (R). Make an organized list to show all possible outcomes if he buys two new pairs of pants.

Answers

Answer:

list in the explanation

Step-by-step explanation:

BOOT x2

SKINNY x2

RELAXED x2

BOOT, SKINNY

BOOT, RELAXED

SKINNY, BOOT

SKINNY, RELAXED

RELAXED, BOOT

RELAXED, SKINNY

The solution set is given by Set A = { BB , SS , RR , BS , BR , SR } , where B , S and R are boot cut (B), skinny (S), and relaxed fit (R) respectively

What is union and intersection of sets?

The union of two sets A and B is the set of all those elements which are either in A or in B, i.e. A ∪ B, whereas the intersection of two sets A and B is the set of all elements which are common. The intersection of these two sets is denoted by A ∩ B

The union of two sets is a new set that contains all of the elements that are in at least one of the two sets

The intersection of two sets is a new set that contains all of the elements that are in both sets

Given data ,

Let the set be represented as A

Now , the equation will be

Marcus is shopping for pants and the available pants are boot cut (B), skinny (S), and relaxed fit (R)

He wants to buy 2 pair of pants , and the possible ways of 2 pants are

Set A = { BB , SS , RR , BS , BR , SR }

So , the total number of elements in set A = 6 pairs

Therefore , the value of A is 6 pairs

Hence , the set A is { BB , SS , RR , BS , BR , SR }

To learn more about sets click :

https://brainly.com/question/28278437

#SPJ2

if the circumference of two circle are in the ratio 2:3, then their areas are in the ratio of

Answers

Answer:

4:9

Step-by-step explanation:

To take the scale factor from distance to area, we square it

2:3  distance

Square each term

2^2 : 3^2  area

4:9

Gisele has $5.90 in quarters and nickels. If Gisele has 16 more nickels than quarters, how many quarters does she have? [I don't want the answer I just want to know how to set the problem up please]

Answers

Answer: There are 17 quarters.

Step-by-step explanation:

Let x = Number of quarters and  Number of nickels =x+16

∵ 1 nickel = $0.05, 1 quarter = $0.25

value of x quarters = 0.25 x

value of x+16  nickels = 0.05(x+16)

Then, as per given,

[tex]0.05(x+16)+0.25 x= 5.90 \\\\\Rightarrow\ 0.05x+0.8+0.25x=5.90\\\\\Rightarrow\ 0.30x=5.9-0.8\\\\\Rightarrow\ 0.30x=5.1\\\\\Rightarrow\ x=\dfrac{5.1}{0.30}=\dfrac{51}{3}\\\\\Rightarrow\ x=17[/tex]

Hence, there are 17 quarters.

A culture of bacterial triples in size every four hours. If the bacteria population is estimated to be three million now, what will it be one day from now?

A. 4,238,000,000
B. 6,561,000,000
C. 243,000,000
D. 2,187,000,000

Answers

Answer:

1 day = 24 hours

we cam divide in 6 periods of 4 hours

if bacteria triples in size every four hours

3 millions at begining

3^7 = 2'187'000'000 bacteria

Espero que te sirva

Answer: Geometric progression

Step-by-step explanation:

0h -> 3x10^6 /4h-> 9x10^6 / 8h-27x10^6 / 12h->81x10^6 / 16h->243x10^6 / 20h-> 729x10^6 / 24h->2187x10^6 = 2.187.000.000.:

Other Questions
regional disparity must be ended for proportionate natinal development An expensive vacuum system can achieve a pressure as low as 1.53 107 N/m2 at 26C. How many atoms are there in a cubic centimeter at this pressure and temperature? What is one way that Henrys speech uses gurative language QuestionConsider these functions.f(x) = -9x + 14g(x)=-3x2Select the correct answer from each drop-down menu.iIf x = 6, then f(6)If g(x) -48, then x =and x =Submit Question 2 of 10While writing a persuasive piece, which appeal should you use to get youraudience to believe and trust you?A. PathosB. ToneC. EthosD. SimileSUBMIT A horizontal spring with spring constant 85 N/m extends outward from a wall just above floor level. A 2.5 kg box sliding across a frictionless floor hits the end of the spring and compresses it 6.5 cm before the spring expands and shoots the box back out. How fast was the box going when it hit the spring Rearrange the equation so x is the independent variable. y+6=5(x-4) The following unadjusted trial balance is prepared at fiscal year-end for Nelson Company. 1.NELSON COMPANY Debit Credit2. Cash $1,000 3. Merchandise Inventory 12,500 4. Store supplies. 5,800 5. Prepaid Insurance. 2,400 6. Store equipment. 42,900 7. Accumulated depreciation - Store equipment $15,2508. Accounts payable 10,0009.J. Nelson, Capital 32,00010.J. Nelson, Withdrawal 2,200 11. Sales. 111,95012. Sales discounts 2,000 13. Sales returns and allowances 2,200 14. Cost of goods sold 38,400 15. Depreciation expense- Store equipmen 0 16. Salaries expense 35,000 17. Insurance expense 0 18. Rent expense 15,000 19. Store supplies expense 0 20. Advertising expense 9,800 21. Totals $169,200 169,200Nelson company uses a perpetual inventory system. It categorizes the following accounts as selling expenses: Required:1. Prepare adjusting journal entries to reflect each of the following:a. Store supplies still available at fiscal year-end amount to $1,750.b. Expired insurance, an administrative expense, for the fiscal year is $1,400.c. Depreciation expense on store equipment, a selling expense is $1,525 for the fiscal year.d. To estimate shrinkage, a physical count of ending merchandise inventory is taken. It shows $10,900 of inventory is still available at fiscal year-end.2. Prepare a multiple-step income statement for fiscal year 2015.3. Comple the statement of retained earnings and the balance sheet.4. Compute the current ratio, acid-test ratio, and gross margin ratio as of January 31, 2015. (Round ratios to two decimals.) What part of the brain is known as the pleasure center?A. Brain stemB. HypothalamusC. ThalamusD. MidbrainSUBMIT A sprinkler system is being installed in a newly renovated building on campus. The average activation time is supposed to be at most 20 seconds. A series of 12 fire alarm/sprinkler system tests results in an average activation time of 21.5 seconds. Do these data indicate that the design specifications have not been met? The hypotheses to be tested are H0: m = 20 versus Ha: m > 20, where m = the true average activation time of the sprinkler system. Assume that activation times for this system are Normally distributed with s = 3 seconds. (a) What is the value of the observed test statistic? (b) What is the value of the P-value? (c) Are the data statistically significant at the 5% significance level? Explain briefly. (d) What does the decision you made mean with respect to the question "Do these data indicate that the design specifications have not been met?" (e) If the true average activation time of the sprinkler system is, in fact, equal to 20 seconds, what type of error would you have made? [09.01]Identify the domain of the equation y=x2 - 6x + 1. (1 point) You are in charge of paying claims submitted by providers. You notice a certain diagnostic provider ("Doe Diagnostics") requested a substantial payment for a large number of members. Many of these claims are for a certain procedure. You review the same type of procedure for other diagnostic providers and realize Doe Diagnostics' claims far exceed any other provider you reviewed. What should you do? Morganton Company makes one product and it provided the following information to help prepare the master budget:The budgeted selling price per unit is $70. Budgeted unit sales for June, July, August, and September are 8,500, 16,000, 18,000, and 19,000 units What is the accounts receivable balance at the end of July? Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number