eastern Aviation equipment pays bob Coleman a $1310 monthly salary plus a 12% commission on merchandise he sells each month. assume Bob's sales were $76,200 for the last month amount of commission: gross pay:​

Answers

Answer 1

Answer:

12/100 *76200 =$9144

so gross pay = $1310 +$9144 =$10454


Related Questions

This test statistic leads to a decision to...

reject the null

accept the null

fail to reject the null



As such, the final conclusion is that...

There is sufficient evidence to warrant rejection of the claim that the population mean is not equal to 88.9.

There is not sufficient evidence to warrant rejection of the claim that the population mean is not equal to 88.9.

The sample data support the claim that the population mean is not equal to 88.9.

There is not sufficient sample evidence to support the claim that the population mean is not equal to 88.9.

Answers

Answer:

There is not sufficient sample evidence to support the claim that the population mean is not equal to 88.9.

Step-by-step explanation:

We are given the following hypothesis below;

Let [tex]\mu[/tex] = population mean.

So, Null Hypothesis, [tex]H_0[/tex] : [tex]\mu[/tex] = 88.9      {means that the population mean is equal to 88.9}

Alternate Hypothesis, [tex]H_A[/tex] : [tex]\mu\neq[/tex] 88.9     {means that the population mean is different from 88.9}

The test statistics that will be used here is One-sample t-test statistics because we don't know about population standard deviation;

                             T.S.  =  [tex]\frac{\bar X-\mu}{\frac{s}{\sqrt{n} } }[/tex]  ~  [tex]t_n_-_1[/tex]

where, [tex]\bar X[/tex] = sample mean = 81.3

             s = sample standard deviation = 13.4

            n = sample size = 7

So, the test statistics =  [tex]\frac{81.3-88.9}{\frac{13.4}{\sqrt{7} } }[/tex]   ~ [tex]t_6[/tex]

                                     =  -1.501

The value of t-test statistics is -1.501.

Also, the P-value of the test statistics is given by;

                    P-value = P([tex]t_6[/tex] < -1.501) = 0.094

Since the P-value of our test statistics is more than the level of significance as 0.094 > 0.01, so we have insufficient evidence to reject our null hypothesis as the test statistics will not fall in the rejection region.

Therefore, we conclude that the population mean is equal to 88.9.

what's the equation that represents the new path​

Answers

Answer:

A: y= 1/4x - 7

if it is perpendicular, then it creates 4 right angles. so that new line would pass through (0,-7) and something else that isnt important. but the slope, or m, would be 1/4, and the y intercept would be -7. so the new equation is y=1/4x-7

Which is the simplified form of (StartFraction 2 a b Over a Superscript negative 5 Baseline b squared EndFraction) Superscript negative 3? Assume a not-equals 0, b not-equals 0. StartFraction b cubed Over 8 a Superscript 18 Baseline EndFraction StartFraction b squared Over 8 a Superscript 45 Baseline EndFraction StartFraction a Superscript 6 Baseline Over 4 b EndFraction StartFraction 2 a Superscript 6 Baseline Over b Superscript 5 Baseline EndFraction

Answers

Answer:

  [tex]\dfrac{b^3}{8a^{18}}[/tex]   matches the first choice

Step-by-step explanation:

[tex]\left(\dfrac{2 a b}{a^{-5}b^2}\right)^{-3}=(2a^{1-(-5)}b^{1-2})^{-3}=(2a^6b^{-1})^{-3}\\\\=2^{-3}a^{6(-3)}b^{-1(-3)}=8^{-1}a^{-18}b^3=\boxed{\dfrac{b^3}{8a^{18}}}[/tex]

__

The applicable rules of exponents are ...

  (a^b)(a^c) = a^(b+c)

  (a^b)^c = a^(bc)

  a^-b = 1/a^b

Answer:

A

Step-by-step explanation:

just took the pretest! good luck!

Claire has to go to the movie theater the movie starts at 4:15 pm it is a 25min walk to the theater from her home what time dose the have to leave the house to get there on time

Answers

Answer:

claire has to leave at 3:50 from her house.

Answer:

She needs to leave by 3:50 to get there on time.

Step-by-step explanation:

4:15 - 0:25 = 3:50.

Which number is divisible by 10? 148 99 121 100

Answers

Answer:

100

Step-by-step explanation:

100/ 10

= 10

Determine what type of decimal each is.
8.54

Answers

●✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎❀✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎●

Hi my lil bunny!

❧⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯☙

[tex]8.54 \div 100 = 0.0854[/tex]

(what do you mean by Determine what type of decimal each is: 8.54 because there is only one decimal there )

❧⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯☙

●✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎❀✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎✴︎●

Have a great day/night!

❀*May*❀

If f(x) = 4x + 3 and g(x) = 22 – 3, then f(g(4)) = ???

Answers

g(4) = 19
f(19) = 79

So f(g(4)) = 79

Answer:

f(g(4))=79

Step-by-step explanation:

given:

f(x) = 4x + 3

g(x) = 22 – 3

g(x) = 19

the x in parentheses represents x's value. if it is just x then example f(x)=3x would be 3x. if f(x) was f(2)=3x, then x would be 2 and f(2)=3x would be 3*2=6

f(g(4))

first solve g(4)

g(x) = 19

g(4)=19     because there are no x

then substitute

f(g(4))

f(19)

f(19) = 4x + 3

all x become 19

f(19) = 4(19) + 3

       =76+3

        =79

hope this helps.

Verify that the Divergence Theorem is true for the vector field F on the region E. F(x,y,z)=3xi+xyj+2xzk, E is the cube bounded by the planes x=0, x=1, y=0, y=1, z=0 and z=1

Answers

Answer: 9/2

Step-by-step explanation: Find explanation in the attached file

The Bookstall Inc. is a specialty bookstore concentrating on used books sold via the Internet. Paperbacks are $1.35 each, and hardcover books are $3.50. Of the 60 books sold last Tuesday morning, 55 were paperback and the rest were hardcover. What was the weighted mean price of a book? (Round your answer to 2 decimal places.)

Answers

Answer:

dddddd okaksy ogvurn

Step-by-step explanation:

d

If average of the numbers 3,9,5,7 and Q is 5 times the value of Q, find the value of Q

Answers

Answer:

q=6

Step-by-step explanation:

3+9+5+7+Q=5Q

5Q-Q=24

Q=6

In an article of 12200 you get Rs 3050 cash discount. Then find the discount percent

Answers

Answer:

25%discount

Step-by-step explanation:

List price=12200,

Discount=3050

[DISCOUNT%=(DISCOUNT/LIST PRICE)×100]

D%=(3050/12200)×100

D%=25%



What is the image point of (4, -6) after a translation right 5 units and up 4 units?

Answers

Answer:

(9,-2)

Step-by-step explanation:

5 is the x coordinate, and 4 is the y coordinate. When you go right a certain amount of units, you add those units to your x coordinate. If you were to go left a certain amount of units, you'd subtract them. Since we're going right, 5 + 4 = 9. When you go up a certain amount of units, you add those units to you y coordinate. If you were to go down a certain amount of units, you'd subtract them.  Since we're going up, -6 + 4 = -2. So, x = 9 and y = -2, or (9,-2)

What is the correct standard form of the equation of the parabola? Enter your answer below. Be sure to show each step of your work.

Answers

Answer:

Step-by-step explanation:

eq. of directrix is y=4 or y-4=0

perpendicular distance of (x,y) from directrix =distance of (x,y) from focus (-3,2)

[tex]| \frac{y-4}{1}|=\sqrt{(x+3)^2+(y-2)^2} \\squaring~both~sides\\y^2-8y+16=(x+3)^2+(y-2)2\\(x+3)^2=y^2-8y+16-(y-2)^2\\(x+3)^2=y^2-8y+16-(y^2-4y+4)\\(x+3)^2=y^2-8y+16-y^2+4y-4\\(x+3)^2=-4y+12\\(x+3)^2=-4(y-3)[/tex]

Write a variable expression for a number w increased by 4 (A) 4 ÷ w (B) w + 5 (C) w + 4

Answers

Answer:

C) w+4

Step-by-step explanation:

w=the variable

+4= increased by 4

HOPE THIS HELPS!!!!!! :)

<33333333333

Zamba has found a little black dress on sale for 50% off the original price of $239.99. She also has a coupon offering free shipping and an additional 10% off of her entire online purchase. If she buys the dress and a pair of shoes costing $34.70, how much will she pay for her ensemble?

$108.00
$104.70
$94.23
$139.23

Answers

Answer:

$139.23

Step-by-step explanation:

50% off the original price of $239.99

= $239.99-(0.5*239.99)

= 239.99-119.995

= $119.995

She purchase a pair of shoes also worth $34.70

Total cost now= $119.995 + $34.70

Total cost now= $154.695

But she has a coupon that gives her 10% off her total sales

Now she wants pay

= $154.695 - 0.1(154.695)

= $154.695-15.4695

= $139.2255

Approximately $139.23

find the range. 83, 71, 62, 86, 90, 95, 61, 60, 87, 72, 95, 74, 82, 54, 99, 62, 78, 76, 84, 92

Answers

Answer: 45

Step-by-step explanation: The range is the difference between the greatest number in the data set and the least number in the data set which in this case is 99 - 54 or 45. So the range of this data set is 45.

Answer:

[tex] \boxed{45}[/tex]

Step-by-step explanation:

Given data:

83 , 71 , 62 , 86 , 90 , 95 , 61 , 60 , 87 , 72 , 95 , 74 , 82 , 54 , 99 , 62 , 78 , 76 , 84 , 92

largest value = 99

Smallest value = 54

Let's find the range:

Range = Largest value - smallest value

= 99 - 54

= 45

Extra information:

Range

It is the simple method of measuring the variations. A range is defined as the difference between the largest and the smallest value of distribution. If the data are arranged in ascending or descending order, then the difference between the largest and smallest value is called the range.

The range is defined by

Range = Largest value - smallest value i.e ( highest value - lowest value )

= L - S

Range is the absolute measure of dispersion = L - S

Thus, if a₁ , a₂ , a₃ ...............aₙ are n term in a sequence arranged in ascending order, the range is given by

R = a - a where a₁ is the smallest value and aₙ is the highest value or R = L - S , where L is the largest value and S is the smallest value.

Hope I helped!

Best regards!

Which is the best definition for the term "segment bisector"?

Answers

Answer:

a line that cuts a segment into two pieces of equal length.

On Monday the temperature is 0F on Tuesday it is seven degrees warmer what is the temperature?

Answers

Answer:

7F

Step-by-step explanation:

Add 7 to 0

0+7 = 7F

Answer:

obviously 7F

Step-by-step explanation:

Just add 7 to the zero and its 7F

A salon and spa chain periodically analyzes its service times to check for variation in service processes using x-bar and R charts. Daily random samples, each containing service times observed with eight different customers are collected. The average mean and the average range of the service times for the past week were 27.2 and 3.76 minutes, respectively. The value of D4 for a sample size of eight is 1.864. What is the upper control limit (UCL) for the R-chart

Answers

Answer:

7.00864

Step-by-step explanation:

The upper control limit for R -chart can be computed by using following formula

UCL=Rbar*D4.

We are given that average range R bar is

Rbar=3.76.

The value of D4 for n=8 is also given that is

D4=1.864.

Thus, the required computed upper control limit is

UCL=3.76*1.864=7.00864.

What is the wavelength of light with 5.53 x 10-19 J of energy? (The speed of
light in a vacuum is 3.00 x 10 m/s, and Planck's constant is 6.626 10-34
J•s.)
A. 399 nm
B. 278 nm
C. 250 nm
D. 359 nm

Answers

Answer:

D. 359 nm

[tex]{ \boxed{ \bf{ energy = \frac{hc}{ \lambda} }}} [/tex]

lambda is the wavelength

c is the speed of light

h is the Planck's constant

[tex]{ \sf{5.53 \times {10}^{ - 19} = \frac{(6.626 \times {10}^{ - 34}) \times (3.00 \times { {10}^{8} }) }{ \lambda} }} \\ \\ { \sf{\lambda = 3.59 \times {10}^{ - 7} }} \\ { \sf{\lambda = 359 \: nm}}[/tex]

A rectangle has an area of 81 square centimeters. Which of the following would be the rectangle's length and width? (Area = equals length×times width)

Answers

Answer:

length: 9cm

width: 9cm

Step-by-step explanation:

9×9=81

the length is 9cm and the width is also 9cm

5. Refer to the figure shown. Determine the measure of
the unknown angle. Show or explain your thanking.

Answers

Answer:

you haven't posted any diagram

Step-by-step explanation:

Which of the following is NOT a property of a paralleogram? * The opposite sides are equal. The opposite angles are equal. Each diagonal bisects the parallogram. The diagonals of all parallograms bisect each other at 90 degree angles. I will give brainliest

Answers

Answer:

The diagonals of all parallelograms do not bisect each other at 90 degree angles.

Step-by-step explanation:

For the right angle, find the missing quantity indicated below the figure.

Answers

Answer:

The Answer is 28.........

Solve for x in the diagram below.
30°
80°
2.cº
T =

Answers

180 = 80 + 2x + 3x
100 = 5x
x = 20

Hello, there!!!!

Given that,

80°,3x° and 2x°are three angles on a st.line.

we have,

2x°+3x°+80°= 180° {The total sum of angles on a st. line is 180°}.

or, 5x°= 180°-80°

or, 5x°=100°

or, x= 100°/5

Therefore the value of x is 20°.

Hope it helps...

A plane is flying at the height of 5000 meter above the sea level. at a particular point, it is excatly above a submarine floating 1200 meter below the sea level. what is the vertical distance between them ?

Answers

Answer:

3800 meters

Step-by-step explanation:

An experimental probability is ______ likely to approach the theoretical probability if the number of trials simulated is larger. A. as B. more C. less D. not

Answers

Answer:

I believe your answer is b. the more trials you conduct, the more information you have

An experimental probability is more likely to approach the theoretical probability if the number of trials simulated is larger. Then the correct option is B.

What is probability?

Its basic premise is that something will almost certainly happen. The percentage of favorable events to the total number of occurrences.

Experimental probability: A probability that is established from the findings of several iterations of a test.

Theoretical probability: The proportion of positive consequences to all potential outcomes. The ratio of the favorable event to the total event.

An experimental probability is more likely to approach the theoretical probability if the number of trials simulated is larger.

Then the correct option is B.

More about the probability link is given below.

https://brainly.com/question/795909

#SPJ2

if f(x)=3-2x and g(x)= 1/x+5 what is the value of (f/g) (8)​

Answers

Answer:

Step-by-step explanation:

(f/g) = (3 - 2x ) / (1/x + 5) You could go to the trouble to simplify all of this, but the easiest way is to just put in the 8 where you see an x

(f/g)8 = (3 - 2*8) / (1/8 + 5)

(f/g)/8 = (3 - 16 / (5 1/8)          1/8 = 0.125

(f/g) 8 = - 13 / ( 5.125)

(f/g)8 = - 2.54

PLEASE HELP ! (4/5) - 50 POINTS -

Answers

Answer:

[tex]\large \boxed{\sf A) \ 12}[/tex]

Step-by-step explanation:

Frequency of a specific data value at an interval is the number of times the data value repeats in that interval.

Cumulative frequency is found by adding each frequency to the frequency that came before it.

cStep-by-step explanation:

3 ratios that are equivalent to 6:12

Answers

Answer:

1:3

2:4

3:6

Step-by-step explanation:

we can divide both sides by 6 and get 1:2

we can divide both sides by 3 and get 2:4

we can divide both sides by 2 and get 3:6

Answer:

12:24, 3:6, 2:4

Step-by-step explanation:

What we are looking for here is a ratio that, when you divide/multiply the same constant on both parts of the ratio, you get 6:12.

6:12 is the same thing as 1:2, so we can find ratios equivalent to 1:2 (the first value will be half the second).

Hope this helped!

Other Questions
regional disparity must be ended for proportionate natinal development An expensive vacuum system can achieve a pressure as low as 1.53 107 N/m2 at 26C. How many atoms are there in a cubic centimeter at this pressure and temperature? What is one way that Henrys speech uses gurative language QuestionConsider these functions.f(x) = -9x + 14g(x)=-3x2Select the correct answer from each drop-down menu.iIf x = 6, then f(6)If g(x) -48, then x =and x =Submit Question 2 of 10While writing a persuasive piece, which appeal should you use to get youraudience to believe and trust you?A. PathosB. ToneC. EthosD. SimileSUBMIT A horizontal spring with spring constant 85 N/m extends outward from a wall just above floor level. A 2.5 kg box sliding across a frictionless floor hits the end of the spring and compresses it 6.5 cm before the spring expands and shoots the box back out. How fast was the box going when it hit the spring Rearrange the equation so x is the independent variable. y+6=5(x-4) The following unadjusted trial balance is prepared at fiscal year-end for Nelson Company. 1.NELSON COMPANY Debit Credit2. Cash $1,000 3. Merchandise Inventory 12,500 4. Store supplies. 5,800 5. Prepaid Insurance. 2,400 6. Store equipment. 42,900 7. Accumulated depreciation - Store equipment $15,2508. Accounts payable 10,0009.J. Nelson, Capital 32,00010.J. Nelson, Withdrawal 2,200 11. Sales. 111,95012. Sales discounts 2,000 13. Sales returns and allowances 2,200 14. Cost of goods sold 38,400 15. Depreciation expense- Store equipmen 0 16. Salaries expense 35,000 17. Insurance expense 0 18. Rent expense 15,000 19. Store supplies expense 0 20. Advertising expense 9,800 21. Totals $169,200 169,200Nelson company uses a perpetual inventory system. It categorizes the following accounts as selling expenses: Required:1. Prepare adjusting journal entries to reflect each of the following:a. Store supplies still available at fiscal year-end amount to $1,750.b. Expired insurance, an administrative expense, for the fiscal year is $1,400.c. Depreciation expense on store equipment, a selling expense is $1,525 for the fiscal year.d. To estimate shrinkage, a physical count of ending merchandise inventory is taken. It shows $10,900 of inventory is still available at fiscal year-end.2. Prepare a multiple-step income statement for fiscal year 2015.3. Comple the statement of retained earnings and the balance sheet.4. Compute the current ratio, acid-test ratio, and gross margin ratio as of January 31, 2015. (Round ratios to two decimals.) What part of the brain is known as the pleasure center?A. Brain stemB. HypothalamusC. ThalamusD. MidbrainSUBMIT A sprinkler system is being installed in a newly renovated building on campus. The average activation time is supposed to be at most 20 seconds. A series of 12 fire alarm/sprinkler system tests results in an average activation time of 21.5 seconds. Do these data indicate that the design specifications have not been met? The hypotheses to be tested are H0: m = 20 versus Ha: m > 20, where m = the true average activation time of the sprinkler system. Assume that activation times for this system are Normally distributed with s = 3 seconds. (a) What is the value of the observed test statistic? (b) What is the value of the P-value? (c) Are the data statistically significant at the 5% significance level? Explain briefly. (d) What does the decision you made mean with respect to the question "Do these data indicate that the design specifications have not been met?" (e) If the true average activation time of the sprinkler system is, in fact, equal to 20 seconds, what type of error would you have made? [09.01]Identify the domain of the equation y=x2 - 6x + 1. (1 point) You are in charge of paying claims submitted by providers. You notice a certain diagnostic provider ("Doe Diagnostics") requested a substantial payment for a large number of members. Many of these claims are for a certain procedure. You review the same type of procedure for other diagnostic providers and realize Doe Diagnostics' claims far exceed any other provider you reviewed. What should you do? Morganton Company makes one product and it provided the following information to help prepare the master budget:The budgeted selling price per unit is $70. Budgeted unit sales for June, July, August, and September are 8,500, 16,000, 18,000, and 19,000 units What is the accounts receivable balance at the end of July? Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number