Find the value of each of the following: a. |15| b. |−15| c. −|15| d. −|−15| *Note: the numbers are inside the 2 parallel lines*

Answers

Answer 1

Answer:

a is 15, b is 15, c is -15, and d is -15 also

Step-by-step explanation:

The 2 parallel lines that surround the number are called "absolute value signs" everything inside them has an outcome of a positive number and in this case the number is 15. Like I said the number(s) inside the absolute value signs have to have a outcome of a positive number, notice in c and d there is a negative sign outside the absolute value signs. Therefore you multiply the negative seperately so, 15(-1) is -15.


Related Questions

Find the value of x in the figure below.
A. 25
B. 35
C. 45
D. 65

Answers

Answer:x=45

Step-by-step explanation:

THE ANSWER IS C.45 or x=25

Bryce is making a model building. He raises the walls of the building by 2centimeters five times. By how many centimeters does Bryce raise the walls all together?

Answers

Answer:

C. 10cm

Step-by-step explanation:

Bryce is making a model building.

He raises the walls of the building

by 2 centimeters five times. By how

many centimeters does Bryce raise

the walls all together?

(A) 2 cm

(C) 10 cm

(B) 5 cm

(D) 20 cm

Bryce raises the walls of the building 2centimeters five times

This means, he raises the walls 2centimeters five different times

By how many centimeters does Bryce raise the walls all together?

We can solve this by finding the product of 2centimeters five times

The total centimeters Bryce raises the walls altogether= 2 centimeters × 5 times

=2cm × 5

=10cm

SOMEBODY PLS HALP ;( According to the number line, which statement MUST be true? A) A > 1 B) B > 4 C) C < 4 D) D < 0

Answers

Answer:

B

Step-by-step explanation:

B sqrtb is right in front of 2, so 2 squared is 4, so a little bit more than 2 squared will be a little more than four.

Answer:

C) C < 4

Step-by-step explanation:

because c is on the right side of four on the number line

find x,y in the following pictures

Answers

Answer:

not detectable

Step-by-step explanation:

Firstly the question is not clear and the second thing is that the given information don't seem to be enough for calculation

Who can do 20 assignments in math for me rn needs to b finish in 5 hours?

Answers

u need to finish 4 assignments in 1 hour

3x(x-2y)-4(x-5y).any answer please respond

Answers

Answer:

Step-by-step explanation:

3x(x - 2y) - 4(x - 5y) = 3x*x - 3x*2y  + x*(-4) - 5y*(-4)  {Distributive property}

                               = 3x² -  6xy - 4x + 20y

                               


Find the measure of each angle indicated. Round to the nearest tenth.
A) 49°
C) 38.1°
B) 44.90
D) 42.89

Can you please help explain how to find the answer​

Answers

Answer:

D

Step-by-step explanation:

So we want to find θ. We are already given the hypotenuse and the side length opposite to θ. Therefore, we can use the trig function sine to find θ.

Recall that:

[tex]\sin(\theta)=opp/hyp[/tex]

Plug in 10.2 for the opposite side and 15 for the hypotenuse:

[tex]\sin(\theta)=10.2/15[/tex]

Solve for θ. Use a calculator:

[tex]\theta=\sin^{-1}(10.2/15)\\\theta\approx42.8436\textdegree[/tex]

The answer is D.

How many of the positive integer factors of 15552 are perfect squares?

Answers

There are 12 factors which are perfect squares is 1,  4,  9,  16,  36,  64,  81, 144,  324, 576, 1296, 5184.

What is factors?

Factors can be define splitting the value in multipliable values.

Factorization of 15552
= 1 * 4 * 4 * 4* 9 * 9 * 3


Perfect squares can be formed by above factors are
= 1,  4,  9,  16,  36,  64,  81, 144,  324, 576, 1296, 5184.

Thus, there are 12 factors which are perfect squares is 1,  4,  9,  16,  36,  64,  81, 144,  324, 576, 1296, 5184.

Learn more about factors here:
https://brainly.com/question/24182713

#SPJ2

Explain how to find the middle quartile of a box-and-whisker plot.

Answers

Step-by-step explanation: The middle quartile or second quartile as I like to call it is the median of the entire data set. Remember that the median is the middle number when the data is written from least to greatest.

Sofia ordered sushi for a company meeting. They change plans and increase how many people will be at the
meeting, so they need at least 100 pieces of sushi in total.
Sofia had already ordered and paid for 24 pieces of sushi, so she needs to order additional sushi. The sushi
comes in rolls, and each roll contains 12 pieces and costs $8.
Let R represent the number of additional rolls that Sofia orders.
1) Which inequality describes this scenario?
Choose 1 answer:

Answers

Answer:

The answer is given below

Step-by-step explanation:

The options are not given but I would list the inequalities needed to solve this problem.

As a result of increase in people to attend meeting, the number of sushi needed to be ordered is 100 pieces. Sofia has already ordered 24 pieces. If R is the number of additional rolls that Sofia orders.

The number of additional rolls that Sofia orders (R) must be greater than or equal to the difference between the number of Sushi needed to be ordered and the number of Sushi that has already being ordered. It is given by the inequality:

R ≥ 100 - 24

R ≥ 76

If each roll contains 12 pieces, the number of rolls needed (n) is given by:

n ≥ R/12

n ≥ 76/12

n ≥ 6.33

n ≥ 7

If each roll cost $8, the money needed to buy the sushi is given as:

Cost ≥ 8(7) ≥ $56

it has rained on the 6th of january twice in the last 20 years calculate the probability that it will rain on the 6th january next year​

Answers

There is obviously an infinite amount of probabilities in which it will rain on the 6th of January

But 50/50, because just because it happened other times doesn’t mean it’ll happen again

Hope this helped ♥︎

Two similar rectangles have a corresponding sides in the ratio 10:3 find the ratio of their areas​

Answers

Hello!

Answer:

[tex]\huge\boxed{100 : 9}[/tex]

If corresponding side lengths are in the ratio 10 : 3, the ratio of their areas will simply be the square (area is 2-dimensional).

Therefore:

10 : 3 ⇒ (10)² : (9)²

100 : 9 is the ratio of the areas.

I hope this helped you! :)

Answer:

Ratio of the corresponding sides of rectangle

10 : 3

Areas will by in the ratio of 10² : 3²

100 : 9

Explanation :

let first rectangles sides be 10 l and 10 b ➾ The area will be 100 × l × b

So second rectangles sides be 3 l and 3b

➾ The area will be 9 × l × b

So the ratio of areas

➾100lb : 9lb

100 : 9

Which numbers are a distance of 2 units from 8 on a number line?
++++++++++
-10-9-8-7-6-5-4-3-2-1 0 1 2 3 4 5 6 7 8 9 10
Select each correct answer.
0-2
06
O 8
0 10
0-6
0-8

Answers

Step-by-step explanation:

0 10

0-6

this is the answer. I am sure

The value of numbers are 6 and 10 which are a distance of 2 units from 8 on a number line.

What is mean by Number line?

Number line is a horizontal line where numbers are marked at equal intervals one after another form smaller to greater.

We have to given that;

Number line is shown in figure.

And, We have to find the value of numbers which are a distance of 2 units from 8 on a number line.

Now,

We can find the value of numbers as;

⇒ | 8 - 2 | = 6

⇒ | 8 + 2 | = 10

Therefore, The value of numbers are 6 and 10 which are a distance of 2 units from 8 on a number line.

Learn more about the number line visit:

brainly.com/question/28223520

#SPJ7

A VERTICAL POLE OF CAST A SHADOW OF 4.5m LONG AT THE SAME TIME A TREE OF HEIGHT 24m LONG CAST A SHADOW OF 6m LONG. FIND THE HEIGHT OF THE POLE.​

Answers

Answer:

18 metres

Step-by-step explanation:

4.5/6 = x/24

¾= x/24

x = 18 m

12. a trader gained 15% by selling an
article for N1560.00, what is the cost
price of the article?​

Answers

Answer:

N1356

Step-by-step explanation: I hope it helps :)

[tex]Profit \% = 15\%\\Selling -Price = N1560.00\\C.P = ?\\\\CP = ( SP \times 100 ) / ( 100 + percentage \: profit).\\C.P =\frac{Selling \:price \times 100}{100+ Profit \%} \\\\C.P = \frac{1560\times 100}{100+15} \\\\C .P = \frac{156000}{115} \\\\C.P =N1356.5[/tex]

Which does NOT represent an integer?
A.39/13
B. -3/5
C. 121 pi
D. 0

Answers

An integer is a whole number, so technically, both B and C are not integers…
Pi is an irrational number and fractions are not whole numbers.

Use the Remainder Theorem to find the remainder: (16x^4 – 8x^3 – 4x + 1) ÷ (2x + 1)

3
1
-1
5

Answers

Answer:

5

Step-by-step explanation:

This illustrates the Remainder Theorem. If a polynomial f(x) is divided by x−a , the remainder is the constant f(a) , and f(x)=q(x)⋅(x−a)+f(a) , where q(x) is a polynomial with degree one less than the degree of f(x) . Synthetic division is a simpler process for dividing a polynomial by a binomial.

Lisa took a survey of her classmates' favorite sport and recorded their genders. The results are in the table below:

Answers

Answer:

0.5 is the answer of this question

bro!

The table below shows some inputs and outputs of the invertible function with domain all real numbers.
Find the following values:
Thanks :D

Answers

Answer:

f⁻¹(-2) = 3 and f⁻¹(1) = 0.

Step-by-step explanation:

By the definition of inverse functions:

[tex]\displaystyle \text{If } f(a) = b\text{, then } f^{-1}(b) = a[/tex]

From the table, note that f(3) = -2.

Then by definition, f⁻¹(-2) = 3.

Likewise, f(0) = 1.

Then by definition, f⁻¹(1) = 0.

A blimp is 1100 meters high in the air and measures the angles of depression to two stadiums to the west of the blimp. If those measurements are 75.2° and 17.9°, how far apart are the two stadiums?

Answers

Answer:

The two stadiums are approximately 3115.1 meters away from each other

Step-by-step explanation:

Since we can construct two right angle triangles between the blimp and the two stadiums as shown in the attached image, then the distance "x" between the two can be find as the difference between the right triangle legs that extend on the ground.

In order to find the size of such legs, one can use the tangent function of the given depression angles as shown below:

[tex]tan(75.2^o)=\frac{1100}{a} \\a=\frac{1100}{tan(75.2^o)}\\a\approx 290.6\,\,meters[/tex]

and for the other one:

[tex]tan(17.9^o)=\frac{1100}{b} \\b=\frac{1100}{tan(17.9^o)}\\b\approx 3405.7\,\,meters[/tex]

The the distance between the stadiums is the difference:

b - a = 3405.7  - 290.6 meters = 3115.1  meters

find the area of parallelogram and round to the nearest tenth.​

Answers

Answer:

A=b×h

A=13.8×6

A=82.8 in²

A≈83in²

Step-by-step explanation:

represent 1/3 and 5/2 on the same number line​

Answers

Answer:

Picture below

Step-by-step explanation:

● 5/2 is 2.5 so just divide the space between 3 by 2

● for 1/3 divide the space between 0 and by 3

if the first step of the equation -8 - 7x = -5x - 10 is " add 10" then what should be done next?

Answers

Answer:

Add 7x to each side

Step-by-step explanation:

-8 - 7x = -5x - 10

Add 10 to each side

-8 - 7x+10 = -5x - 10+10

2 -7x = -5x

Add 7x to each side

2-7x+7x = -5x+7x

2 = 2x

Answer: See below

Step-by-step explanation:

[tex]-8 - 7x = -5x - 10[/tex]

I believe it is adding 8 on both sides

The next step after adding 8 on both sides is adding 5x on both sides

[tex]-7x=-5x-2[/tex]

[tex]-7x+5x=-5x-2+5x[/tex]

[tex]-2x=-2[/tex]

x=1

It is an equation
What is -
x+3x=25
2x+36x=2

Answers

Answer:

Answer 1 : 25/4

Answer 2 : 1/19

Step-by-step explanation:

Question 1:

x + 3x = 25

4x = 25

x = 25/4

Question 2:

2x+36x=2

38x = 2

x = 2/38

x = 1/19

What is the value of the expression below when y = 4?
3y2 + y + 8​

Answers

Answer:

3y²+y+8

=3(4)²+4+8

=3(16)+4+8

=48+4+8

=60

A group of friends went to lunch and spent a total of $76, which included the food bill and a tip of $16. They decided to split the bill and tip evenly among themselves

Answers

Complete question:

A group of 8 friends went to lunch and spent a total of $76, which included the food bill and a tip of $16. They decided to split the bill and tip evenly among themselves. Which equations and solutions describe the situation? Check all that apply. The equation 1/8(x+16)=76/8 represents the situation, where x is the food bill. The equation 1/8 (x+16)=76 represents the situation, where x is the food bill. The solution x=60 represents the total food bill. The solution x=60 represents each friend’s share of the food bill and tip. The equation 8(x+16)=76 represents the situation, where x is the food bill.

Answer:

The equation 1/8(x+16)=76/8 represents the situation, where x is the food bill

The solution x=60 represents the total food bill

Step-by-step explanation:

Given the following :

Total amount spent = $76

Amount paid as tip = $16

Number of friends = 8

Total Cost of lunch consists of:

Actual Cost of food + amount of tip

Let actual cost of food = x

Total cost of lunch is thus :

x + $16 = $76

If the friends are to each the bill equally:

Then:

Divide both sides by 8:

(1/8)* (x + 16) = 76/8

Therefore,

(x + 16) / 8 = 76/8

x + 16 = 76 / 8

(x + 16)/8 = 9.5

x + 16 = 9.5 * 8

x + 16 = 76

x = 76 - 16

x = 60

Answer:

A

and

C

Step-by-step explanation:

The axis of symmetry for a quadratic equation can be found using the formula x equals StartFraction negative b Over 2 a EndFraction, where a and b are coefficients in the quadratic equation and x represents the values along a vertical line on the coordinate plane. What is the equation when solved for a?

Answers

Answer:

[tex]a=-\frac{b}{2x}[/tex]

Step-by-step explanation:

The equation of a quadratic function is given as:

ax² + bx + c = 0

where a, b and c are the coefficient in the quadratic equation.

The axis of symmetry of the quadratic equation is given as:

[tex]x=-\frac{b}{2a}[/tex]

To get the equation for a, we have to make a the subject of formula:

[tex]x=-\frac{b}{2a}\\\\multiply\ both\ sides\ by \ 2a:\\\\x*2a=-\frac{b}{2a}*2a\\\\2ax=-b\\\\Divide\ through\ by\ 2a\\\\2ax/2a=-b/2a\\\\a=-\frac{b}{2x}[/tex]

The value of a when solved from x = -b/2a is;

a = -b/2x

We are given the formula for axis of symmetry of a quadratic equation to be;

x = -b/2a

Where;

a and b are coefficients in the quadratic equation

x represents the values along a vertical line on the coordinate plane.

Now, we want to solve for a which means we make it the subject of the equation;

Using multiplication property of equality, we multiply both sides by 2a to get;

2ax = -b

We now use division property of equality by dividing both sides by 2x to get;

a = -b/2x

Read more at; https://brainly.com/question/3528055

The lines on a 2-cup liquid measuring cup divide each cup into eighths. If you measure 1 3/4 cups of water, between which two quantities can you be certain that your exact measurement will be?

Answers

Answer:

1 3/4 cups is between the 13th and 15th lines from the bottom.

Step-by-step explanation:

The bottom of the cup has no line and corresponds to 0 eights.

1st line up: 1/8 cup  

2nd line up: 2/8 cup    this is also called 1/4 cup

3rd line up: 3/8 cup

4th line up: 4/8 cup     this is also called 1/2 cup

5th line up: 5/8 cup

6th line up: 6/8 cup     this is also called 3/4 cup

7th line up: 7/8 cup

8th line up: 8/8 cup     this is also called 1 cup

9th line up: 9/8 cup

10th line up: 10/8 cup    this is also called 1 1/4 cup

11th line up: 1 3/8 cup

12th line up: 1 4/8 cup     this is also called 1 1/2 cup

13th line up: 1 5/8 cup

14th line up: 1 6/8 cup    this is also called 1 3/4 cup

15th line up: 1 7/8 cup

16th line up: 1 8/8 cup    this is also called 2 cups

1 3/4 cups is between the 13th and 15th lines from the bottom.

the distance travelled by light in 1year is called light year. the valued of 1 light year is about 9460000000000km.express it in scientific notation.​

Answers

Answer:

9.46×10¹²

Step-by-step explanation:

To express that number in scientific notation you have to move the invisible decimal point from the end to the left in between the first and second number to the left

9460000000000

9.46×10¹²

i hope this helps and if you have any more questions please feel free to ask.

How many hours are there in ten quarters of an hour?

Answers

Answer:

2 1/2 hours

Step-by-step explanation:quarters means 1/4 and there are 4 of them in each hours  so if you have 10 quarters of a hour they add up to 2 hours and a half, because 2 hours times 4 equals 8 quarters and then add the other 2 quarters and you get half

Other Questions
An expensive vacuum system can achieve a pressure as low as 1.53 107 N/m2 at 26C. How many atoms are there in a cubic centimeter at this pressure and temperature? What is one way that Henrys speech uses gurative language QuestionConsider these functions.f(x) = -9x + 14g(x)=-3x2Select the correct answer from each drop-down menu.iIf x = 6, then f(6)If g(x) -48, then x =and x =Submit Question 2 of 10While writing a persuasive piece, which appeal should you use to get youraudience to believe and trust you?A. PathosB. ToneC. EthosD. SimileSUBMIT A horizontal spring with spring constant 85 N/m extends outward from a wall just above floor level. A 2.5 kg box sliding across a frictionless floor hits the end of the spring and compresses it 6.5 cm before the spring expands and shoots the box back out. How fast was the box going when it hit the spring Rearrange the equation so x is the independent variable. y+6=5(x-4) The following unadjusted trial balance is prepared at fiscal year-end for Nelson Company. 1.NELSON COMPANY Debit Credit2. Cash $1,000 3. Merchandise Inventory 12,500 4. Store supplies. 5,800 5. Prepaid Insurance. 2,400 6. Store equipment. 42,900 7. Accumulated depreciation - Store equipment $15,2508. Accounts payable 10,0009.J. Nelson, Capital 32,00010.J. Nelson, Withdrawal 2,200 11. Sales. 111,95012. Sales discounts 2,000 13. Sales returns and allowances 2,200 14. Cost of goods sold 38,400 15. Depreciation expense- Store equipmen 0 16. Salaries expense 35,000 17. Insurance expense 0 18. Rent expense 15,000 19. Store supplies expense 0 20. Advertising expense 9,800 21. Totals $169,200 169,200Nelson company uses a perpetual inventory system. It categorizes the following accounts as selling expenses: Required:1. Prepare adjusting journal entries to reflect each of the following:a. Store supplies still available at fiscal year-end amount to $1,750.b. Expired insurance, an administrative expense, for the fiscal year is $1,400.c. Depreciation expense on store equipment, a selling expense is $1,525 for the fiscal year.d. To estimate shrinkage, a physical count of ending merchandise inventory is taken. It shows $10,900 of inventory is still available at fiscal year-end.2. Prepare a multiple-step income statement for fiscal year 2015.3. Comple the statement of retained earnings and the balance sheet.4. Compute the current ratio, acid-test ratio, and gross margin ratio as of January 31, 2015. (Round ratios to two decimals.) What part of the brain is known as the pleasure center?A. Brain stemB. HypothalamusC. ThalamusD. MidbrainSUBMIT A sprinkler system is being installed in a newly renovated building on campus. The average activation time is supposed to be at most 20 seconds. A series of 12 fire alarm/sprinkler system tests results in an average activation time of 21.5 seconds. Do these data indicate that the design specifications have not been met? The hypotheses to be tested are H0: m = 20 versus Ha: m > 20, where m = the true average activation time of the sprinkler system. Assume that activation times for this system are Normally distributed with s = 3 seconds. (a) What is the value of the observed test statistic? (b) What is the value of the P-value? (c) Are the data statistically significant at the 5% significance level? Explain briefly. (d) What does the decision you made mean with respect to the question "Do these data indicate that the design specifications have not been met?" (e) If the true average activation time of the sprinkler system is, in fact, equal to 20 seconds, what type of error would you have made? [09.01]Identify the domain of the equation y=x2 - 6x + 1. (1 point) You are in charge of paying claims submitted by providers. You notice a certain diagnostic provider ("Doe Diagnostics") requested a substantial payment for a large number of members. Many of these claims are for a certain procedure. You review the same type of procedure for other diagnostic providers and realize Doe Diagnostics' claims far exceed any other provider you reviewed. What should you do? Morganton Company makes one product and it provided the following information to help prepare the master budget:The budgeted selling price per unit is $70. Budgeted unit sales for June, July, August, and September are 8,500, 16,000, 18,000, and 19,000 units What is the accounts receivable balance at the end of July? Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number the water is..........