Answer:
Explanation:
Are gender traits completely a result of societal expectations?
Are there any parts of the human body that get oxygen directly from the air and not from the blood?
Are there nuclear reactions going on in our bodies?
Can humans ever directly see a photon?
Can I turn my cat into a diamond?
Do blind people dream in visual images?
Do Kirlian photographs show the soul of an organism?
Do koalas eat honey like other bears?
Do poppy seeds contain narcotics?
Does the human body contain minerals?
How can the heart be strong enough to pump blood up your legs against gravity?
How can we differentiate so many different foods if we can only taste four flavors on our tongue: sweet, bitter, sour, and salty?
How can we unlock the 90% of our brain that we never use?
How did doctors create my belly button?
How did evolution ever lead ostriches to hide their head in the sand when an enemy approaches?
How do I turn on more parts of my brain and get smarter?
How do nerves control every organ and function in the body?
How do trees give earth all its oxygen?
How does the outer layer of skin cells on my finger detect when I am touching an object?
How long before genetic sequencing is able to tell us exactly how our children will look and act?
How long does it take our eyes to fully adapt to darkness?
How much water can a camel store in its hump?
How strong does a non-toxic odor have to be before it damages your sense of smell?
Is human blood ever any color other than red?
Is ionizing radiation always harmful?
Is it completely random whether a baby is a boy or a girl?
What are the five senses of the human body?
What chemicals can make human tissue regenerate in seconds?
What is it about a full moon that makes people do crazy things and commit crimes?
What is it about red that makes bulls so angry?
When did humans stop evolving?
When do birds use their teeth?
Where in my body is the original cell from which I was formed?
Why are bats blind?
Why are human brains the biggest?
Why are red, yellow, and blue the primary colors in painting but computer screens use red, green, and blue?
Why are veins blue?
Why can only certain parts of the tongue taste sweet flavors? Is there an evolutionary benefit to this?
Why can you boil a frog without it jumping out to safety if you raise the temperature slowly?
Why can't color blind people see any colors?
Why did evolution create a chicken that lays so many unfertilized eggs when that is so wasteful?
Why do camera flashes make your eyes turn red?
Why do humans have an appendix even though it is unnecessary?
Why do my fingers absorb water and become wrinkled?
Why does chewing gum take seven years to digest?
Why does every cell in our body contain DNA?
Why does evolution always lead to more advanced species?
Why don't dogs sweat?
Why don't I burst cells in my rear when I sit down?
Why don't our eyeballs fill up with water when we swim?
Why don't trees freeze and burst in the winter like cold pipes?
Why have humans evolved to be taller over the last three hundred years?
Why will a mother bird abandon its chick if touched by a human?
Which location is least likely to experience a volcanic eruption? Α. an island hot spot, such as the island of Hawaii B. Hamilton County on the plains of central Texas с. a convergent boundary, as in the Ring of Fire D a volcanic island arc, such as the Aleutian Arc in Alaska
Answer:
i think that the answer is B. Hamilton County on the plains of central Texas i took the test
Explanation:
Hamilton County on the plains of central Texas is least likely to experience a volcanic eruption. Therefore, option (B) is correct.
What are volcanoes?Molten rock and gases stored under the surface erupt through a volcano, generating a hill or mountain.
Active, inactive, or extinct volcanoes. Active volcanoes are likely to erupt again. Dormant volcanoes may erupt again. Extinct volcanoes won't erupt.Magma collects inside active volcanoes. The magma chamber's pressure forces it through rock channels and onto the planet's surface.
Volcanic eruptions can be violent or slow-moving. Volcanoes erupt through vents on the sides or a primary entrance at the top. The volcano's morphology depends on eruption rate and magma chemistry. Land and sea volcanoes exist. As lava cools and hardens, underwater volcanoes build mountains and ranges. When volcanoes rise above the ocean, they create islands.
Learn more about volcano, here:
https://brainly.com/question/18058649
#SPJ5
Which of the following is true?
a. Extinctions of past species has happened gradually and on a small scale.
b. Bacteria represent a newer form of life, not present during the early prehistory of Earth.
c. Most organisms present early in Earth's prehistory were more complex than modern organisms.
d. Species on Earth today are but a fraction of all species that ever lived.
e. The number of species existing at one time has decreased throughout history.
Answer:
D
Explanation:
So many species on the Earth have gone extinct throughout it's years. Many species have died out over the 4.543 billion years that the earth has existed, and new species are introduced throughout the decades whilst some fade out.
Climate change and succession both result in a change to the ocean ecosystem. What is succession?
a. Succession is a gradual change to ocean temperatures.
b. Succession is a gradual change to ocean communities.
c. Succession is a rapid change in ocean temperatures.
f
d. Succession is a rapid change to ocean communities.
Answer:
b. Succession is a gradual change to ocean communities
Explanation:
An ecosystem can undergo changes in it's structure and composition over a particular period of time. This term is called ECOLOGICAL SUCCESSION. Succession is the gradual change that occurs to a community over time. Succession is of two types; primary and secondary succession.
According to the question, climate change and succession are causes of change to the ocean ecosystem. Hence, succession there represents the gradual change that occurs to the structural composition of ocean ecosystem over time.
Answer:
The answer is B - Succession is a gradual change to ocean communities
Explanation:
Think of primary and secondary succession, these processes take time.
Which multicellular clade arose first in the history of life on Earth? View Available Hint(s) Which multicellular clade arose first in the history of life on Earth? Land plants Animalia Fungi Protista
Answer:
Protista
Explanation:
Protista is the first class of multicellular organism that arose in history. The first of this member is cyanobacteria.
Cyanobacteria is large group of photosynthetic organism that produce their own food by using light energy from sun and carbondioxide.
The first evidence of multicellularity is from cyanobacteria-like organisms that lived 3–3.5 billion years ago.
They help to can convert inert atmospheric nitrogen into an organic form, such as nitrate or ammonia.
The multicellular clade that appeared first in the history of life on Earth is ANIMALIA.
The Kingdom Animalia (also known as Metazoa) is a clade that consists of multicellular-heterotrophic organisms, which cannot synthesize their own food.
It has been estimated that the first animals evolved around 800 million years ago.
The first animals that appeared on the Earth were sponges or sponge-like animals.
In conclusion, the multicellular clade that appeared first in the history of life on Earth is ANIMALIA.
Learn more in:
https://brainly.com/question/9031447?referrer=searchResults
if a wild game animal is slaughtered under usda guidelines can it be prepared and served A:No. A wild game animal can never be served B:Yes a wild game animal can be served C:No wild game animals cannot be eated D:Maybe if you seek usda permission
Answer: C:) No wild game animals cannot be eated
Explanation: hope that helps (:
explain why germinating seeds were used in this investigation cellualr respiration
Explanation:
As oxygen is consumed to provide energy, germinating seeds release carbon dioxide. ... HYPOTHESES: The experimental hypothesis is that germinating seeds will show a greater rate of respiration than control glass beads. Additionally, that at higher temperatures, the rate of cellular respiration in the seeds will increase.
what is a radical a group of ions
Answer:
A radical is a group of atoms of elements carrying a charge. radicals or ions are formed by gaining or loosing ions. positive radical ions are called radical cations whereas negative radical ions are called radical anions.
hope this helps you u :)
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG
Answer:
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
Explanation:
The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20 nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:
Schematically:
The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:
5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'
The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:
3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'
In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.
1. The phenotype of the heterozygous plant is_________.
2. The genotype of the heterozygous plant is_________.
3. The genotype of the plant with yellow pods is________.
4. The genotypes of gametes produced by a heterozigous plant is______.
5. The genotypes of gametes produced by a yellow plant is_______.
A. Green pods
B. 75% AA and 25% Aa
C. AA
D. 100% A
E. Yellow pods
F. 50%
G. 25%
H. 100% a
I. 50% A and 50% a
J. Aa
K. 0%
L. 75%
M. 75% A and 25% a
Answer:
1. Green
2. Aa
3. aa
4. A and a
5. a and a
Explanation:
1. The phenotype of the heterozygous plant (Aa) would be green since the allele responsible for green color (A) is dominant over the allele responsible for yellow color (a).
2. The genotype of a heterozygous plant would be Aa. Heterozygous individuals have different alleles for the same gene.
3. The genotype of the plant with a yellow pod would be aa. Since the allele for green color (A) is dominant over the allele for yellow color (a), the yellow color can be expressed only in the absence of the (A) allele. Hence, the genotype fo yellow color has to be aa.
4. The genotypes of gametes produced by a heterozygous plant would be (A) and (a) because heterozygous individuals have two different alleles for a gene.
5. The genotypes of gametes produced by a yellow plant would be (a) and (a) because a yellow plant has the genotype (aa).
When sweat cools on the skin, removing heat and cooling the body, what process is occurring? A. Parasympathetic nerve conduction B. Respiration C. Homeostasis D. Dehydration
Explanation: it has to be C because i got it right on my test
Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin. What kind of a cell is this?
Answer:
An animal cell in the telophase
Explanation:
Telophase is one of the stages of cell division in animal cell .
In the animal cell during telophase, Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin because the nuclear membrane and nucleoli reform, cytokinesis is almost coming to completion and the chromosomes eventually uncoil to chromatin. Usually cytokinesis occurs during telophase.
Protein that accounts for why water can cross a membrane more quickly than expected is Group of answer choices
Answer:
The correct answer is "Aquaporin".
Explanation:
The missing options of this question are:
A. ATP synthetase
B. Aquaporin
C. The sodium-potassium pump
D. Integrin
The correct answer is option B. "Aquaporin".
Aquaporins are microscopic channels that belong to a family of proteins that form pores. Aquaporins are also known as water channels for its specific biological role of allowing water to cross the cell membrane. The presence of aquaporins explains why water can cross cell membrane more quickly than expected, since they function as regulators of water transference.
What is the process of
evaporation?
A. The process in which plants release vapor into
the atmosphere
B. Any process that returns water from the
atmosphere to the earth
C. The process in which liquid water turns to
water vapor
Which of the following does NOT describe rotation?
spin
counter-clockwise
flip
clockwise
turn
Answer:
I think it's flip if not turn
the origin of a muscle is generally
explain the question more
Answer: The stable and proximal attachment
Explanation:
A layer of cells called the endodermis surrounds the stele. Xylem is found towards the center of the stele and phloem towards the outside of the stele. 18) How does this compare to their arrangement in the stem? 19) The meristematic region is protected in the root by the presence of a root cap. How is the meristematic region protected in the stem tip? 20) In which of these regions would you expect to find the specialized cells of vascular tissue? 21) In which of these regions are the cells genetically identical? 22) Why?
Answer:
Epidermis layer is responsible for the protection of meristematic region.
Explanation:
Meristematic region is protected in the stem tip by epidermis which consist of dead layer of cells. Epidermis is the outer layer of stems, leaves, flowers and fruits which is responsible for the protection of inner part from damage. Vascular bundle such as phloem present near the boundary of the stem while the xylem is present in the inside of the stem. In the inside layer of the stem, all the xylem cells are genetically identical while the layer that is present at the edge of the stem is phloem in which all the cells are genetically identical to each other.
g dGDP is made from ________ by the ribonucleotide reductase. This enzyme is inactive when ______ is bound to its master regulatory pocket.
Answer:
1. GTP dephosphorylation
2. hydrolyzed or removed
Explanation:
GDP, (Guanosine diphosphate) is a biological term, that is made of composition including pyrophosphate group, a pentose sugar ribose, and the nucleobase guanine and it is made from GTP ( Guanosine triphosphate ) dephosphorylation by the ribonucleotide reductase. This enzyme is inactive when hydrolyzed or removed, and then eventually bound to its master regulatory pocket.
DNA is negatively charged. Therefore, it is
O hydrophilic
O hydrophobic
A mutation causes a sequence of DNA that has the nucleotides TTG to be changed to TCG. The resulting protein has a different sequence of amino acids. Which type of mutation is this? a. missense b. nonsense c. silent d. frameshift
Answer:
The correct answer would be - a) missense.
Explanation:
A missense mutation is a type of a point mutation that is caused by the alteration or change in the a nucleotide of a triplet codon in a DNA sequence. This leads to a altered mRNA and incorporate different amino acid and ultimately different protein than usual.
This type of mutation can produce non functional protein by translation in most of the case and did not make any big change in the individual.
Thus, the correct answer would be - a) missense.
Answer:
A. Missense
Explanation:
edge 2020 100%
What are two major drivers of surface ocean current and deep ocean current? 1. Surface ocean current 2. Deep ocean current The choices are: A. Differences in water density, resulting from the variability of water temperature and salinity B. Global wind systems
Answer:
1-B 2-A
Explanation:
this is because the wind blowing over the water causes motion whereas deep water is effected by Differences in water density, resulting from the variability of water temperature and salinity
explain what perlemoen are?
Answer:
Also known as "abalone" which is a
Explanation:
Answer:
any of various edible marine gastropod mollusks of the genus Haliotis
Explanation:
hope this helps
What part of the brain is known as the pleasure center?
A. Brain stem
B. Hypothalamus
C. Thalamus
D. Midbrain
SUBMIT
Answer:
B. Hypothalamus
Explanation:
The hypothalamus contains the pleasure center of the brain, the nucleus accumbens. The hormone dopamine is released from this part of the brain in response to or anticipation of pleasurable activities such as eating good food, monetary rewards as well as when taking psychoactive drugs.
The release of dopamine affects other feelings such as happiness, focus, being alert as well as staying motivated. it also affect some voluntary actions as well.
Constantly seeking out activities that stimulate dopamine release may lead to addiction to such activities as in drug addiction.
List 3 variable that Anurag should keep the same
Answer:
seawater ,upside-down funnel and seaweed
Explanation:
a body may have zero velocity even though its speed is 10m/s. give reason.
Explanation:
because speed is time rate at which an object is moving along a bath, while velocity is the rate and direction of object's movement .
define factors affecting enzyme action:temperature
Answer:
I am secondary level student and this doesn't belongs to my coure till yet however..i have written this through google.....you may search there as well..
Explanation:
Enzyme activity occurs within a narrow range of temperatures compared to ordinary chemical reactions. As you have seen, each enzyme has a certain temperature at which it is more active. This point is called the optimal temperature, which ranges between 37 to 40C°...
Biologists designed an experiment to test the effects of compost on the development of root crops
Answer:
The crop has good yield because Compost has a good effect on root crops.
Explanation:
Compost has a great effect on the development of root crops such as onion, potato, garlic and ginger etc. Compost provide nutrients to these crops as well as soften the soil due to which they grow rapidly. It also improved ventilation, soil structure and soil texture which is very necessary for the crop. Due to ventilation, oxygen gas is available to the roots which increases growth and yield of these crops. Compost also retain water and nutrients so they are available to the roots. So those plots where compost is applied observed increase in yield as compared to other plots.
Which is NOT a function of magnesium in the body?
znutritio acting as a cofactor for enzyme systems in the Irody
regulating bone and mineral status
protecting teeth from acid-forming bacteria
making up one component in bone mineral
Answer: I think it is the third one which states, "Protecting teeth from acid-forming bacteria".
Explanation:
what is angiology????
Explanation:
Angiology is the medical specialty dedicated to studying the circulatory system and of the lymphatic system, i.e., arteries, veins and lymphatic vessels. In the UK, this field is more often termed angiology, and in the United States the term vascular medicine is more frequent
Answer:
- study of blood vessels and lymphatic system..
Explanation:
this is the medical term...is the study of blood vessels and lymphatic system.
what is economic importance of honey bee
Answer:
1. They are one of the most important pollinators for both wild and domestic plants.
2. Their most important product, honey, is used in baking, meals, and drinks. It is also used for shooting sore throat and suppressing the urge to cough. It also reduces the ravages of the aging process and it is an antioxidant that may help in the prevention of cancers. It is a mild salve for treating skin conditions and abrasions.
3. Propolis, a material made when bees mix resin with honey, is used to treat minor wounds and abscesses.
4. Bee pollen which are pollen balls are excellent source of amino acids and vitamins for humans.
5. Royal jelly, which is a milky secretion secreted by worker honey bees is used for asthma, hay fever, pancreatitis, insomnia, premenstrual syndrome, and other diseases.
Which of the following small GTPases are NOT involved in vesicle budding or docking? A. ARF B. Rab1 C. Ras D. Sar1p
Answer:
option c is correct that is Ras
Explanation: