Human Bones
Name three components of bones and describe
their function.

Answers

Answer 1

Answer: 1st the periostneum which is the outside of the bone and a thin but dense layer that has nerves and blood vessels

2nd compact bone. It is very smooth and very hard

3rd and lastly Cancellous, this looks a little like a sponge but much harder.

Explanation:

Answer 2

Answer:

The periosteum is a thin, dense membrane that contains nerves and blood vessels that nourish the bone.

Compact bone is smooth and dense. It is the hard part of the bone.

Cancellous bone looks like a sponge and protects the bone marrow.

Bone marrow is a thick jelly that makes blood cells.

Explanation:

These are the check offs for edge 2021


Related Questions

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

1. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. A phylogenetic tree containing two main branches for evolutionary relationships among the animals.
B. The first branch leads to Drosophila.
C. The second branch divides into two branches, 2a and 2b. Branch 2a leads to Lancelet.
D. Branch 2b divides into two branches: 3a and 3b. Branch 3a leads to Zebrafish.
E. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Frog.
F. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Chicken.
G. Branch 5b divides into two branches leading to Human and Mouse, respectively.
2. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.
B. The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.
C. A frog is the ancestor of both a mouse and a chicken.

Answers

The figure shows a tree diagram with two main branches. The first branch leads to Drosophila. The second branch divides into two branches 3a and 3b. Branch 3a leads to Lancelet. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Zebrafish. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Frog. Branch 5b divides into two branches: 6a and 6b. Branch 6a leads to Chicken. Branch 6b divides into two branches leading to Human and Mouse, respectively.

This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.

The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

A frog is the ancestor of both a mouse and a chicken.

The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.

Answer:

The answer is below

Explanation:

Given the information above, and from the available pictures which showed the detailed analysis of the information presented in the question. It can be concluded that, the nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

Hence, the right answer is option B.

The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the likelihood that an organism could become extinct. Which of the following could also increase an organism's chances of extinction? A. an increase in predation, competition, and/or disease B. a lack of genetic diversity in an organism's species C. the inability to reproduce D. all of these

Answers

Answer:

D

Explanation:

all of those are likely to increase an organisms chances of extinction

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

Select all that apply.
Which conditions relate to the research of van Helmont?
plant mass related only to soil
conclusions partly correct
demonstrated plant food from soil
conducted around 1400 AD.
plant mass related to H 20

Answers

Answer:

I'd say the best Answer is A & C

Explanation:

How do I work this question out I’m struggling

Answers

I think the best thing to do is use a ruler maybe.

An ecologist samples the abundance of various species along an environmental gradient and fails to find clusters of species. Instead, peaks of abundance of dominant species are merely randomly spaced segments along a continuum. This distribution of species supports the

Answers

Answer:

This distribution of species supports Gleason´s Individualistic concept of a community.

Explanation:

This theory was proposed by Gleason and it states that plant species respond individually to environmental factors that continuously change at spatial and temporal levels. This means that the combination and distribution of plants in a certain point or area are unique because each vegetable species has a different distribution pattern and a different tolerance and abundance rate. Hence each species´ response curve to a certain gradient has its own shape and size and it different from other species curves.  

Plants assembly growing in an area is the result of environmental conditions and migration rate of species. As every area is continuously getting propagules of different species, the survival success of each plant depends not only in environmental factors, but also depends on the tolerance to other new species and their interactions. This combination along a gradient always results in different composition and abundance of species. This is why a sample can not be confined to a clearly defined vegetable community.

This point of view is known as individualistic or continuum concept of vegetable community. Gleason believed that vegetable species were distributed as a continuum and that communities can not be identified as combinations of associated species that repeat in space.

Why is it necessary to separate oxgynated blood and deoxgynated blood in living organisums?

Answers

Answer:

For efficient transportation of blood.

Explanation:

Why does the land around a once active coal mine remain barren?
A: Toxic nitrous oxides were released into the soil killing all plants.
B: C: Ozone is formed from hydrocarbons which prevent the growth of plants.
Please don't just take points. Thank you and have a good day

Answers

Hello!!

The answer is A. Toxic nitrous oxides were releassed into the soil killing all plants

Answer:

Empty coal mines are flooded with acid rain so no life forms can survive.

Explanation:

how many different versions of a gene are carried in a single normal cell?

Answers

Answer:

two versions of a gene are carried in a single normal cell called alleles

• How the knowledge of classification be applied to assess the characteristics of different organisms when visit to zoo, herbaria or gardens.(Students may do research on internet to answer this question )
plz correct answer
be quick

Answers

Answer:

Compare two organism on the physical features and mode of nutrition.

Explanation:

Organisms are classified in groups and sub-groups on the basis of similarities and differences. so in order to compare two organisms, start with the similarities that are present between them. If similarities are more so they belong to the same group or if differences are more than both are placed in different groups. for classification, see the physical appearance of organism, mode of nutrition and habitat etc. If organisms are identical, they belong to the same species, if one or two characters are different so their genus will be same but specie is different. In zoo animals are different from the animals which is present in garden so compare the physical features of zoo and garden animals.

Protects the cell and controls what enters and leaves the cell

Answers

Answer:

- Endoplastic reticulum

-cell membrane

-ribosomes

-mithocondrion

^ all the ansers

Explanation:

Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

What is Cell Membrane?

The cell membrane is also called the plasma membrane. It is composed of a semipermeable lipid bilayer that regulates the transport of materials into and out of the cell. It protects the cell and provides a stable environment within the cell, and this membrane serves many functions.

The main function of the cell membrane is to transport nutrients into the cell, while another is to remove toxins from the cell. Cellular membranes are composed of glycerophospholipids, which are molecules composed of glycerol, a phosphate group, and two fatty acid chains.

Thus, Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

Learn more about Cell Membrane, here:

https://brainly.com/question/11906743

#SPJ2

Your question is incomplete, most probably complete question is:

_____Protects the cell and controls what enters and leaves the cell

A) cell wall

B) lysosomes

C)cell membrane

D)Vacuole

HELP
In humans, ventilation, digestion, and blood flow are important biological processes. Explain the relationship between the structure of tissues or organs and one of these processes.

Answers

Answer:

I am assuming the question is asking how do the processes relate to one another.

Explanation:

Ventilation happens in the lungs, where carbon dioxide and oxygen are exchanged in the alveoli. This is done via cappilaries that surround the alveoli. Cappilaries are small blood vessels, which are collecitelvy part of the blood flow system (circulation) of the body. In reguards to the digestion, there are capillaries in the vili (which are tiny finger-like structures) so that they can pick up the nutrients during digestion. Another way blood flow and digestion are connected is because the stomach is a muscle, thus is moves and requires energy. That energy comes from the oxygen and nutrients that is supplied by the blood. These are just some examples.

What can you learn about by studying DNA?

Answers

Answer:

Explanation:

                  The study of human DNA and genetics can be intellectually fascinating, but it also has plenty of practical applications. From the use of DNA in court cases to the discovery of new therapies for genetic diseases, a thorough understanding of the human genome can have important medical, social and legal impacts.

john is testing the effect of temperature on the solubility of sugar in water

Answers

Answer:

As John is testing the effect of temperature on the solubility of sugar in water. To test this, he will measure the amount of sugar dissolved at different temperature level.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

what is a warning safety sign​

Answers

Answer:

Hey there!

A warning safety sign is a sign that warns you that there may be a safety hazard around you.

Let me know if this helps :)

Which of the following statements is true?

Photosynthesis is a type of homeostasis.
Unicellular organisms have differentiated cells.
Respiration is a type of metabolism.
Multicellular organisms are made of only one cell.

Answers

Answer:

Respiration is a type of metabolism.

Answer:

C. Respiration is a type of metabolism

Explanation:

Both B and D are incorrect because:

Multicelluar organisms have more than one cell; while singlecelled organisims only have one cell.

Also, homeostasis is a natural way an organisms body reacts to different situations, like when you sweat, your body is realising a way to lower the heat in your body. Therfore, A. is also incorrect.

Hope this helped!

The opposable thumb is a trait that connects us to other primates; allowing us to grab and use tools and increasing chances for survival. This means it is a(n) __________.

Answers

Answer:

The options to this question are;

A. genotype

B. adaptation

C. selective pressure

D. stabilizing pressure

The answer is B) Adaptation

Explanation:

Adaptation is the process whereby an organism becomes well suited to survive in its natural environment, which is aided by the possession of certain traits called adaptive features. For example, the fins of a fish makes it fit to survive in an aquatic environment, likewise the opposable thumbs of humans make us well suited to survive in our environment.

As stated in the question, the opposable thumb i.e. movement of the thumb independently of the other four fingers, is a characteristics of primates. This unique feature (opposable thumb) allows us to grab things, get a good grasp of tools, use tools effectively, write things, etc. All these ability due to the possession of opposable thumb increases our chances of survival. Hence, the possession of opposable thumb is regarded as an ADAPTATION

Which of the following are all examples of pollution
Pesticide Run-off
Desertification
Global Warming
Poaching
Burning of Fossil Fuels

Answers

Burning fossil fuels

A molecule will become an ion when which of the following happens?

Answers

Loses or gains a charge

1. Viruses such as avian (bird) flu and swine flu that mutate and can spread from animals to human populations are known as what?
O A. Vectors
O B. Transmuting viruses
O C. Epidemics
O D. Zoonoses

Answers

Answer:

B

Explanation:

they are transmuting viruses

B. Transmuting viruses is the answer

-gene 1
-gene 2
-gene 3
How are these three genes related?

Answers

Answer:

Depends on the locations of these gene segment on the chromosome whether it be found on the same or different.

It can either be linked or unlinked.

why is it necessary yo separate oxgynated and deoxgynated blood in livng oranisum

Answers

Explanation:

it is necessary in mammals and birds to separate oxygenated and deoxygenated blood because this makes their circulatory system more efficient and helps in maintaining a constant body temperature

What is the role of Langerhans cells? prevent pathogens from entering the body using antibacterial agents destroy pathogens that enter the body using white blood cells identify pathogens that enter the body and carry them to lymph nodes for destruction

Answers

The role of Langerhans cells is that they prevent pathogens from entering the body using antibacterial agents.

What are Langerhans cells?

Langerhans cell is a dendritic cell of the skin and mucosa, containing Birbeck granules, and present in all layers of the epidermis but most prominent in the stratum spinosum.

Langerhans cells play important roles in the immune system by acting as the outermost guard of the cutaneous immune system where they induce the first reactions against pathogens encountered via the skin.

Therefore, the role of Langerhans cells is that they prevent pathogens from entering the body using antibacterial agents.

Learn more about Langerhans cells at: https://brainly.com/question/15660598

#SPJ2

Answer: 3.identify pathogens that enter the body and carry them to lymph nodes for destruction

Explanation:


Mention the types of bees​

Answers

Answer:

ok thus very good percent few Mohammad khan

if you think about fat as old stuff,what new stuff can be made from it

Answers

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

Fat is derived from plant and animal sources. They include seeds, fruits, fatty fish.

Fats serve as a source of energy in organisms and also serve as insulation.

If you think about fat as old stuff,what new stuff can be made from it means of the things fats can be made from and they include Paints, Lubricants, Biofuel, Face cream, Soap etc. These products are manufactured in industries on a large scale due to their high demand.

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

Which of the traits below are completely influenced by the expression of genes? (Choose all that apply)
weight
attached or unattached earlobes
hair texture
eye color

Answers

Eye color bjfijdjsuddjjdcnvnfjd

Answer:

attached or unattached ear lobes

Help!!!
I'll give brainliest the brainliest. ​

Answers

Answer:

resists the turgor  pressure of the cell:  A : cell wall

controls the activities of  the cell : C : nucleus

site of the chemical  reactions of the cell  including synthesis of  proteins:  D : cytoplasm

Answer:

1. A -  Cell Wall

2. C - Nucleus

3. B. Mitochondria

Give brainliest

Other Questions
Read the lines from this e-mail to a friend.Which lines best show that the wnter has ad stenowrite his experience in a school essay?My first ski trip was so cool! My teacher, Angie, tookme down the mountain lots and lots. The first time Itotally wiped out, which was a bummer. But I rocked itafter a little practiceThis winter I took my first ski trip, and it waswonderful I had an excellent teacher named Angiewho took me on several runs down the mountainAfter a rough beginning, I got much better andenjoyed the entire experienceO I can't wait to show you all the awesome picturestook of my ski trip. Wait til you see them. You willlaugh like crazy! I look totally goofy in my sne vsuitSee ya soon!O Next time you totally have to come with me Buddy!The two of us will have a blast on the slopesPromise you'll try to get your parents to let youcome? Skiing is awesomeO We'll hang out together soon, OK? I will let you tryon my ski boots They feel kinda freaky at first, butNextSub Which of the following is the solution set of the given equation? (x - 3) - 2(x + 6) = -5 a) {-4} b) {8} c) {-10} The distance of planet Mercury from the Sun is approximately 5.8. 107 kilometers, and the distance of planet Venus from the Sun is 1.1 . 108 kilometers. About howmany more kilometers is the distance of Venus from the Sun than the distance of Mercury from the Sun?O 5.2. 107 kilometersO 4.7. 108 kilometersO 5.2. 108 kilometersO 5.7. 109 kilometers why water can reduce unpleasant smell that produce from methane gas ? HELPPPP. How many engineers are there in u.s? Select the correct answer from the drop-down menu.If A and Bare independent events, P(Aand B) =1. P(A)2.P(B)3.P(A) * P(B)4.P(A) + P(B) using methyl ,phenolphthalein and litmus name an acid who was the king prithivi Narayan shah if y - 1/y =8 then find the value of y^2-1/y^3 water was_______ from a hole in the can Look up term Cold War, and explain how The Boys of Winter relates to the Cold War. 5 examples. what is the rename of 10/21 The cycling road race through the Adelaide Hills started at 11:50am and the winnerTook 74 minutes. The winner crossed the nishing line at Put the verbs in brackets into the correct tense1 He talked about Denmark as though he had been. .. (be) there but we know he never has.2 She looks as if she .(be) really ill.3 It looks as though it ..(rain).4 She behaves as if she (be) in trouble.5 The weather here is so bad, it looks as though we .(have to) holiday abroad.6 It smells as if you .(put) lots of herbs in the stew.7 Maeve looked as though she .(have) little sleep thenight before, but she had gone to bed quite early.8 When he speaks, it sounds as if English (not be) his first language.9 She spoke about university as though she ..(spend) years there but in fact shed only spent a month there.10 I spoke to Simon last night and he sounded as though he. (be) really upset about something.11 She sounded as if she .(be) French.12 This sauce tastes as if you (put) too much pepper in it.13 My sister isnt rich but she spends money as though she .. (have) loads of it.14 She acts as though she ..(be) very confident, but in fact shes quite shy.15 She treats me as though I (be) her child.16 He talks about karate as if he (have) a black belt but we know hes only just started lessons.17 Little Tommy was trembling as though he .. (see) a ghost.18 She behaved as if nothing . (happen).19 When Moira broke off their relationship, John behaved as if the world (end).20 That woman looks as though she (faint). Bring her some water . Brian invested his savings in two investment funds. The $8000 that he invested in Fund A returned a 4% profit. The amount that he invested in Fund B returned a 1% profit. How much did he invest in Fund B, if both funds together returned a 2% profit? or what value of g does the function f(g) = g2 + 3g equal 18? The pressure of sea water increases by 1.0atm for each 10m increase in the depth, by what percentage is the density of water increased in the deepest ocean of water of 12km. Compressibility is 5.010^-5 atm 15 POINTS IF SOMEONE ANSWERS QUICK Megan buys condiments in bulk for her restaurant. The company that she orders ketchup from charges $14.78 per gallon for orders less than 8 gallons. For orders of 8 gallons or more, the cost is $11.99 per gallon of ketchup. Which function represents this situation? side note: f(x)= blank [Nora:] When I look back on it, it seems to me as if I had been living here like a poor womanjust from hand to mouth. I have existed merely to perform tricks for you, Torvald. But you would have it so. You and papa have committed a great sin against me. It is your fault that I have made nothing of my life.A Dolls House,Henrik IbsenHow do the archetypes depicted in this passage reveal a theme in the play?Helmers depiction as a villain develops the theme that true happiness resides in equality between men and women.Noras depiction as a mother develops the theme that parents are obligated to take care of their children.Helmers depiction as a ruler develops the theme that money does not bring happiness.Noras depiction as an oppressed innocent reveals the theme that the oppressed live unsatisfying lives.