IMPORTANT ANSWER ALL 3 PLEASE!

IMPORTANT ANSWER ALL 3 PLEASE!

Answers

Answer 1

Answer:

4. Liters

5. Celsius

6. Grams


Related Questions

Kepler's laws, satellites motion and weightlessness

Answers

Answer:

First Kepler law states that Each planet describes an ellipsoidal motion about the sun as its single focus.

Second Kepler law states that An imaginary line joining a planet to the Sun sweeps out equal areas in equal time intervals.

Third Kepler law states that The squares of period of revolution of the planet around the sun are proportional to the cubes of mean distance between the planet and the sun.

Weightlessness is the condition where the body has zero gravity ( its acceleration is equal to the acceleration due to gravity )

[tex].[/tex]

Kepler's law states that the Sun serves as the planet's center of gravity while they travel in elliptical orbits.

What is the Kepler's motion?

Each planet describes an ellipsoidal motion around the sun as its sole focus, according to the first Kepler law.

According to the second Kepler law, an imaginary line between a planet and the Sun sweeps out equivalent areas at equivalent times.

According to the third Kepler law, the squares of a planet's period of revolution around the sun are proportional to the cubes of the planet's mean distance from the sun.

When the body is weightless, there is no gravitational pull on it ( its acceleration is equal to the acceleration due to gravity).

Therefore, the Sun serves as the planet's center of gravity while they travel in elliptical orbits, which is described by Kepler's law.

To learn more about Kepler's motion, refer to the link:

https://brainly.com/question/1608361

#SPJ2

The starter motor of a car engine draws a current of 140 A from the battery. The copper wire to the motor is 4.20 mm in diameter and 1.2 m long. The starter motor runs for 0.760 s until the car engine starts.Required:a. How much charge passes through the starter motor? b. How far does an electron travel along the wire while the starter motor is on?(mm)

Answers

Answer:

(a)106.4C

b)0.5676mm

Explanation:

(a)To get the charge that have passed through the starter then The current will be multiplied by the duration

I= current

t= time taken

Q= required charge

Q= I*t = 140*0.760 = 106.C

(b) b. How far does an electron travel along the wire while the starter motor is on?(mm)

diameter of the conductor is 4.20 mm

But Radius= diameter/2= 4.20/2=

The radius of the conductor is 2.1mm, then if we convert to metre for consistency same then

radius of the conductor is 0.0021m.

We can now calculate the area of the conductor which is

A = π*r^2

= π*(0.0021)^2 = 13.85*10^-6 m^2

We can proceed to calculate the current density below

J = 140/13.85*10^-6 = 10108303A/m

According to the listed reference:

Where e= 1.6*10^-19

n= 8.46*10^28

Vd = J/(n*e) = 10108303/ ( 8.46*10^28 * 1.6*10^-19 ) =0.0007468m/s=0 .7468 mm/s

Therefore , the distance traveled is:

x = v*t = 0.7468 * 0.760 = 0.5676mm

(a) The charge passes through the starter motor is 106.4C.

(b) An electron travel along the wire while the starter motor is on 0.5676mm.

Electron

Answer (a)

I= current

t= time taken

Q= required charge

Q= I*t

Q= 140*0.760

Q= 106.C

Answer (b)

The n electron travel along the wire while the starter motor is on:

Diameter of the conductor is 4.20 mm

Radius= diameter/2= 4.20/2

Radius =2.1mm

Radius of the conductor is 0.0021m.

A = π*r^2

A= π*(0.0021)^2

A= 13.85*10^-6 m^2

Where e= 1.6*10^-19

n= 8.46*10^28

Vd = J/(n*e) = 10108303/ ( 8.46*10^28 * 1.6*10^-19 )

Vd  =0.0007468m/s

Vd =0 .7468 mm/s

The distance traveled is:

x = v*t

x= 0.7468 * 0.760

x = 0.5676mm

Learn more about "Electron":

https://brainly.com/question/1255220?referrer=searchResults

Consider a wire of a circular cross-section with a radius of R = 3.17 mm. The magnitude of the current density is modeled as J = cr2 = 9.00 ✕ 106 A/m4 r2. What is the current (in A) through the inner section of the wire from the center to r = 0.5R?

Answers

Answer:

The current is  [tex]I = 8.9 *10^{-5} \ A[/tex]

Explanation:

From the question we are told that

     The  radius is [tex]r = 3.17 \ mm = 3.17 *10^{-3} \ m[/tex]

      The current density is  [tex]J = c\cdot r^2 = 9.00*10^{6} \ A/m^4 \cdot r^2[/tex]

      The distance we are considering is  [tex]r = 0.5 R = 0.001585[/tex]

Generally current density is mathematically represented as

          [tex]J = \frac{I}{A }[/tex]

Where A is the cross-sectional area represented as

         [tex]A = \pi r^2[/tex]

=>      [tex]J = \frac{I}{\pi r^2 }[/tex]

=>    [tex]I = J * (\pi r^2 )[/tex]

Now the change in current per unit length is mathematically evaluated as

        [tex]dI = 2 J * \pi r dr[/tex]

Now to obtain the current (in A) through the inner section of the wire from the center to r = 0.5R we integrate dI from the 0 (center) to point 0.5R as follows

         [tex]I = 2\pi \int\limits^{0.5 R}_{0} {( 9.0*10^6A/m^4) * r^2 * r} \, dr[/tex]

         [tex]I = 2\pi * 9.0*10^{6} \int\limits^{0.001585}_{0} {r^3} \, dr[/tex]

        [tex]I = 2\pi *(9.0*10^{6}) [\frac{r^4}{4} ] | \left 0.001585} \atop 0}} \right.[/tex]

        [tex]I = 2\pi *(9.0*10^{6}) [ \frac{0.001585^4}{4} ][/tex]

substituting values

        [tex]I = 2 * 3.142 * 9.00 *10^6 * [ \frac{0.001585^4}{4} ][/tex]

        [tex]I = 8.9 *10^{-5} \ A[/tex]

what is liquid pressure and its si unit?

Answers

The SI unit of pressure is the pascal: 1Pa=1N/m2 1 Pa = 1 N/m 2 . Pressure due to the weight of a liquid of constant density is given by p=ρgh p = ρ g h , where p is the pressure, h is the depth of the liquid, ρ is the density of the liquid, and g is the acceleration due to gravity.

Matter's resistance to a change in motion is called

Answers

Answer:

Inertia! I hope this helps!

Answer:

inertia

Explanation

Inertia.

A car accelerates uniformly from rest and reaches a speed of 22.7 m/s in 9.02 s. Assume the diameter of a tire is 58.5 cm. (a) Find the number of revolutions the tire makes during this motion, assuming that no slipping occurs. rev (b) What is the final angular speed of a tire in revolutions per second? rev/s

Answers

(a) The car is undergoing an acceleration of

[tex]a=\dfrac{22.7\frac{\rm m}{\rm s}-0}{9.02\,\mathrm s}\approx2.52\dfrac{\rm m}{\mathrm s^2}[/tex]

so that in 9.02 s, it will have covered a distance of

[tex]x=\dfrac a2(9.02\,\mathrm s)^2\approx102\,\mathrm m[/tex]

The car has tires with diameter d = 58.5 cm = 0.585 m, and hence circumference π d ≈ 1.84 m. Divide the distance traveled by the tire circumference to determine how many revolutions it makes:

[tex]\dfrac{102\,\mathrm m}{1.84\,\mathrm m}\approx55.7\,\mathrm{rev}[/tex]

(b) The wheels have average angular velocity

[tex]\omega=\dfrac{\omega_f+\omega_i}2=\dfrac{\theta_f-\theta_i}{\Delta t}[/tex]

where [tex]\omega[/tex] is the average angular velocity, [tex]\omega_i[/tex] and [tex]\omega_f[/tex] are the initial and final angular velocities (rev/s), [tex]\theta_i[/tex] and [tex]\theta_f[/tex] are the initial and final angular displacements (rev), respectively, and [tex]\Delta t[/tex] is the duration of the time between initial and final measurements. The second equality holds because acceleration is constant.

The wheels start at rest, so

[tex]\dfrac{\omega_f}2=\dfrac{55.7\,\rm rev}{9.02\,\rm s}\implies\omega_f\approx12.4\dfrac{\rm rev}{\rm s}[/tex]

If an electromagnetic wave has components Ey = E0 sin(kx - ωt) and Bz = B0 sin(kx - ωt), in what direction is it traveling?

Answers

Answer:

Its traveling in the +x direction

Explanation:

The E-field is in the +y-direction, and the B-field is in the +z-direction, so it must be moving along the +x-direction, since the E-field, B-field and the direction of moving are all at right angles to each other.

The electromagnetic wave is travelling in the +x direction.

Electromagnetic waves are waves formed as a result of vibrations between an electric field and a magnetic field.

Given that:

Ey = E0 sin(kx - ωt)

Hence the electric field is moving in the +y direction.

Also, Bz = B0 sin(kx - ωt)

Hence the magnetic field is moving in the +z direction

Electric fields and magnetic fields (E and B) in an EM wave are perpendicular to each other and are also perpendicular to the direction of propagation of the wave.

Therefore the direction of the wave is travelling in the +x direction.

Find out more at: https://brainly.com/question/25559554

How much work is needed to pump all the water out of a cylindrical tank with a height of 10 m and a radius of 5 m

Answers

Answer:

Explanation:

volume of water being lifted

= π r² h , where r is radius of cylinder and h is height of cylinder

= 3.14 x5² x 10

= 785 m³

mass of water = 785 x 10³ kg

mass of this much of water is lifted so that its centre of mass is lifted by height

10 / 2 = 5m .

So work done = mgh , m is mass of water , h is displacement of centre of mass and g is acceleration due to gravity

= 785 x 10³ x 9.8 x 5

= 38.465 x 10⁶ J  

Now the friends are ready to tackle a homework problem. A pulse is sent traveling along a rope under a tension of 29 N whose mass per unit length abruptly changes, from 19 kg/m to 45 kg/m. The length of the rope is 2.5 m for the first section and 2.8 m for the second, and the second rope is rigidly fixed to a wall. Two pulses will eventually be detected at the origin: the pulse that was reflected from the medium discontinuity and the pulse that was originally transmitted, which hits the wall and is reflected back and transmitted through the first rope. What is the time difference, Δt, between the two pulses detected at the origin? s

Answers

Answer:

The time difference is 2.97 sec.

Explanation:

Given that,

Tension = 29 N

Mass per unit length [tex]\mu_{1}=19\ kg/m[/tex]

Mass per unit length [tex]\mu_{2}=45\ kg/m[/tex]

Length of first section = 2.5 m

Length of second section = 2.8 m

We need to total distance of first pulse

Using formula for distance

[tex]d=2.5+2.5[/tex]

[tex]d_{1}=5.0\ m[/tex]

We need to total distance of second pulse

Using formula for distance

[tex]d=2.8+2.8[/tex]

[tex]d_{2}=5.6\ m[/tex]

We need to calculate the speed of pulse in the first string

Using formula of speed

[tex]v_{1}=\sqrt{\dfrac{T}{\mu_{1}}}[/tex]

Put the value into the formula

[tex]v_{1}=\sqrt{\dfrac{29}{19}}[/tex]

[tex]v_{1}=1.24\ m/s[/tex]

We need to calculate the speed of pulse in the second string

Using formula of speed

[tex]v_{2}=\sqrt{\dfrac{T}}{\mu_{2}}}[/tex]

Put the value into the formula

[tex]v_{2}=\sqrt{\dfrac{29}{45}}[/tex]

[tex]v_{2}=0.80\ m/s[/tex]

We need to calculate the time for first pulse

Using formula of time

[tex]t_{1}=\dfrac{d_{1}}{v_{1}}[/tex]

Put the value into the formula

[tex]t_{1}=\dfrac{5.0}{1.24}[/tex]

[tex]t_{1}=4.03\ sec[/tex]

We need to calculate the time for second pulse

Using formula of time

[tex]t_{2}=\dfrac{d_{1}}{v_{1}}[/tex]

Put the value into the formula

[tex]t_{2}=\dfrac{5.6}{0.80}[/tex]

[tex]t_{2}=7\ sec[/tex]

We need to calculate the time difference

Using formula of time difference

[tex]\Delta t=t_{2}-t_{1}[/tex]

Put the value into the formula

[tex]\Delta t=7-4.03[/tex]

[tex]\Delta t=2.97\ sec[/tex]

Hence, The time difference is 2.97 sec.

pls try to understand my doubt and clear it
.​

Answers

I can’t read the last few numbers, is that an 8 ??

A tuning fork with a frequency of 335 Hz and a tuning fork of unknown frequency produce beats with a frequency of 5.3 when struck at the same time. A small piece of putty is placed on the tuning fork with the known frequency and it's frequency is lowered slightly. When struck at the same time, the two forks now produce a beat frequency of 8 Hz. 1)What is frequency of tuning fork which originally had a frequency of 335 Hz after the putty has been placed on it

Answers

Answer:

Explanation:

Unknown fork frequency is either

335 + 5.3 = 340.3 Hz

or

335 - 5.3 = 329.7 Hz

After we modify the known fork, the unknown fork frequency equation becomes either

(335 - x) + 8 = 340.3

(335 - x)  = 332.3

x = 2.7 Hz

or

(335 - x) + 8 = 329.7

(335 - x) = 321.7

x = 13.3 Hz

IF the unknown fork frequency was 340.3 Hz,

THEN the 335 Hz fork was detuned to 335 - 2.7 = 332.3 Hz

IF the unknown fork frequency was 329.7 Hz,

THEN the 335 Hz fork was detuned to 335 - 13.3 = 321.7 Hz

Metal 1 has a larger work function than metal 2. Both are illuminated with the same short-wavelength ultraviolet light.
Do electrons from metal 1 have a higher speed, a lower speed, or the same speed as electrons from metal 2? Explain.

Answers

Answer:

a lower speed

Explanation:

Let us look closely at the Einstein's photoelectric equation;

KE= E-Wo

Where;

KE= kinetic energy of the emitted photoelectron

E= energy of the incident photon

Wo= work function of the metal

Hence,where Wo for metal 1 > Wo for metal 2, it follows that KE for metal 1 must also be less than KE for metal 2.

This is because the difference between E and Wo for metal 1 is smaller than the same difference for metal 2 hence the answer.

A defibrillator is a device used to shock the heart back to normal beat patterns. To do this, it discharges a 15 μF capacitor through paddles placed on the skin, causing charge to flow through the heart. Assume that the capacitor is originally charged with 5.0 kV .Part AWhat is the charge initially stored on the capacitor?3×10−9 C7.5×104 C7.5×10−2 C7.5×10−5 CPart BWhat is the energy stored on the capacitor?What is the energy stored on the capacitor?1.9×108 J380 J190 J1.9×10−4 JPart CIf the resistance between the two paddles is 100 Ω when the paddles are placed on the skin of the patient, how much current ideally flows through the patient when the capacitor starts to discharge?5×105 A50 A2×10−2 A5×10−2 APart DIf a defibrillator passes 17 A of current through a person in 90 μs . During this time, how much charge moves through the patient?If a defibrillator passes 17 {\rm A} of current through a person in 90 {\rm \mu s} . During this time, how much charge moves through the patient?190 mC1.5 C1.5 mC17 C

Answers

Answer:

a)  q = 7.5 10⁻² C , b) 190 J , c)  I₀ = 50 A , d) 1.5 mC

Explanation:

The expression for capacitance is

            C = q / DV

            q = C DV

let's reduce the magnitudes to the SI system

            ΔV = 5 kV = 5000 V

            C = 15 μF = 15 10⁻⁶ F

              t = 90 μs = 90 10⁻⁶ s

            q = 15 10⁻⁶ 5000

            q = 7.5 10⁻² C

b) the energy in a capacitor is

             U = ½ C ΔV²

             U = ½ 15 10⁻⁶ 5000²

             U = 1,875 10² J

answer  190 J

c) At the moment the discharge begins, all the current is available and it decreases with time,

whereby

                V = I R

in the first instant I = Io

                I₀ = V / R

                I₀ = 5000/100

                I₀ = 50 A

but this is for a very short time

answer 50 A

d) The definition of current is

            i = dq / dt

in this case they give us the total current and the total time, so we can find the total charge

            i = q / t

            q = i t

            q = 17 90 10⁻⁶

            q = 1.53 10⁻³ C

answer is 1.5 mC

A laboratory electromagnet produces a magnetic field of magnitude 1.38 T. A proton moves through this field with a speed of 5.86 times 10^6 m/s.

a. Find the magnitude of the maximum magnetic force that could be exerted on the proton.
b. What is the magnitude of the maximum acceleration of the proton?
c. Would the field exert the same magnetic force on an electron moving through the field with the same speed? (Assume that the electron is moving in the direction as the proton.)

1. Yes
2. No

Answers

.Answer;

Using Fmax=qVB

F=(1.6*10^-19 C)(5.860*10^6 m/s)(1.38 T)

ANS=1.29*10^-12 N

2. Using Amax=Fmax/ m

Amax =(1.29*10^-12 N) / (1.67*10^-27 kg)

ANS=1.93*10^15 m/s^2*

3. No, the acceleration wouldn't be the same. Since The magnitude of the electron is equal to that of the proton, but the direction would be in the opposite direction and also Since an electron has a smaller mass than a proton

A rod on a compressed spring exerts 12 N of force on a 0.05-kg steel ball. The
rod pushes the ball 0.03 m. How much work does the spring do on the ball?
A) 36
B) 36 N
C) 60 N
D)1.00

Answers

Answer:

Work = 0.36N

Explanation:

Given

Force = 12N

Distance = 0.03m

Weight = 0.05kg

Required

Determine the work done

Workdone is calculated as thus;

Work = Force * Distance

Substitute 12N for Force and 0.03m for Distance

Work = 12N * 0.03m

Work = 0.36Nm

Using proper S.I units

Work = 0.36N

Hence, work done by the spring on the ball is 0.36N

At the pizza party you and two friends decide to go to Mexico City from El Paso, TX where y'all live. You volunteer your car if everyone chips in for gas. Someone asks how much the gas will cost per person on a round trip. Your first step is to call your smarter brother to see if he'll figure it out for you. Naturally he's too busy to bother, but he does tell you that it is 2015 km to Mexico City, there's 11 cents to the peso, and gas costs 5.8 pesos per liter in Mexico. You know your car gets 21 miles to the gallon, but we still don't have a clue as to how much the trip is going to cost (in dollars) each person in gas ($/person).

Answers

Answer:

cost_cost = $ 96

Explanation:

In this exercise we have units in the groin system and the SI system, to avoid problems let's reduce everything to the SI system

   

         performance = 21 miles / gallon (1,609 km / 1 mile) (1 gallon / 3,785 l)

         perfomance= 8,927 km / l

now let's use a direct rule of proportions (rule of three). If a liter travels 8,927 km, how many liters are needed to travel the 2015 km

          #_gasoline = 2015 km (1l / 8.927 km) = 225.72 liters

Now let's find the total cost of fuel. Ns indicates that $ 0.11 = 1 peso and the liter of fuel costs 5.8 pesos

            cost_litre = 5.8 peso ($ 0.11 / 1 peso) = $ 0.638

 

             cost_gasoline = #_gasoline   cost_litro

             cost_gasoline = 225.72   0.638

             cost_gasoline = $ 144

This cost is for the one way trip, the total round trip cost is

             cost_total = 2 cost_gasoline

             cost_total = $ 288

Now let's look for the cost in the vehicle, you and two people will go, for which a total of 3 people will go, so the cost per person is

                cost_person = total_cost / #_people

                cost_person = 288/3

                cost_cost = $ 96

zeugen and yardang differences​

Answers

Answer:

Yardangs are formed on vertical strata while zeugen on horizontal strata. ... Yardangs are formed on vertical hard/soft layers of rock, while zeugen (this is its plural form) are formed on horizontal bands of hard/soft rocks giving it a more mushroom-like shape. The Great Sphinx of Giza has been sculpted in a yardang

Water is pumped with a 120 kPa compressor entering the lower pipe (1) and flows upward at a speed of 1 m/s. Acceleration due to gravity is 10 m/s and water density is1000 kg/m-3. What is the water pressure on the upper pipe (II).

Answers

Answer:

The water pressure on the upper pipe is 92.5 kPa.

Explanation:

Given that,

Pressure in lower pipe= 120 kPa

Speed of water in lower pipe= 1 m/s

Acceleration due to gravity = 10 m/s²

Density of water = 1000 kg/m³

Radius of lower pipe = 12 m

Radius of uppes pipe = 6 m

Height of upper pipe = 2 m

We need to calculate the velocity in upper pipe

Using continuity equation

[tex]A_{1}v_{1}=A_{2}v_{1}[/tex]

[tex]\pi r_{1}^2\times v_{1}=\pi r_{2}^2\times v_{2}[/tex]

[tex]v_{2}=\dfrac{r_{1}^2\times v_{1}}{r_{2}^2}[/tex]

Put the value into the formula

[tex]v_{2}=\dfrac{12^2\times1}{6^2}[/tex]

[tex]v_{2}=4\ m/s[/tex]

We need to calculate the water pressure on the upper pipe

Using bernoulli equation

[tex]P_{1}+\dfrac{1}{2}\rho v_{1}^2+\rho gh_{1}=P_{2}+\dfrac{1}{2}\rho v_{2}^2+\rho gh_{2}[/tex]

Put the value into the formula

[tex]120\times10^{3}+\dfrac{1}{2}\times1000\times1^2+1000\times10\times0=P_{2}+\dfrac{1}{2}\times1000\times(4)^2+1000\times10\times2[/tex]

[tex]120500=P_{2}+28000[/tex]

[tex]P_{2}=120500-28000[/tex]

[tex]P_{2}=92500\ Pa[/tex]

[tex]P_{2}=92.5\ kPa[/tex]

Hence, The water pressure on the upper pipe is 92.5 kPa.

Can a person break a wall with a punch?(I mean technically,maybe with inhuman speed)​

Answers

Answer:

yes, shaolin monks can do. you can find tutorials on Youtb

What is the wavelength of electromagnetic radiation which has a frequency of 3.818 x 10^14 Hz?

Answers

Answer:

7.86×10⁻⁷ m

Explanation:

Using,

v = λf.................. Equation 1

Where v = velocity of electromagnetic wave, λ = wave length, f = frequency.

make λ the subject of the equation

λ = v/f............... Equation 2

Note: All electromagnetic  wave have the same speed which is 3×10⁸ m/s.

Given: f = 3.818×10¹⁴ Hz

Constant: v = 3×10⁸ m/s

Substitute these values into equation 2

λ  =  3×10⁸/3.818×10¹⁴

λ  = 7.86×10⁻⁷ m

Hence the wavelength of the electromagnetic radiation is  7.86×10⁻⁷ m

The wavelength of this electromagnetic radiation is equal to [tex]7.86 \times 10^{-7} \;meters[/tex]

Given the following data:

Frequency = [tex]3.818\times 10^{14}\;Hz[/tex]

Scientific data:

Velocity of an electromagnetic radiation = [tex]3 \times 10^8\;m/s[/tex]

To determine the wavelength of this electromagnetic radiation:

Mathematically, the wavelength of an electromagnetic radiation is calculated by using the formula;

[tex]Wavelength = \frac{Speed }{frequency}[/tex]

Substituting the given parameters into the formula, we have;

[tex]Wavelength = \frac{3 \times 10^8}{3.818\times 10^{14}}[/tex]

Wavelength = [tex]7.86 \times 10^{-7} \;meters[/tex]

Read more wavelength on here: https://brainly.com/question/6352445

An electron in the first energy level of the electron cloud has an electron in the third energy level

Answers

Answer:

a lower energy than

Explanation:

sorry im a month late but is lower energy than

A diffraction grating with 200 lines per mm is used in an experiment to study the visible spectrum of a gas discharge tube. At what angle from the beam axis will the first order peak occur if the tube emits light with wavelength of 617.3 nm

Answers

Answer

123.5 x 10 ^-3 radian

Explanation:

Given the Width of slit a = 1 x 10⁻³ / 200

a = 5x 10⁻⁶ m .

angle at which first order peak is formed

= λ / a (where λ is wavelength and a is width of slit)

given λ = 617.3 x 10⁻⁹ m

a = 5 x 10⁻⁶

θ = 617.3 x 10⁻⁹ / 5 x 10⁻⁶

= 123.5x 10⁻³ radian .

first order peak is formed at an angle of 123.5 x 10⁻³ radian .

Explanation:

The four wheels of a car are connected to the car's body by spring assemblies that let the wheels move up and down over bumps and dips in the road. When a 68 kg (about 150 lb) person sits on the left front fender of a small car, this corner of the car dips by about 1.2 cm (about 1/2 in).

If we treat the spring assembly as a single spring, what is the approximate spring constant?

k= ____________

Answers

Answer:

The approximate  spring constant is  [tex]k = 55533.33 \ N/m[/tex]

Explanation:

From the question we are told that

   The  mass of the person is  [tex]m = 68 \ kg[/tex]

     The  dip of the car is  [tex]x = 1.2 \ cm = 0.012 \ m[/tex]

Generally according to hooks law  

        [tex]F = k * x[/tex]

here the force F is the weight of the person which is mathematically represented as

         [tex]F = m * g[/tex]

=>    [tex]m * g = k * x[/tex]

=>     [tex]k = \frac{m * g }{x }[/tex]

=>    [tex]k = \frac{68 * 9.8}{ 0.012}[/tex]

=>   [tex]k = 55533.33 \ N/m[/tex]

1 hallar el trabajo mecanico de un cuerpo que tiene una fuerza de 250 newton y recorre 750 metros

2 hallar la potencia necesaria para levantar un transformador de masa 2500kg,una altura de 4 metros en un tiempo de 30 segundos
porfa es para hoy

Answers

Answer: TRACK

Explanation:

a ball is kicked on level ground with a speed of 30 m/s at angle of 40 degrees above horizontal g Find the minimum velocity of the ball during its flight

Answers

Answer:

The minimum velocity of the ball during its flight is 22.98 m/s.

Explanation:

The velocity of the ball v = 30 m/s

The angle it makes with the horizontal ∅ = 40°

The minimum velocity of the ball during flight will be the horizontal axis component of the velocity, as acceleration is zero on this axis.

[tex]V_{x}[/tex] = v cos ∅

[tex]V_{x}[/tex]  = 30 cos 40°

[tex]V_{x}[/tex] = 30 x 0.766 = 22.98 m/s

A 80 kg bungee jumper is on a bridge that is 100 meters above a river. Attached to the jumper is a bungee cord that is 50 meters long. After jumping off of the bridge, the jumper reaches a position that is 10 meters above the river when the bungee cord is at its maximum stretch.

Required:
a. How much energy is stored in the bungee cord at that maximum stretch?
b. What is the spring force constant of the bungee cord?

Answers

Answer:

a) 70,560 J

b) 88.2 N/m

Explanation:

The spring potential will equal the change in gravity potential

PS = PE = mgh = 80(9.8)(100 - 10) = 70,560 J

PS = ½kx²

k = 2PS/x² = 2(70560)/(100 - 50 - 10)² = 88.2 N/m

During the spin cycle of your clothes washer, the tub rotates at a steady angular velocity of 31.7 rad/s. Find the angular displacement Δθ of the tub during a spin of 98.3 s, expressed both in radians and in revolutions.

Answers

Answer:

[tex]\Delta \theta = 3116.11\,rad[/tex] and [tex]\Delta \theta = 495.944\,rev[/tex]

Explanation:

The tub rotates at constant speed and the kinematic formula to describe the change in angular displacement ([tex]\Delta \theta[/tex]), measured in radians, is:

[tex]\Delta \theta = \omega \cdot \Delta t[/tex]

Where:

[tex]\omega[/tex] - Steady angular speed, measured in radians per second.

[tex]\Delta t[/tex] - Time, measured in seconds.

If [tex]\omega = 31.7\,\frac{rad}{s}[/tex] and [tex]\Delta t = 98.3\,s[/tex], then:

[tex]\Delta \theta = \left(31.7\,\frac{rad}{s} \right)\cdot (98.3\,s)[/tex]

[tex]\Delta \theta = 3116.11\,rad[/tex]

The change in angular displacement, measured in revolutions, is given by the following expression:

[tex]\Delta \theta = (3116.11\,rad)\cdot \left(\frac{1}{2\pi} \frac{rev}{rad} \right)[/tex]

[tex]\Delta \theta = 495.944\,rev[/tex]

The sentence, "The popcorn kernels popped twice as fast as the last batch," is a(n) _____. experiment hypothesis observation control

Answers

The correct answer is C. Observation

Explanation:

An observation is a statement a describes a phenomenon, which is the result of measuring the phenomenon or using the senses to collect information about it. Additionally, observations are part of the Scientific method because through observations it is possible to understand phenomena.

The sentence presented is an observation because this statement is the result of the researcher observing or measuring how fast kernels pops, which means the statement derives from studying a phenomenon. Also, this cannot be classified as a hypothesis because a hypothesis is a probable explanation, and it cannot be classified as an experiment because the experiment is the general method to prove or disprove a hypothesis.

A train on one track moves in the same direction as a second train on the adjacent track. The first train, which is ahead of the second train and moves with a speed of 36.4 m/s , blows a horn whose frequency is 123 Hz .what is its speed?

Answers

Answer:

51. 7m/s

Explanation:

Take speed of sound in air = 340 m/s

fp = fs (V + Vp)/(V + Vs)

128 = 123 (340 + Vp)/(340 + 36.4)

Vp = 51.7m/s

Explanation:

A fish is 11.9 cm from the front surface of a fish bowl of radius 33 cm. Where does the fish appear to be to someone in air viewing it from in front of the bowl

Answers

Answer:

The fish would appear 42.7 cm on the left side from the front of the bowl.

Explanation:

The fish (object) distance = 11.9 cm, radius of curvature of the bowl = 33 cm. The distance of image of the fish (image distance) can be determined by applying the mirror formula;

[tex]\frac{1}{f}[/tex] = [tex]\frac{1}{u}[/tex] + [tex]\frac{1}{v}[/tex]

where f is the focal length of the reflecting surface, u is the object distance and v is the image distance.

But, f = [tex]\frac{radius of curvature}{2}[/tex]

         = [tex]\frac{33}{2}[/tex]

       f = 16.5 cm

Substitute f = 16.5 = [tex]\frac{165}{10}[/tex], and u = 11.9 = [tex]\frac{119}{10}[/tex] in equation 1;

[tex]\frac{10}{165}[/tex] = [tex]\frac{10}{119}[/tex] + [tex]\frac{1}{v}[/tex]

[tex]\frac{1}{v}[/tex] = [tex]\frac{10}{165}[/tex] - [tex]\frac{10}{119}[/tex]

  = [tex]\frac{1190 - 1650}{19635}[/tex]

[tex]\frac{1}{v}[/tex] = [tex]\frac{-460}{19635}[/tex]

⇒ v  = [tex]\frac{19635}{-460}[/tex]

       = -42.6848

    v = 42.7 cm

The fish would appear 42.7 cm on the left side from the front of the bowl.

Other Questions
What are words used in place of nouns, such as "T" and "him"?A. Personal pronounsB. SimileC. Rule of ThreeD. Rhetorical question regional disparity must be ended for proportionate natinal development An expensive vacuum system can achieve a pressure as low as 1.53 107 N/m2 at 26C. How many atoms are there in a cubic centimeter at this pressure and temperature? What is one way that Henrys speech uses gurative language QuestionConsider these functions.f(x) = -9x + 14g(x)=-3x2Select the correct answer from each drop-down menu.iIf x = 6, then f(6)If g(x) -48, then x =and x =Submit Question 2 of 10While writing a persuasive piece, which appeal should you use to get youraudience to believe and trust you?A. PathosB. ToneC. EthosD. SimileSUBMIT A horizontal spring with spring constant 85 N/m extends outward from a wall just above floor level. A 2.5 kg box sliding across a frictionless floor hits the end of the spring and compresses it 6.5 cm before the spring expands and shoots the box back out. How fast was the box going when it hit the spring Rearrange the equation so x is the independent variable. y+6=5(x-4) The following unadjusted trial balance is prepared at fiscal year-end for Nelson Company. 1.NELSON COMPANY Debit Credit2. Cash $1,000 3. Merchandise Inventory 12,500 4. Store supplies. 5,800 5. Prepaid Insurance. 2,400 6. Store equipment. 42,900 7. Accumulated depreciation - Store equipment $15,2508. Accounts payable 10,0009.J. Nelson, Capital 32,00010.J. Nelson, Withdrawal 2,200 11. Sales. 111,95012. Sales discounts 2,000 13. Sales returns and allowances 2,200 14. Cost of goods sold 38,400 15. Depreciation expense- Store equipmen 0 16. Salaries expense 35,000 17. Insurance expense 0 18. Rent expense 15,000 19. Store supplies expense 0 20. Advertising expense 9,800 21. Totals $169,200 169,200Nelson company uses a perpetual inventory system. It categorizes the following accounts as selling expenses: Required:1. Prepare adjusting journal entries to reflect each of the following:a. Store supplies still available at fiscal year-end amount to $1,750.b. Expired insurance, an administrative expense, for the fiscal year is $1,400.c. Depreciation expense on store equipment, a selling expense is $1,525 for the fiscal year.d. To estimate shrinkage, a physical count of ending merchandise inventory is taken. It shows $10,900 of inventory is still available at fiscal year-end.2. Prepare a multiple-step income statement for fiscal year 2015.3. Comple the statement of retained earnings and the balance sheet.4. Compute the current ratio, acid-test ratio, and gross margin ratio as of January 31, 2015. (Round ratios to two decimals.) What part of the brain is known as the pleasure center?A. Brain stemB. HypothalamusC. ThalamusD. MidbrainSUBMIT A sprinkler system is being installed in a newly renovated building on campus. The average activation time is supposed to be at most 20 seconds. A series of 12 fire alarm/sprinkler system tests results in an average activation time of 21.5 seconds. Do these data indicate that the design specifications have not been met? The hypotheses to be tested are H0: m = 20 versus Ha: m > 20, where m = the true average activation time of the sprinkler system. Assume that activation times for this system are Normally distributed with s = 3 seconds. (a) What is the value of the observed test statistic? (b) What is the value of the P-value? (c) Are the data statistically significant at the 5% significance level? Explain briefly. (d) What does the decision you made mean with respect to the question "Do these data indicate that the design specifications have not been met?" (e) If the true average activation time of the sprinkler system is, in fact, equal to 20 seconds, what type of error would you have made? [09.01]Identify the domain of the equation y=x2 - 6x + 1. (1 point) You are in charge of paying claims submitted by providers. You notice a certain diagnostic provider ("Doe Diagnostics") requested a substantial payment for a large number of members. Many of these claims are for a certain procedure. You review the same type of procedure for other diagnostic providers and realize Doe Diagnostics' claims far exceed any other provider you reviewed. What should you do? Morganton Company makes one product and it provided the following information to help prepare the master budget:The budgeted selling price per unit is $70. Budgeted unit sales for June, July, August, and September are 8,500, 16,000, 18,000, and 19,000 units What is the accounts receivable balance at the end of July? Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why