Instructions: Determine if the two triangles in
the image are congruent. If they are, state how
you know by identifying the postulate.
th

Instructions: Determine If The Two Triangles Inthe Image Are Congruent. If They Are, State Howyou Know

Answers

Answer 1

The 2 triangles are congruent

Instructions: Determine If The Two Triangles Inthe Image Are Congruent. If They Are, State Howyou Know

Related Questions

3 ratios that are equivalent to 6:12

Answers

Answer:

1:3

2:4

3:6

Step-by-step explanation:

we can divide both sides by 6 and get 1:2

we can divide both sides by 3 and get 2:4

we can divide both sides by 2 and get 3:6

Answer:

12:24, 3:6, 2:4

Step-by-step explanation:

What we are looking for here is a ratio that, when you divide/multiply the same constant on both parts of the ratio, you get 6:12.

6:12 is the same thing as 1:2, so we can find ratios equivalent to 1:2 (the first value will be half the second).

Hope this helped!

convert 8 7/9 yard into in

Answers

Answer:

316.08 inches

Step-by-step explanation:

There are 3 feet in a yard, and there is 12 inches in 1 foot, so there are 36 inches in one yard. If there is 8 7/9 yards it is the same at 8.78 yards, and  8.78 x 36 = 316.08 inches. Therefore 8 7/9 yards = 316.08 inches.

what's the equation that represents the new path​

Answers

Answer:

A: y= 1/4x - 7

if it is perpendicular, then it creates 4 right angles. so that new line would pass through (0,-7) and something else that isnt important. but the slope, or m, would be 1/4, and the y intercept would be -7. so the new equation is y=1/4x-7

If f(x) = 4x + 3 and g(x) = 22 – 3, then f(g(4)) = ???

Answers

g(4) = 19
f(19) = 79

So f(g(4)) = 79

Answer:

f(g(4))=79

Step-by-step explanation:

given:

f(x) = 4x + 3

g(x) = 22 – 3

g(x) = 19

the x in parentheses represents x's value. if it is just x then example f(x)=3x would be 3x. if f(x) was f(2)=3x, then x would be 2 and f(2)=3x would be 3*2=6

f(g(4))

first solve g(4)

g(x) = 19

g(4)=19     because there are no x

then substitute

f(g(4))

f(19)

f(19) = 4x + 3

all x become 19

f(19) = 4(19) + 3

       =76+3

        =79

hope this helps.

Solve for x in the diagram below.
30°
80°
2.cº
T =

Answers

180 = 80 + 2x + 3x
100 = 5x
x = 20

Hello, there!!!!

Given that,

80°,3x° and 2x°are three angles on a st.line.

we have,

2x°+3x°+80°= 180° {The total sum of angles on a st. line is 180°}.

or, 5x°= 180°-80°

or, 5x°=100°

or, x= 100°/5

Therefore the value of x is 20°.

Hope it helps...

The Bookstall Inc. is a specialty bookstore concentrating on used books sold via the Internet. Paperbacks are $1.35 each, and hardcover books are $3.50. Of the 60 books sold last Tuesday morning, 55 were paperback and the rest were hardcover. What was the weighted mean price of a book? (Round your answer to 2 decimal places.)

Answers

Answer:

dddddd okaksy ogvurn

Step-by-step explanation:

d

What is the wavelength of light with 5.53 x 10-19 J of energy? (The speed of
light in a vacuum is 3.00 x 10 m/s, and Planck's constant is 6.626 10-34
J•s.)
A. 399 nm
B. 278 nm
C. 250 nm
D. 359 nm

Answers

Answer:

D. 359 nm

[tex]{ \boxed{ \bf{ energy = \frac{hc}{ \lambda} }}} [/tex]

lambda is the wavelength

c is the speed of light

h is the Planck's constant

[tex]{ \sf{5.53 \times {10}^{ - 19} = \frac{(6.626 \times {10}^{ - 34}) \times (3.00 \times { {10}^{8} }) }{ \lambda} }} \\ \\ { \sf{\lambda = 3.59 \times {10}^{ - 7} }} \\ { \sf{\lambda = 359 \: nm}}[/tex]

For the right angle, find the missing quantity indicated below the figure.

Answers

Answer:

The Answer is 28.........

On Monday the temperature is 0F on Tuesday it is seven degrees warmer what is the temperature?

Answers

Answer:

7F

Step-by-step explanation:

Add 7 to 0

0+7 = 7F

Answer:

obviously 7F

Step-by-step explanation:

Just add 7 to the zero and its 7F

This test statistic leads to a decision to...

reject the null

accept the null

fail to reject the null



As such, the final conclusion is that...

There is sufficient evidence to warrant rejection of the claim that the population mean is not equal to 88.9.

There is not sufficient evidence to warrant rejection of the claim that the population mean is not equal to 88.9.

The sample data support the claim that the population mean is not equal to 88.9.

There is not sufficient sample evidence to support the claim that the population mean is not equal to 88.9.

Answers

Answer:

There is not sufficient sample evidence to support the claim that the population mean is not equal to 88.9.

Step-by-step explanation:

We are given the following hypothesis below;

Let [tex]\mu[/tex] = population mean.

So, Null Hypothesis, [tex]H_0[/tex] : [tex]\mu[/tex] = 88.9      {means that the population mean is equal to 88.9}

Alternate Hypothesis, [tex]H_A[/tex] : [tex]\mu\neq[/tex] 88.9     {means that the population mean is different from 88.9}

The test statistics that will be used here is One-sample t-test statistics because we don't know about population standard deviation;

                             T.S.  =  [tex]\frac{\bar X-\mu}{\frac{s}{\sqrt{n} } }[/tex]  ~  [tex]t_n_-_1[/tex]

where, [tex]\bar X[/tex] = sample mean = 81.3

             s = sample standard deviation = 13.4

            n = sample size = 7

So, the test statistics =  [tex]\frac{81.3-88.9}{\frac{13.4}{\sqrt{7} } }[/tex]   ~ [tex]t_6[/tex]

                                     =  -1.501

The value of t-test statistics is -1.501.

Also, the P-value of the test statistics is given by;

                    P-value = P([tex]t_6[/tex] < -1.501) = 0.094

Since the P-value of our test statistics is more than the level of significance as 0.094 > 0.01, so we have insufficient evidence to reject our null hypothesis as the test statistics will not fall in the rejection region.

Therefore, we conclude that the population mean is equal to 88.9.

Write a variable expression for a number w increased by 4 (A) 4 ÷ w (B) w + 5 (C) w + 4

Answers

Answer:

C) w+4

Step-by-step explanation:

w=the variable

+4= increased by 4

HOPE THIS HELPS!!!!!! :)

<33333333333

Given the polynomial, identify the coefficients and degree of each term:

Answers

Answer:

See below.

Step-by-step explanation:

The degree is simply the number of the exponent (or the sum) and the coefficient is simply the number in front of the term.

First Term: -7; Deg=0, Co=-7.

-7 is the same as saying -7x^0. Thus, the degree is 0.

Second Term: -x^4; Deg=4, Co=-1

-x^4 is the same as saying -1(x^4). Thus, the degree is 4 while the coefficient is -1.

Third Term: -5x^3; Deg=3, Co=-5

Again, this is the same as saying -5(x^3). Thus, the degree is 3 while the coefficient is -1.

Fourth Term: 7x; Deg=1, Co=7

7x is the same as saying 7x^1. Thus, the degree is 1 while the coefficient is 7.

Fifth Term: x^2; Deg=2, Co=2

x^2 is the same as 1(x^2). Thus, the degree is 2 while the coefficient is 1.

The leading coefficient is the first coefficient when the polynomial is placed in descending order based on degree number. First, arrange the polynomial into descending order based on the degree:

[tex]-x^4-5x^3+x^2+7x-7[/tex]

Thus, the leading coefficient is -1 (belonging to the x^4).

The degree of the leading term will always be the highest. In this case, it is 4.

The degree of the polynomial is the highest degree. In this case, it is 4.

PLEASE HELP ! (4/5) - 50 POINTS -

Answers

Answer:

[tex]\large \boxed{\sf A) \ 12}[/tex]

Step-by-step explanation:

Frequency of a specific data value at an interval is the number of times the data value repeats in that interval.

Cumulative frequency is found by adding each frequency to the frequency that came before it.

cStep-by-step explanation:

Which number is divisible by 10? 148 99 121 100

Answers

Answer:

100

Step-by-step explanation:

100/ 10

= 10

A plane is flying at the height of 5000 meter above the sea level. at a particular point, it is excatly above a submarine floating 1200 meter below the sea level. what is the vertical distance between them ?

Answers

Answer:

3800 meters

Step-by-step explanation:

In an article of 12200 you get Rs 3050 cash discount. Then find the discount percent

Answers

Answer:

25%discount

Step-by-step explanation:

List price=12200,

Discount=3050

[DISCOUNT%=(DISCOUNT/LIST PRICE)×100]

D%=(3050/12200)×100

D%=25%

If average of the numbers 3,9,5,7 and Q is 5 times the value of Q, find the value of Q

Answers

Answer:

q=6

Step-by-step explanation:

3+9+5+7+Q=5Q

5Q-Q=24

Q=6

Which of the following is NOT a property of a paralleogram? * The opposite sides are equal. The opposite angles are equal. Each diagonal bisects the parallogram. The diagonals of all parallograms bisect each other at 90 degree angles. I will give brainliest

Answers

Answer:

The diagonals of all parallelograms do not bisect each other at 90 degree angles.

Step-by-step explanation:

A rectangle has an area of 81 square centimeters. Which of the following would be the rectangle's length and width? (Area = equals length×times width)

Answers

Answer:

length: 9cm

width: 9cm

Step-by-step explanation:

9×9=81

the length is 9cm and the width is also 9cm

An experimental probability is ______ likely to approach the theoretical probability if the number of trials simulated is larger. A. as B. more C. less D. not

Answers

Answer:

I believe your answer is b. the more trials you conduct, the more information you have

An experimental probability is more likely to approach the theoretical probability if the number of trials simulated is larger. Then the correct option is B.

What is probability?

Its basic premise is that something will almost certainly happen. The percentage of favorable events to the total number of occurrences.

Experimental probability: A probability that is established from the findings of several iterations of a test.

Theoretical probability: The proportion of positive consequences to all potential outcomes. The ratio of the favorable event to the total event.

An experimental probability is more likely to approach the theoretical probability if the number of trials simulated is larger.

Then the correct option is B.

More about the probability link is given below.

https://brainly.com/question/795909

#SPJ2

Verify that the Divergence Theorem is true for the vector field F on the region E. F(x,y,z)=3xi+xyj+2xzk, E is the cube bounded by the planes x=0, x=1, y=0, y=1, z=0 and z=1

Answers

Answer: 9/2

Step-by-step explanation: Find explanation in the attached file

What is the correct standard form of the equation of the parabola? Enter your answer below. Be sure to show each step of your work.

Answers

Answer:

Step-by-step explanation:

eq. of directrix is y=4 or y-4=0

perpendicular distance of (x,y) from directrix =distance of (x,y) from focus (-3,2)

[tex]| \frac{y-4}{1}|=\sqrt{(x+3)^2+(y-2)^2} \\squaring~both~sides\\y^2-8y+16=(x+3)^2+(y-2)2\\(x+3)^2=y^2-8y+16-(y-2)^2\\(x+3)^2=y^2-8y+16-(y^2-4y+4)\\(x+3)^2=y^2-8y+16-y^2+4y-4\\(x+3)^2=-4y+12\\(x+3)^2=-4(y-3)[/tex]

Which is the best definition for the term "segment bisector"?

Answers

Answer:

a line that cuts a segment into two pieces of equal length.

if f(x)=3-2x and g(x)= 1/x+5 what is the value of (f/g) (8)​

Answers

Answer:

Step-by-step explanation:

(f/g) = (3 - 2x ) / (1/x + 5) You could go to the trouble to simplify all of this, but the easiest way is to just put in the 8 where you see an x

(f/g)8 = (3 - 2*8) / (1/8 + 5)

(f/g)/8 = (3 - 16 / (5 1/8)          1/8 = 0.125

(f/g) 8 = - 13 / ( 5.125)

(f/g)8 = - 2.54



What is the image point of (4, -6) after a translation right 5 units and up 4 units?

Answers

Answer:

(9,-2)

Step-by-step explanation:

5 is the x coordinate, and 4 is the y coordinate. When you go right a certain amount of units, you add those units to your x coordinate. If you were to go left a certain amount of units, you'd subtract them. Since we're going right, 5 + 4 = 9. When you go up a certain amount of units, you add those units to you y coordinate. If you were to go down a certain amount of units, you'd subtract them.  Since we're going up, -6 + 4 = -2. So, x = 9 and y = -2, or (9,-2)

Claire has to go to the movie theater the movie starts at 4:15 pm it is a 25min walk to the theater from her home what time dose the have to leave the house to get there on time

Answers

Answer:

claire has to leave at 3:50 from her house.

Answer:

She needs to leave by 3:50 to get there on time.

Step-by-step explanation:

4:15 - 0:25 = 3:50.

A salon and spa chain periodically analyzes its service times to check for variation in service processes using x-bar and R charts. Daily random samples, each containing service times observed with eight different customers are collected. The average mean and the average range of the service times for the past week were 27.2 and 3.76 minutes, respectively. The value of D4 for a sample size of eight is 1.864. What is the upper control limit (UCL) for the R-chart

Answers

Answer:

7.00864

Step-by-step explanation:

The upper control limit for R -chart can be computed by using following formula

UCL=Rbar*D4.

We are given that average range R bar is

Rbar=3.76.

The value of D4 for n=8 is also given that is

D4=1.864.

Thus, the required computed upper control limit is

UCL=3.76*1.864=7.00864.

find the range. 83, 71, 62, 86, 90, 95, 61, 60, 87, 72, 95, 74, 82, 54, 99, 62, 78, 76, 84, 92

Answers

Answer: 45

Step-by-step explanation: The range is the difference between the greatest number in the data set and the least number in the data set which in this case is 99 - 54 or 45. So the range of this data set is 45.

Answer:

[tex] \boxed{45}[/tex]

Step-by-step explanation:

Given data:

83 , 71 , 62 , 86 , 90 , 95 , 61 , 60 , 87 , 72 , 95 , 74 , 82 , 54 , 99 , 62 , 78 , 76 , 84 , 92

largest value = 99

Smallest value = 54

Let's find the range:

Range = Largest value - smallest value

= 99 - 54

= 45

Extra information:

Range

It is the simple method of measuring the variations. A range is defined as the difference between the largest and the smallest value of distribution. If the data are arranged in ascending or descending order, then the difference between the largest and smallest value is called the range.

The range is defined by

Range = Largest value - smallest value i.e ( highest value - lowest value )

= L - S

Range is the absolute measure of dispersion = L - S

Thus, if a₁ , a₂ , a₃ ...............aₙ are n term in a sequence arranged in ascending order, the range is given by

R = a - a where a₁ is the smallest value and aₙ is the highest value or R = L - S , where L is the largest value and S is the smallest value.

Hope I helped!

Best regards!

5. Refer to the figure shown. Determine the measure of
the unknown angle. Show or explain your thanking.

Answers

Answer:

you haven't posted any diagram

Step-by-step explanation:

Zamba has found a little black dress on sale for 50% off the original price of $239.99. She also has a coupon offering free shipping and an additional 10% off of her entire online purchase. If she buys the dress and a pair of shoes costing $34.70, how much will she pay for her ensemble?

$108.00
$104.70
$94.23
$139.23

Answers

Answer:

$139.23

Step-by-step explanation:

50% off the original price of $239.99

= $239.99-(0.5*239.99)

= 239.99-119.995

= $119.995

She purchase a pair of shoes also worth $34.70

Total cost now= $119.995 + $34.70

Total cost now= $154.695

But she has a coupon that gives her 10% off her total sales

Now she wants pay

= $154.695 - 0.1(154.695)

= $154.695-15.4695

= $139.2255

Approximately $139.23

Other Questions
34% of working mothers do not have enough money to cover their health insurance deductibles. You randomly select six working mothers and ask them whether they have enough money to cover their health insurance deductibles. The random variable represents the number of working mothers who do not have enough money to cover their health insurance deductibles. Required:Construct a binomial distribution using n= 0.6 and p=0.34 Given that T{X: 2 Help me with this question for 10 points please A piece of equipment (Asset class 15.0) was purchased by the Jones Construction Company. The cost basis was $300,000. Determine the ADS and GDS depreciation deduction for this property each year Green Inc. made no adjusting entry for accrued and unpaid employee wages of $38,000 on December 31. This error would Multiple Choice Understate assets by $38,000. Overstate net income by $38,000. Understate net income by $38,000. Have no effect on net income. PLEASE HELP ASAP T^T How did Louisiana's political boundaries change since it's founding the French in 1682 How much heat is required to convert 5.0 kg of ice from a temperature of - 20 0C to water at a temperature of 205 0F In a recent survey of drinking laws, a random sample of 1000 women showed that 65% were in favor of increasing the legal drinking age. In a random sample of 1000 men, 60% favored increasing the legal drinking age. Test the claim that the percentage of men and women favoring a higher legal drinking age is different at (alpha 0.05). Which, if any, pair of sides are parallel? AB II DC and AD II BC Cannot be determined AB II DC only AD II BC only Restriction digest A:ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCCHow many bases are in the second fragment? Each employee in a company is either right-handed or left-handed.32 of the 54 employees are female.18 of the 41 right-handed employees are male.Complete the frequency tree for this information.right-handedfemaleleft-handed54000right-handedmaleleft-handedTotal marks: 3 A metal blade of length L = 300 cm spins at a constant rate of 17 rad/s about an axis that is perpendicular to the blade and through its center. A uniform magnetic field B = 4.0 mT is perpendicular to the plane of rotation. What is the magnitude of the potential difference (in V) between the center of the blade and either of its ends? help with this thanks He is playing football into past continuous What do you predict the chemical formula for the compound formed between calcium and sulfur? You go on a trip to the Galapagos island to study the animals there for a paper you are writing on evolution, just like Darwin did. You spend 3 days taking notes on all the physical characteristics you can observe about the tortoises and then you spend 3 days observing the finches. What have you recorded? A. Inherited characteristics B. Environmental variation factors C. Phenotypes D. Genotypes The total number of cupcakes soldduring 5 days was 2087. The number of cupcakes sold by the shop on Thursday was 3 times the cupcakes sold on Monday. How many cupcakes were sold on Thursday? What was the first military action the Confederacy took?A. Capturing Fort Sumter from the Union armyB. Sending troops to capture Washington, D.C.C. Declaring martial law in BaltimoreD. Sinking Union naval vessels in Virginia What is the frequency of a wave that has a wavelength of .20 m and a speed of 22 m/s