Lee lo siguiente. La Mezquita de Córdoba _[blank 1]_ patrimonio mundial desde 1984. ¿Se _[blank 2]_ mucho en el parque de diversiones? El restaurante que te _[blank 3]_ es de dos tenedores. ¿_[blank 4]_ este plato típico de México? Empareja los espacios en blanco con los verbos correctos.

options:
Habéis recorrido
ha estado
he recomendado
han divertido
Has probado
ha sido

Answers

Answer 1
Blank 1 : ha sido
Blank 2: Han divertido
Blank 3: he recomendado
Blank4: has probado

Related Questions

Reescribe la siguiente historia como si tu mejor amigo fuera el protagonista recuerda cambiar los determinantes y los verbos según corresponda cuando entré a mi habitación había un gran caos la cama está desorganizada la almohada en el suelo y la alcancía rota todos mis ahorros están esparcidos allí mismo estado responsable Rufo mi perro yo lo miré muy enfadado y él me pidió perdón con sus ojos tristes

Answers

Answer:

Cuando entre a mi habitación encontré un gran caos. La cama estaba deshecha, la almohada estaba en el suelo y la alcancía estaba rota. Todos mis ahorros estaban esparcidos. Allí estaba el responsable, mi perro Rufo. Lo mire enfadado y él, con sus ojos tristes, me pidió perdón.

Explanation:

introducción de el lenguaje no verbal de el arte me ayudan porfis​

Answers

can refer to communication through touch or smell

Answer:

Es el lenguaje corporal, la expresión facial, los movimientos del cuerpo, la mirada y también la ropa y objetos. Cualquier cosa con las que nos comuniquemos que no sea hablar.

Explanation:

Question 16 Multiple Choice Worth 2 points)
(01.02 MC)
Read and choose the option that best completes the sentence.
Es mi cumpleaños y tengo la fiesta en la casa de mi amiga Celeste. Me maquillo y
la cara en el espejo antes de ir a la fiesta por la noche.
me afeito
Ome miro
me duermo
O me pongo

Answers

Me afeito :Because that’s the answer

The answer is me afeito

his oratory (worked up/worked out) the feelings of the crowd...

worked up or worked out​

Answers

Answer:

I think, answer is this,

his oratory worked out the feeling of this croud.

Explanation:

Hope it helps you..

Thanks...

HELP ASAP Assignment 2: Reflexive verb sentences: Create 10 Sentences using REFLEXIVE verbs. Each sentence should include: 2 details (why, with whom, where, when, how often, etc..) An image that represents the reflexive verb.

Answers

Answer:

1. Andrea y Luis se despiertan a las siete de la mañana todos los día. (image abt waking up)

2. Marcela se peina para tener su cabello suave. (Image abt brushing hair)

3.  Nosotros debemos vestir con uniforme en la escuela. (Image abt dressing up with uniform)

4. Ricardo llamó a su hermano para saludarlo. (Image abt calling someone on the phone)

5. Ella se maquilla cuando se va de fiesta. (Image abt putting on make up)

6. Yo me ducho en el baño de arriba. (Image abt showering)

7. Teresa va a quedarse en casa el fin se semana. (Image abt staying at home)

8. Diego se lava las manos después de comer. (Image abt washing hands)

9. A mi mamá le gusta acostarse temprano para dormir mejor. (Image abt going to sleep)

10. Karen se seca el cabello antes de salir. (Image abt hair dryer)

Explanation:

Which season takes place during the following months?
FERRER
septiembre, octubre, noviembre
el verano
b. el invierno
C.
la primavera
d. el otoño
Please select the best answer from the choices provided
A​

Answers

Hey There!!~

I think the right answer is C). La primavera....

Good Luck!!~

By Itsbrazts.

Answer:

d. el otoño

Explanation:

Durante los meses: During the months:

septiembre: september

octubre: october

noviembre: november

la estación es:  the season is:

d. el otoño: qutumn

escribir 10 palabras con tilde y sin tilde

Answers

Answer:

Con tilde:

Méxicomédicoteléfonosalónárbolnúmeroescribiócírculoángulocafélíneagarantía

Sin tilde:

seguroestadoclienteEspañacincoculturapasadopresentefuturopresidenteunidosluna

Con tilde:

Sartén EsdrújulaSalón Césped CaníbalSillón Agonía Alegría Ilusión Carácter

Sin tilde:

Pareja Agua Vaso TendederoCepillo Tierra Ojo Resumen España Tomate

A una palabra se le pide tilde cuando se clasifique entre sobresdrújulas, esdrújulas, llanas y agudas, aunque también existe la tilde dicrítica para distinguir palabras, ejemplo:

: Bebida.Te: Pronombre persona de la segunda persona en singular.

MissSpanish

PLS HELP UNSCRAMBLE THE WORDS IN SPANISH

Answers

Answer:

1. Hidrográfica

2. Aluvial

3. Lagos

4. Ultravioleta

5. Agua

6. Bosque

7. Desinfecta

8. Contaminan

9. Filtraciones

10. Valle

Explanation:

You have a friend who wants to be an actor. Using verbs of influence and the subjunctive, give your friend three recommendations. For example, you might say, 'I recommend that you live in New York.' Use a different verb of influence in each sentence.

Answers

Explanation:

Remember, the verb of influence are words that express influence over actions that a subject would or would not like another person to do, although he cannot enforce doing the action.

Words underlined are verb of influence examples;

I want you to meetup with less poplar actors first.

Endeavor to desire gradual success.

I require your total commitment here.

lee el poema de gustavo adolfo becquer y haz los ejercicios en tu cuaderno

Answers

Answer: Read the poem by gustavo adolfo becquer and do the exercises in your notebook

Explanation: I do not know you question but i taslated it of you in english

how do humans interact with their environment​

Answers

Answer:

Humans try to modify the environment (positively or negatively), such as cutting forests, building dams, and extending urban areas.

The way humans adapt to the environment to meet their needs.

The way humans depend on the environment for food, timber, water, and other resources.

Answer:

Humans impact the physical environment in many ways: overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water.

Explanation:

Read and select the best answer to complete the dialogue.

–Buenas noches, yo soy Sr. García. ¿Cuál es su nombre, señor?
–Mi nombre es Sr. López. 1. ________.
–Igualmente.
–2. ________.
–Adiós. (1 point)
1. Muy mal 2. Buenos días
1. Mucho gusto 2. Hasta luego
1. Estoy bien 2. Soy de España
1. Más o menos 2. Es de Perú

Answers

Answer:

1. Mucho gusto 2. Hasta luego

Explanation:

1 . much gusto


2 . hasta luego

According to the agency that Jake and Summer work for, what will be stolen within four days?
a cat
a work of art
a map
a backpack

Answers

Answer:

It's "A work of art"

Explanation:

According to the agency that Jake and Summer work for, what will be stolen within four days is: a work of art.

Jake and summer

Both Jake and summer are both detective as they work for a  detective agency.

What will be stolen within four days is a work of art as they were told that the work of art will be disappearing.

Therefore the correct option is B.

Learn more about Jake and summer here:https://brainly.com/question/26351992

#SPJ2

Hola. Mi nombre es Paula y yo vivo con dos de mis amigas. Trabajo en un restaurante. Mi mejor amiga es Eleodora y ella trabaja en la oficina al lado del restaurante. Nosotras estudiamos en la universidad que está en esta ciudad. Marisol es mi otra amiga y ella cuida enfermos en un hospital. ¿Qué hace Eleodora?

Answers

Answer:

Trabaja en la oficina al lado del restaurante y estudia en la universidad.

Explanation:

Answer:

Eleadora, a decir de Paula:

Trabaja en la oficina al lado del restauranteEstudia, junto con Paula, en la universidad que se encuentra en esa Ciudad.

Read the incomplete sentence. Choose the option with the correct word or phrase that completes the sentence.
Huipiles are ________.
ordinary
one-of-a-kind
only made of heavy material
only made of light material

Answers

Answer:

the answer would be one-of-a-kind

Explanation:

Answer:

One of a kind

Explanation:

i took the test hope this helps

Write a short dialogue–both sides of the conversation–in Spanish between you and your adult neighbor in complete sentences. Use the vocabulary from this lesson and the following suggestions as a guide for your answer:

You may copy and paste the accented and special characters from this list if needed: á, Á, É, é, Í, í, Ó, ó, Ú, ú, ü, Ñ, ñ, ¡, ¿

*Note: The sample sentences/questions in parentheses are just a guide to help you form your sentences/questions. You must come up with your own original answers keeping academic integrity intact.


Greet your neighbor and ask him/her when his/her birthday is. (e.g., Good morning, Mrs. ____ When is your birthday?)
Have your neighbor reply in one sentence. (e.g., My birthday is May 3rd.)
Let your neighbor know when your birthday is. (e.g., My birthday is November 10th.)
Give a farewell. (e.g., Thanks and good bye.)

Hints:

Remember to use the formal format when talking to an adult, or a person whom you just met or do not know very well yet.

Answers

Answer:

Hello, below is a short dialogue between both sides regarding the prompt from your post.

uno de los ángulos interiores de un triangulo mide 100 grados y la diferencia de los otros 2 es de 25 grados ¿Cuánto mide el Angulo menor?

Answers

Answer:

el ángulo menor es 27.5 grados

Explanation:

Todo de los trianglos necesita 180 grados.

Usted tiene un ángulo con 100 grados, y los otros tiene una diferencia de 25 grados. Nombra un ángulo 'x' y el otro 'y'

Usted tiene eso:  100 grados y  [tex]y-x=25[/tex] (1)

Necesita la ecuación.

añade 'x' al otro lado del ecuación.[tex]y=x+25[/tex] (2)

Porque un triangulo necesita 180 grados, puede usar eso. [tex]180-100=80[/tex] (3)

Los dos angulos igual 80 grados en total. [tex]80=y+x[/tex] (4)

Sustituye ecuación numero (2) en ecuación numero (4). [tex]80=25+x+x[/tex] or [tex]80=25+2x[/tex]

Sustrae 25, y ahorra tiene [tex]55=2x[/tex] dividir por 2 [tex]27.5 = x[/tex] and sustituye 'x' en la cuarta ecuación [tex]y=52.5[/tex].  El ángulo menor mide 27.5

Lo siento para los errores hablo solo un poco de español

1. Sr. Ruiz / _______________ compra ropa. 2. Mi amigo, Miguel, y yo / _________________ bebemos agua.
3. Alicia y Teresa / _____________ llevan pantalones cortos. 4. Sandra / __________________ come arroz.

Answers

Answers:

1. Sr. Ruiz / Él compra ropa.

Translation:

- Mr. Ruiz / He buys clothes.

2. Mi amigo, Miguel, y yo / Nosotros bebemos agua.

Translation:

- My friend, Miguel, and I / We drink water.

3. Alicia y Teresa / Ellas llevan pantalones cortos.

Translation:

- Alicia and Teresa / They are wearing shorts.

4. Sandra / Ella come arroz.

Translation:

- Sandra / She eats rice.

-AntoLuzu

3 personajes a nivel mundial que sean referentes al valor de honestidad. Y porqué

Answers

Answer:

Explanation:

Jesús el Cristo, nos enseño la primera regla de la vida, el saber obedecer, la humildad, el amor al prójimo y el amor a DIOS.

José Mujica, el presidente "más pobre del mundo", ejemplo para muchos mandatarios que han hecho del poder y el dinero su negocio, el tuvo un solo mandato, se fue sin llevarse nada entre la manos, su sueldo de presidente lo dono a las causas sociales.

Nelson Mandela, El ex presidente sudafricano y Premio Nobel de la Paz, dedicó 67 años de su vida a la lucha por la igualdad racial y el fin del régimen segregacionista del apartheid, impuesto por la minoría blanca

1. a number b divided by thirty-six​

Answers

Answer:

[tex]\frac{b}{36}[/tex]

Explanation:

Read and choose the option that answers the question.

Hola! Me llamo Raúl. Primero, me visto a las seis y media de la mañana para ir a la escuela. Segundo, me peino el pelo con el cepillo. Me pongo la colonia como el tercer paso. Finalmente, me preparo el desayuno.

Which of the following steps is completed first?
Me preparo la cabeza.
Me limpio el cuerpo.
Me como.
Me pongo ropa.

Answers

Answer:

D

Explanation:

Me pongo ropa.

Answer:

me pongo ropa "D" is the correct answer

Explanation:

Fill in the blanks of these sentences with the appropriate indirect object pronoun (me, te, le, nos, os, or les).

1. (A mi) No gusta esta música.
2. (A nosotros) encanta ir a los restaurantes españoles.
3. (A ti) fascina el arte de Picasso?
4. (A ellos) interesa viajar a Sudamérica.
5. (A Uds.) importan las noticias aquí.
6. (A ella) interesan los libros que tratan de perú

Answers

1.me
2.nos
3.te
4.le
5.les
6.le

Answer:

1. Me gusta esta música.

2. Nos encanta ir a los restaurantes españoles.

3. Te fascina el arte de Picasso?

4. Les interesa viajar a Sudamérica.

5. Les importan las noticias aquí.

6. Le interesan los libros que tratan de Perú.

Explanation:

¿Considera Usted que las condiciones de vulnerabilidad ante un Tsunami son las mismas para todas las poblaciones? Justifique su respuesta con tres argumentaciones.

Answers

Answer:

noe  entnieot

Explanation:

Conjuga 3 verbos en el presente y 3 en el pretérito con acentos.

Answers

Answer:

Yo  Como-Comí

Yo Duermo-Dormi

Yo Uso-Use

Explanation:

Answer:

Presente:

Yo como, tú comes, él come, nosotros comemos, vosotros coméis o ustedes comen, ellos comen.

Yo juego, tú juegas , él juega, nosotros jugamos, vosotros jugáis o ustedes juegan, ellos juegan

Yo voy, tú vas, él va, nosotros vamos, vosotros vais o ustedes van, ellos van

Pretérito:

Yo leí, tú leísteis, él leyó, nosotros leímos, vosotros leísteis o ustedes leyeron, ellos leyeron.

Yo estudié, tú estudiasteis, él estudió, nosotros estudiamos, ustedes estudiaron o vosotros estudiasteis, ellos estudiaron.

Yo hablé, hablasteis, habló, hablamos, ustedes hablaron o vosotros hablasteis, ellos hablaron.

Explanation:

¿Cual va _____ el platillo principal? soy estar ser estoy

Answers

Answer:

ser

Explanation:

ser is used for more permanent disruption. estar is used for temporary like a place or action.

escrisbe dos ejemplos de manifiesto personal

Answers

Answer:

1. Creo que cada persona es única y original. Distinta del resto, pero igual de valiosa.

2. Mi propósito es ayudar a otros a librarse de miedos y prejuicios que les impiden lograr sus sueños.

Explanation:

Espero haber ayudado!

Answer:

1. Creo que cada persona es única y original. Distinta del resto, pero igual de valiosa.

2. Mi propósito es ayudar a otros a librarse de miedos y prejuicios que les impiden lograr sus sueños.

Explanation:

Escoge la opción correcta.
El Día de los Muertos es una celebración donde la gente se divierte con cosas inusuales en una fiesta, como por
ejemplo _____

Answers

Explanation:

OFRENDAS

Answer:

Asistir a las tumbas y:

convivir con la persona muerta poner una ofrendapernoctar en el lugarllevarle serenata a la persona muerta

Alguien me puede ayudar con el resumen del libro RESUELVE EL MISTERIO?
porfavor

Answers

Alguien quiere hacerse con el tesoro escondido de una excéntica millonaria. Pero la búsqueda del culpable se ve complicada por todo tipo de acertijos, enigmas, oscuros secretos y un montón de decisiones imposibles. Por si fuese poco, Carlos es el encargado de investigar lo ocurrido y no ha resuelto un misterio en su vida, así que va a necesitar tu ayuda para resolver su primer caso. ¿Podrás ayudarle a él y a sus amigos a descubrir al culpable, encontrar el tesoro y salvar la agencia de detectives de su madre? Tú decides a qué sospechosos interrogar, qué preguntas hacer y qu´epistas seguir.

. Con cual obra de misericordia te idéntificas

Answers

Answer:

need more info

Explanation:

Con el milagro de Fátima

what is used to writehistorto 230 years​

Answers

Answer:

Historians use manuscripts, carvings, pillars, other types of utensils and jwellerys. They examine the archeological sites the soil etc, to find the specific ages of them. They also used preserved documents to write it.

please click thanks and mark brainliest if you like :)

Other Questions
An intergalactic rock star bangs his drum every 1.30 s. A person on earth measures that the time between beats is 2.50 s. How fast is the rock star moving relative to the earth 34% of working mothers do not have enough money to cover their health insurance deductibles. You randomly select six working mothers and ask them whether they have enough money to cover their health insurance deductibles. The random variable represents the number of working mothers who do not have enough money to cover their health insurance deductibles. Required:Construct a binomial distribution using n= 0.6 and p=0.34 Given that T{X: 2 Help me with this question for 10 points please A piece of equipment (Asset class 15.0) was purchased by the Jones Construction Company. The cost basis was $300,000. Determine the ADS and GDS depreciation deduction for this property each year Green Inc. made no adjusting entry for accrued and unpaid employee wages of $38,000 on December 31. This error would Multiple Choice Understate assets by $38,000. Overstate net income by $38,000. Understate net income by $38,000. Have no effect on net income. PLEASE HELP ASAP T^T How did Louisiana's political boundaries change since it's founding the French in 1682 How much heat is required to convert 5.0 kg of ice from a temperature of - 20 0C to water at a temperature of 205 0F In a recent survey of drinking laws, a random sample of 1000 women showed that 65% were in favor of increasing the legal drinking age. In a random sample of 1000 men, 60% favored increasing the legal drinking age. Test the claim that the percentage of men and women favoring a higher legal drinking age is different at (alpha 0.05). Which, if any, pair of sides are parallel? AB II DC and AD II BC Cannot be determined AB II DC only AD II BC only Restriction digest A:ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCCHow many bases are in the second fragment? Each employee in a company is either right-handed or left-handed.32 of the 54 employees are female.18 of the 41 right-handed employees are male.Complete the frequency tree for this information.right-handedfemaleleft-handed54000right-handedmaleleft-handedTotal marks: 3 A metal blade of length L = 300 cm spins at a constant rate of 17 rad/s about an axis that is perpendicular to the blade and through its center. A uniform magnetic field B = 4.0 mT is perpendicular to the plane of rotation. What is the magnitude of the potential difference (in V) between the center of the blade and either of its ends? help with this thanks He is playing football into past continuous What do you predict the chemical formula for the compound formed between calcium and sulfur? You go on a trip to the Galapagos island to study the animals there for a paper you are writing on evolution, just like Darwin did. You spend 3 days taking notes on all the physical characteristics you can observe about the tortoises and then you spend 3 days observing the finches. What have you recorded? A. Inherited characteristics B. Environmental variation factors C. Phenotypes D. Genotypes The total number of cupcakes soldduring 5 days was 2087. The number of cupcakes sold by the shop on Thursday was 3 times the cupcakes sold on Monday. How many cupcakes were sold on Thursday? What was the first military action the Confederacy took?A. Capturing Fort Sumter from the Union armyB. Sending troops to capture Washington, D.C.C. Declaring martial law in BaltimoreD. Sinking Union naval vessels in Virginia