Should we include viruses in the domains of life ? Why ?

Answers

Answer 1

Answer:

Today, there is no solid evidence for the existence of a viral domain of life or for a significant implication of viruses in the origin of the cellular domains.

Explanation:


Related Questions

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG

Answers

Answer:

a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA

Explanation:

The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20  nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:

Schematically:

The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:

5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'

The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:

3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'

Which is NOT a function of magnesium in the body?
znutritio acting as a cofactor for enzyme systems in the Irody
regulating bone and mineral status
protecting teeth from acid-forming bacteria
making up one component in bone mineral​

Answers

Answer: I think it is the third one which states, "Protecting teeth from acid-forming bacteria".

Explanation:

Formula, name, and Group number of element needed for:     (i) hypothyroidism -     (ii) hypertension     (iii) kidneys     (iv) bones

Answers

Answer:

I) Hypothyroidism involves the insufficient production of thyroid in the thyroid gland which helps in the development of individuals. The element Iodine enhances the production of the thyroid.

I2- Iodine - Group number 17

Hypertension - Too much Salt which contains sodium in foods causes hypertension.

Na- Sodium- Group number 1

Bones require Calcium for its proper development and also helps to strengthen it.

Calcium - Ca- Group number 2

Kidney - Excess sodium in kidneys could result to kidney diseases which is why plenty of water should be taken to help the kidney from this element.

Na- Sodium- Group number 1

What part of the brain is known as the pleasure center?

A. Brain stem

B. Hypothalamus

C. Thalamus

D. Midbrain

SUBMIT

Answers

Answer:

B. Hypothalamus

Explanation:

The hypothalamus contains the pleasure center of the brain, the nucleus accumbens. The hormone dopamine is released from this part of the brain in response to or anticipation of pleasurable activities such as eating good food, monetary rewards as well as when taking psychoactive drugs.

The release of dopamine affects other feelings such as happiness, focus, being alert as well as staying motivated. it also affect some voluntary actions as well.

Constantly seeking out activities that stimulate dopamine release may lead to addiction to such activities as in drug addiction.

what is the key to the recognition of a trait whose expression is determined by the effects of two or more genes

Answers

Answer:

Explanation:

Polygenic inheritance occurs when many loci of a gene contributes to it genetic make up.

No particular allele can be selected for contributing to a particular traits all the allele are equally expressed.

Over expressitivity example is pleiotrophy effect have more than 5 fingers or toes

The offspring express more dominant traits that the normal mendelian principle

This signs indicate polygenic inheritance.

what is economic importance of honey bee​

Answers

Answer:

1. They are one of the most important pollinators for both wild and domestic plants.

2. Their most important product, honey, is used in baking, meals, and drinks. It is also used for shooting sore throat and suppressing the urge to cough. It also reduces the ravages of the aging process and it is an antioxidant that may help in the prevention of cancers. It is a mild salve for treating skin conditions and abrasions.

3. Propolis, a material made when bees mix resin with honey, is used to treat minor wounds and abscesses.

4. Bee pollen which are pollen balls are excellent source of amino acids and vitamins for humans.

5. Royal jelly, which is a milky secretion secreted by worker honey bees is used for asthma, hay fever, pancreatitis, insomnia, premenstrual syndrome, and other diseases.

Which scientist was responsible for coining the phrase "Big Bang"? *
O Fred Hoyle
O Albert Einstein
O Sir Isaac Newton
O Edwin Hubble

Answers

Answer:

Fred Hoyle

Explanation:

Sir Fred Hoyle FRS was an English astronomer who formulated the theory of stellar nucleosynthesis. He also held controversial stances on other scientific matters—in particular his rejection of the "Big Bang" theory, a term coined by him on BBC radio, and his promotion of panspermia as the origin of life on Earth

The scientist that was responsible for coining the phrase “Big Bang” was
a) Fred Hoyle

explain why germinating seeds were used in this investigation cellualr respiration

Answers

Explanation:

As oxygen is consumed to provide energy, germinating seeds release carbon dioxide. ... HYPOTHESES: The experimental hypothesis is that germinating seeds will show a greater rate of respiration than control glass beads. Additionally, that at higher temperatures, the rate of cellular respiration in the seeds will increase.

what is a radical a group of ions

Answers

Answer:

A radical is a group of atoms of elements carrying a charge. radicals or ions are formed by gaining or loosing ions. positive radical ions are called radical cations whereas negative radical ions are called radical  anions.

hope this helps you u :)      

The diagram shows a phase of mitosis. A phase of mitosis is shown. The chromosomes lined up at the center. Letter A represents long strings inside of the cell. Which does the letter A represent in the diagram?

Answers

I wish you added the diagram but I can tell that the long strings are the spindle fibres.

Answer:

the long string things are the fiber spindle thing

( sorry i'm not good at reading passages and citing from them... )

if a wild game animal is slaughtered under usda guidelines can it be prepared and served A:No. A wild game animal can never be served B:Yes a wild game animal can be served C:No wild game animals cannot be eated D:Maybe if you seek usda permission

Answers

Answer: C:) No wild game animals cannot be eated

Explanation: hope that helps (:

which climate does sparrow live hot or cold

Answers

Answer:

Hot ok please give me brilliance

Explanation:

please

Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin. What kind of a cell is this?

Answers

Answer:

An animal cell in the telophase

Explanation:

Telophase is one of the stages of cell division in animal cell .

In the animal cell during telophase, Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin because the nuclear membrane and nucleoli reform, cytokinesis is almost coming to completion and the chromosomes eventually uncoil to chromatin. Usually cytokinesis occurs during telophase.

a body may have zero velocity even though its speed is 10m/s. give reason.​

Answers

Explanation:

because speed is time rate at which an object is moving along a bath, while velocity is the rate and direction of object's movement .

You have been assigned a DNA stretch. What is the complementary strand when you replicate the template

Answers

Answer:

The complementary strands of a DNA are read in the opposite direction to one another

Explanation:

A DNA strand/stretch can be represented with a number of bases. The bases in a DNA strand are Adenine (A), Thymine (T), Cytosine (C) and Guanine (G). The Adenine can bind to Thymine (and vice-versa) while the Guanine can bind to Cytosine (and vice versa). These bonded bases are called "base pairs".

Complementary DNA strands are read in opposite direction to one another. Each end of a DNA strand is either a 5' end or a 3' end. Hence, if one strand runs from the 5' to 3' end, the complementary strand will run from the 3' to 5'. Thus, they are represented "on paper" the way they run.

For example,

If the DNA strand assigned is AGTCTAG running 5' to 3', the complementary strand will be CTAGACT (starting from the 3' end) and NOT TCAGATC (which starts from the 5' end)

b) How will you describe any three (3) major components of the environment to a named
class puyil?​

Answers

Answer:

Hydrosphere, atmosphere and biosphere are the three major components of the environment.

Explanation:

Hydrosphere, atmosphere and biosphere are the three major components of the environment. hydrosphere refers to water bodies such as ocean, sea, ponds and lakes etc that is present in our environment. atmosphere refers to the gaseous layer which is present above the earth surface. in this layer oxygen, nitrogen and carbondioxide etc are present. biosphere refers to all living organisms such as human, animals, plants and microbes etc which are present on earth surface..

Vị trí các cacbon trong cấu trúc của đường đềôxyribô trong 1 nuclêôtit được thêm dấu phẩy vì:

Answers

Answer:

hi please answer my questions.

explain what perlemoen are?​

Answers

Answer:

Also known as "abalone" which is a

Explanation:

Answer:

any of various edible marine gastropod mollusks of the genus Haliotis

Explanation:

hope this helps

Butterflies can produce hundreds of offspring per cross. In a certain variety of butterflies, a maternally-imprintable gene is responsible for wing phenotype. Two possible alleles for this gene are w for normal wings and wc for crinkled wings. Which of the following pieces of information would be helpful in predicting the wing phenotype of a male offspring from a cross?

a. look at the father's phenotype
b. know the mother's genotype
c. look at the mother's phenotype
d. know the father's genotype

Answers

Answer: d. know the father's genotype

Explanation: Butterflies can produce hundreds of offspring per cross. In a certain variety of butterflies, a maternally-imprintable gene is responsible for wing phenotype.

The option that would be helpful in predicting the wing phenotype of a male offspring from such a cross would be to look at the father's phenotype.

Imprinted genes can simply be defined as genes that are expressed in parent-of-origin specific manner and result from a chemical modification of DNAs.  Such genes are differentially expressed depending on which of the two parents they are inherited from. Hence:

maternally-imprintable genes are only expressed when they are inherited from the father. paternally-imprintable genes are only expressed when inherited from the mother.

Phenotype refers to the physical appearance or expression of a gene. Therefore, if a gene is maternally imprintable, looking at the phenotype of the father would be helpful in predicting the phenotype of the male child in case a cross happens.

Applying the same principle to the butterfly, it will, therefore, be helpful to look at the father's phenotype in order to predict the wing phenotype of a male offspring from a cross.

The correct option is A.

More about imprinted genes can be found here: https://brainly.com/question/7207412

Which of the following small GTPases are NOT involved in vesicle budding or docking? A. ARF B. Rab1 C. Ras D. Sar1p

Answers

Answer:

option c is correct that is Ras

Explanation:

In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.
1. The phenotype of the heterozygous plant is_________.
2. The genotype of the heterozygous plant is_________.
3. The genotype of the plant with yellow pods is________.
4. The genotypes of gametes produced by a heterozigous plant is______.
5. The genotypes of gametes produced by a yellow plant is_______.
A. Green pods
B. 75% AA and 25% Aa
C. AA
D. 100% A
E. Yellow pods
F. 50%
G. 25%
H. 100% a
I. 50% A and 50% a
J. Aa
K. 0%
L. 75%
M. 75% A and 25% a

Answers

Answer:

1. Green

2. Aa

3. aa

4. A and a

5. a and a

Explanation:

1. The phenotype of the heterozygous plant (Aa) would be green since the allele responsible for green color (A) is dominant over the allele responsible for yellow color (a).

2. The genotype of a heterozygous plant would be Aa. Heterozygous individuals have different alleles for the same gene.

3. The genotype of the plant with a yellow pod would be aa. Since the allele for green color (A) is dominant over the allele for yellow color (a), the yellow color can be expressed only in the absence of the (A) allele. Hence, the genotype fo yellow color has to be aa.

4. The genotypes of gametes produced by a heterozygous plant would be (A) and (a) because heterozygous individuals have two different alleles for a gene.

5. The genotypes of gametes produced by a yellow plant would be (a) and (a) because a yellow plant has the genotype (aa).

Help anyone please????!

Answers

1. Wavelength
2. Compression
3. Rarefractiom
Please mark brainliest

Saprobic microorganisms are important decomposers of plant litter, animal matter, and dead microbes. This is an example of a(n) ______________.

Answers

Answer:

The correct answer would be - heterotrophs (chemoheterotrophs)

Explanation:

Heterotrophs are the living organisms that are directly or indirectly depend on the autotrophs or the organisms that can make their own food for energy and growth.

Saprobic microorganism are free living organisms that get their energy from decomposing rotten or dead organic matter such as plant litter, animal matter and dead microbes. It is performed with the help of enzymes or chemicals they release to decompose such matter. they also known as chemoheterotrophs.

Thus, the correct answer would be - heterotrophs (chemoheterotrophs).

define factors affecting enzyme action:temperature

Answers

Answer:

I am secondary level student and this doesn't belongs to my coure till yet however..i have written this through google.....you may search there as well..

Explanation:

Enzyme activity occurs within a narrow range of temperatures compared to ordinary chemical reactions. As you have seen, each enzyme has a certain temperature at which it is more active. This point is called the optimal temperature, which ranges between 37 to 40C°...

Temperature. As temperature increases to the optimum , the kinetic energy of the enzyme and substrate increases, causing more collisions between the enzyme and substrate.

If a cell membrane were completely permeable to all substances, could the cell continue to live? Explain your answer in depth.

Answers

If the membrane were fully permeable to all substances, then anything could enter the cell. This would upset the balance between the cell's contents and the outside environment. There is only so much ability to store substances and utilize substances, therefore, the cell would not be able to maintain homeostasis.

What is the process of
evaporation?

A. The process in which plants release vapor into
the atmosphere

B. Any process that returns water from the
atmosphere to the earth

C. The process in which liquid water turns to
water vapor

Answers

The answer to your question is C

Describe how scent and taste work in conjunction. Are the tastes of below mention foods that were tested heightened by the sense of smell, or only some of the foods?

a. Salt
b. Sugar
c. Lemon Juice
d. Coffe grounds

Answers

Answer:

Scent and Taste work in conjunction because when your brain smells food, it pulls up a picture or memory of that food in your head, and you remember what it tasted like and if you enjoyed it.

Only some of the food. Salt does not really have a smell, so it does not do anything, but all the others do and are heightened

Explanation:

Take cotton candy for example. When you smell cotton candy, you smell SUGAR and lots of it. You know that sugar tastes good and as such you now want to eat the cotton candy.

For this example, we will use lemonade. Lemonade is commonly a drink that most love on a hot summer day at the beach. When you smell the lemonade, it reminds your brain of how good it tasted and pulls up the memory at the back of your mind,  making you feel happy and relaxed. It then ends up tasting better

(This is my first answer, it won't be perfect)

Smell and taste go hand in hand because when you smell food, your brain conjures up an image or recollection of that food in your head, allowing you to recall how it tasted and if you liked it.

What is Conjuction?

Since salt doesn't truly have a fragrance, it has no effect; nevertheless, all the others do and their intensity is increased.

You can definitely smell a lot of sugar when you smell cotton candy. You want to eat the cotton candy because you are aware that sugar tastes delicious.

On a hot summer day at the beach, most people enjoy drinking lemonade.

Therefore, Smell and taste go hand in hand because when you smell food, your brain conjures up an image or recollection of that food in your head, allowing you to recall how it tasted and if you liked it.

To learn more about conjuction, refer to the link:

https://brainly.com/question/25713213

#SPJ2

ASAP When ______ is hydrolyzed, it forms _______. A. protein, amino acids B. ATP, ADP C. polysaccharide, monosaccharide D. lipid, triglyceride

Answers

Answer:

The answer is ATP, ADP

Explanation:

When protein is hydrolyzed, it forms amino acids. Thus, the correct option is A.

What is Hydrolysis?

Hydrolysis may be defined as a chemical process that utilizes the molecules of water that involve the chemical breakdown of a compound.

Amino acids are the monomers of protein. These amino acids are linked together by peptide bonds. But the process of hydrolysis breaks the peptide bond between the amino acid sequences and released them significantly in free form.

Therefore, when protein is hydrolyzed, it forms amino acids. Thus, the correct option is A.

To learn more about Hydrolysis, refer to the link:

https://brainly.com/question/4352413

#SPJ5

Which part of the cell functions to recognize other cells? (1 point)
O nucleus
O cytoplasm
O cell wall
O plasma membrane

Answers

Answer:

cell wall maybe it may be wrong also

Plasma membrane of the cell functions to recognize other cells. Thus option D is correct.

What is Plasma membrane?

The plasma membrane which is an outer covering of cell present in both prokaryotic and eukaryotic cell.

It is a thin selectively semi-permeable membrane which enclose the cytoplasm along with other organelle.

Proteins and lipids are the major components of membrane, beside this carbohydrate are also present in cell membrane.  

The most common lipid in membrane is phospholipid, other lipids are glycolipid, sphingolipid.  

The function of cell membrane is to provide protection and maintain the integrity of the internal environment of the cell,

It act as a base of attachment for the cytoskeleton  for cell-cell communication.

It involve in transport of materials like nutrients, toxic substances.

Thus option D is correct.

Learn more about plasma membrane, here:

https://brainly.com/question/14727404

#SPJ2

use the numbers 12345 to place the protien creations steps below in the correct order

Answers

Use the numbers 1, 2, 3, 4, and 5 to place the protein creation steps below in the correct order. Ribosome attaches to the mRNA. Information is transcribed in DNA to mRNA. tRNA anticodon carries an amino acid that compliments the mRNA codon. mRNA leaves the nucleus. The chain of amino acids forms a protein.  

if it is helpfull please mark as brainlist

Answer:

please list numbers 12345 and then i will

Explanation:

Other Questions
Dave loves a bargain and buys a feather boa whichhas been reduced in price by 70%. If the sale priceis 2.85, what was the original price of the boa? What is the critical F value when the sample size for the numerator is seven and the sample size for the denominator is six What is a sand painting? A. a part of a Navajo healing ceremony B. a rawhide design C. a part of a potlatch ceremony D. a painting on a clay pot What is the range of possible sizes for side x?8.02.5 Please helpp!! 500kg, 42m, 675g, and 10m/s are all examples of what typed of data?b GIVING 100 POINT AND BRAINLIEST! :)This image shows a model of the rock cycle.At point R, rocks melt underground to form magma. Which is another process that contributes to the formation of rock at point R?compacting of sediments on the mountaincooling as the lava runs down the mountainweathering of the mountain from the environmenteroding of different rocks at the base of the mountain A city council consists of seven Democrats and six Republicans. If a committee of five people is selected, find the probability of selecting two Democrats and three Republicans. Fill in the blank with the Spanish word that best completes the following sentence.Los estudiantes tienen quetoda la escuela.llorarlimpiarpasarcontestar Please show ALL work!!!! Who was Hernando de Soto? (quick summary would be extremely helpful!) Use AABC shown below to answer the question that follows:Which of the following is a step towards proving the similarity of triangle so AABC and ADBA? (5 points)Segment BC is a hypotenuse.Angle B is congruent to itself.Segment BA is shorter than segment BC.Segment BC is intersected by segment AD. James defines a circle as "the set of all the points equidistant from a given point." His statement is not precise enoughbecause he should specify thatO a circle includes its diameterO the set of points is in a planeO a circle includes its radiusO the set of points are collinear [tex] {x}^{3} - {x}^{2} \div x[/tex] please answer the question Convert 4.206 m into mm help me please!! i am already failing the test simplify 2 root 3 multiply by root 7 Which of the following actions would cause the aggregate demand curve to shift to the left? A. an increase in government spending caused by increased spending on highways and bridge construction B. a decrease net export spending caused by an appreciation of the home currency C. an increase in exports caused by an increase in economic activity in the European Union D. an increase in consumer spending caused by a cut in the personal income tax rate The diameter of neutral atoms generally decreases going left to right across one period on the periodic table. What change causes this decrease in diameter of atoms? Which of the following best describes what would have to change totransform an authoritarian government into a theocracy?