Tapestry Corporation will spend $1 million for special production equipment. Shipping and installation charges will amount to $175,000 and an initial increase in net working capital of $50,000 will be required. The equipment will replace an existing machine that has a salvage value of $85,000 and a book value of $100,000. Executives expect revenue to increase by $200,000 per year with no increase in operating expenses. If Tapestry has a corporate tax rate of 21%, what is the amount of the initial outlay for this project?

Answers

Answer 1

Answer:

($1,136,850)

Explanation:

The computation of the initial outlay is shown below:

Purchase price (-1,000,000 - $175,000)    (1,175,000) (A)

machine proceeds

{$85,000 + ($100,000 - $85,000) × 0.21}   $88,150 (B)

Net working capital ($50,000) (C)

Initial outlay ($1,136,850)     (A - B + C)

Hence, the initial outlay is ($1,136,850)

We basically applied the above calculation to arrive at the answer


Related Questions

As an economy​ grows, A. the opportunity cost of production will approach 0. B. its PPF does not​ shift; instead, the production point moves from inside the PPF to be closer to the PPF. C. its PPF shifts outward. D. it can eliminate scarcity. E. the opportunity cost of production will increase.

Answers

Answer:

Option C, its PPF shifts outward, is the right answer.

Explanation:

Option “c” is correct because the growth in the economy shows two things. First, the output of the economy has increased during a particular period of time. Secondly, it shows that the potential of the economy has increased. This means its productivity to produce has increased. Therefore, in such cases, the PPF curve shifts rightwards and this rightwards shift in PPF shows the economic growth

importance of general vocational skill in successful business or institution ​

Answers

Explanation:

Vocational Skills education is important because its equips people with the practical skills necessary to begin or enhance a career.

For careers like Medical Assistant, Cosmetologist, and Auto Mechanic, vocational training is a way to get started down the pathway to a career. It takes less time than a traditional college, therefore it is a good choice for people who need to begin using these skills sooner.

In some other careers, like engineering and IT, high level technicians need specialized training. This is often done in addition to traditional education. This is where vocational training plays a role in the lives of those who may have already gone to a four year college.

Vocational training is a great way to change your career as well, as you do not have to commit to spending as much time as required by a traditional college to gain new skills.

TrainUp. com is a great resource to find career training classes for those looking to expand on their skills in the Human Resources, Information Technology, Business Management, Industrial, Finance, and Legal fields. Their training network includes more than 300,000 instructor-led training events and 7,000+ online courses!

Which of the following is NOT a factor to consider when examining extrinsic job satisfaction?
a. pay
b. coworkers
c. job tasks
d. supervisors

Answers

Answer:

The answer is C) Job tasks

Answer:

c

Explanation:

Suppose when a monopolist produces 50 units its average revenue is $8 per unit, its marginal revenue is $4 per unit, its marginal cost is $4 per unit, and its average total cost is $3 per unit. What can we conclude about this monopolist? a. The monopolist is currently maximizing profits, and its total profits are $200. b. The monopolist is currently maximizing profits, and its total profits are $250. c. The monopolist is not currently maximizing its profits; it should produce more units and charge a lower price to maximize profit. d. The monopolist is not currently maximizing its profits; it should produce fewer units and charger a higher price to maximize profit.

Answers

Answer:

b. The monopolist is currently maximizing profits, and its total profits are $250

Explanation:

The computation of monopolist is shown below:-

The monopolist is producing 50 units ate which are

MR = $4

Price = $8

MC = $4

ATC = $3

This applies that

MR = MC

while

P > ATC

So the monopolist is making a profit by making profit-maximizing quantity.

Total profits are (P - ATC) × Q

= (8 - 3) × 50

= $250

Hence, b option is correct

Antiperspirant deodorants were introduced to the market in 1941. The market for antiperspirant deodorants is currently characterized by slowing product class revenue, fierce price competition, and repeat purchase behavior. Antiperspirant deodorants are currently at the ________ stage of the product life cycle.

Answers

Answer:

Maturity

Explanation:

In this scenario, Antiperspirant deodorants were introduced to the market in 1941. The market for antiperspirant deodorants is currently characterized by slowing product class revenue, fierce price competition, and repeat purchase behavior. Antiperspirant deodorants are currently at the maturity stage of the product life cycle.

A product life cycle can be defined as the stages or phases that a particular product passes through, from the period it was introduced into the market to the period when it is eventually removed from the market.

Generally, there are four (4) stages in the product-life cycle;

1. Introduction.

2. Growth.

3. Maturity.

4. Decline.

Hence, maturity is the stage in which product experiences a peak in sales growth and then eventually slows as the product reaches more customers, and lastly price competition is fierce.

You need to have $30,250 in 17 in years. You can earn an annual interest rate of 4 percent for the first 5 years, 4.6 percent for the next 4 years, and 5.3 percent for the final 8 years. how much do you have to deposit today?

Answers

Answer:

The amount that has to be deposited today is $6205.63

Explanation:

The given parameters are;

The annual interest rate for the first 5 years = 4 percent

The annual interest rate for the next 4 years = 4.6 percent

The annual interest rate for the final 8 years = 5.3 percent

Let the amount deposited be X, we have;

X × (1 + 0.04)⁵ + X × (1 + 0.04)⁵×(1.046)⁴ + X × (1 + 0.04)⁵×(1.046)⁴ ×(1.053)⁸ = $30,250

X ((1.04)^5 + (1 + 0.04)^5×(1.046)^4 + (1 + 0.04)^5×(1.046)^4 ×(1.053)^8) = $30,250

X × 4.875 = $30,250

X = $30,250/$4.875 = $6205.63

The amount that has to be deposited today = $6205.63.

The HR department at Trevor Communications oversees the recruitment and training of employees at the firm.As the firm grows and recruits more employees,overseeing individual training programs has been come too much for HR staff to handle.Which of the following applications should the HR department use to help with employee training?A) A customer relationship management systemB) A management information systemC) A learning management systemD) A decision support systemE) An executive decision-making system

Answers

Answer:

C) A learning management system

Explanation:

Analyzing the above scenario, it is clear that the learning management system would be very useful to the HR department at Trevor Communications.

This system can be defined as a learning process that takes place in a virtual way, in an environment where each individual can access learning content in an interactive and dynamic way, by accessing a tool that contains the content and information necessary for specific learning.

This system confers several advantages to the organization, such as the elimination of personnel costs, greater ease of monitoring and follow-up, greater availability, ease of implementation and evaluation.

Chenrezic Music Stores, a chain of stores selling musical instruments, is trying to improve its customer service. While examining its checkout data, it learned that people who buy guitar covers also buy guitar straps and vice versa. In this scenario, the use of data mining to find better ways to improve customer service has also led to the discovery of a(n) .

Answers

Answer: Affinity pattern

Explanation:

Data mining is when patterns are being discovered in large data. From the question, we are informed that Chenrezic Music Stores, a chain of stores selling musical instruments, is trying to improve its customer service.

We are further told that while examining its checkout data, it learned that people who buy guitar covers also buy guitar straps and vice versa. In this

This shows that data mining has helped to find better ways to improve customer service has also led to the discovery of affinity pattern.

Health-Tech Materials is a firm that manufactures medical equipment purchased by hospitals and clinics. The firm employs over 2,500 workers in its two manufacturing facilities located in Texas and Arizona. Recently, Health-Tech dismissed a number of employees for ethics violations ranging from improper Internet usage to stealing company funds. In addition, the firm has been sued by two former employees for wrongful discharge. As a result, Health-Tech's top executives are evaluating the firm's hiring process, ethics training system, reward system, and disciplinary system to determine how to promote ethics and fair treatment.
Health-Tech's HR department has devised a brief ethics test for employees to use when determining if their actions match Health-Tech's code of conduct. Which of the following questions is LEAST likely to be included on the ethics test?
A) What Health-Tech employees will be affected by my actions?
B) Will my actions reflect negatively on the image of Health-Tech?
C) Would I perform this action if I worked for a Health-Tech competitor?
D) Is the action I am about to perform on behalf of Health-Tech a legal one?

Answers

Answer:

Correct Answer: The least likely question to be included in the ethic test is:

A) What Health-Tech employees will be affected by my actions?

Explanation:

This is because, it does not have a direct implication to the code of conduct expected by the Health-Tech's company when compared with others. For example, seeing a fraud going on in the company, it is expected that the staff should report to the appropriate management staff irrespective of whether the action would affect the staff's friend or not.

what are the benefits of traditional Technology​

Answers

Answer:

They dont cost like a thousand dollars.

Explanation:

Explanation:

They don't cost of thousand dollars.

Those who make dispositional attributions regarding poverty and unemployment tend to adopt political positions that:________

a. offer more direct support to the poor.
b. are unsympathetic to the poor.
c. tend to blame the poor for their problems.
d. are more neutral regarding poverty and unemployment.

Answers

Answer:

a. offer more direct support to the poor.

Explanation:

A disadvantage of couponing is…? radio_button_unchecked Low redemption rates. radio_button_unchecked Reduces consumer’s perceived risk associated with trial of a new brand. radio_button_unchecked Encourages repeat purchase. radio_button_unchecked Helps coax users to trade up to more expensive brands. SUBMIT

Answers

Answer:

Correct Answer:

1.  Low redemption rates.

Explanation:

Couponing is the situation whereby discount in form of Coupons are offered to customers over a specific product that is on sale. It is similar to product discount other than the fact that, the discount is based on the coupon card.

The disadvantage of offering coupons is that you would be giving a discount to people who would buy your products even without them anyway thereby leading to low redemption rate. This can be costly and also increases the risk of incurring losses.

Answer:

Low redemption rates.

Explanation:

Couponing is a kind of promotion used by businesses in giving discounts to their customers for products purchased. it is done using coupon cards.

Low redemption rate simply means the number of people that make use of the coupon card in purchases as a percentage of number of coupon cards distributed. The implications of low redemption rates as a disadvantage of couponing means lower sales for the business and this could consequently cause losses as this indicates that promotion was not effective. In other words, low sales using coupons increases cost to company lowering profit and maybe causing losses

Medical science is an important sector all over the globe ​

Answers

Answer:

Medical scientists also conduct research to find treatments to un-treatable conditions. Medical science matters because it is the foundation of a strong healthcare system. When medical science is well resourced, patients conditions are diagnosed quickly and correctly, leading to correct and efficient treatment.

Answer:

medical science is an important sector all over the globe . It is related to human life .it has various field with many profession ranging from basic level to a higher level various work like preparing and dispensing drugs taking of diagnosing and treating peoples body elements suggesting for preventive measures are related to taking care of human life . India for medical science and various professional professionals related to it are important for human life

An auditor's report includes the following statement: "The financial statements referred to above do not present fairly the financial position, results of operations, or cash flows in conformity with U.S. generally accepted accounting principles." This auditor's report was most likely issued in connection with financial statements that are

Answers

Answer:

The answer is misleading or not free from material misstatement

Explanation:

When a financial statement is misleading or not free from material misstatement, an auditor issued a qualified report. This qualified report tells the users of the financial statement that something is wrong.

Material misstatement refers to an error in the financial statement that if omitted, it will affect the decision of the users.

If a financial statement is free from error or material misstatement, an auditor will issue unqualified report.

Attestation standards apply when a CPA is engaged to issue a practitioner’s report on A preparation service. The subject matter of a compilation. An examination after performing agreed-upon procedures. A review of an assertion about subject matter that is the responsibility of another party.

Answers

Answer:

A review of an assertion about the subject matter that is the responsibility of another party

Explanation:

An attest engagement is defined as the independent review of a subject matter by a professional other than the auditor by conducting a specific procedure and he is expected to issue a report of his findings on the reliability of the subject matter.

The three stages of attestation services are compilation ,review and audit.

Attestation engagement is governed by the Statements on standard for  attestation engagement (SSAE)

"A customer in the 28% tax bracket has $4,000 of capital gains and $12,000 of capital losses. How much unused loss is carried forward to the next tax year?"

Answers

Answer:

$5,000

Explanation:

Given that:

A customer in the 28% tax bracket has $4,000 of capital gains and $12,000 of capital losses. How much unused loss is carried forward to the next tax year?

Capital gain = $4000

Capital loss = $12,000

Net loss = ( capital loss - capital gain)

Net loss = ($12,000 - $4,000)

Net loss = $8,000

Maximum net loss deductible from taxes In a year is $3000

Net loss - deductible

$8,000 - $3,000 = $5,000

Unused loss carried into the next year = $5,000

__________ is associated with a person who is crafty or understands right/wrong behavior but uses tricks to obtain an unfair advantage.

Answers

Answer:

Guile

Explanation:

Guile is associated with a person who is crafty or understands right/wrong behavior but uses tricks to obtain an unfair advantage.

For instance, you have an urgent appointment such as a meeting with a business partner but you chose to deceitfully distract him from the fact that you are already lagging behind schedule (time) by telling a joke or mind blowing story. This is typically an example of Guile.

The following information pertains to Cullumber Company.
1. Cash balance per books, August 31, $7,374.
2. Cash balance per bank, August 31, $7,338.
3. Outstanding checks, August 31, $690.
4. August bank service charge not recorded by the depositor $42.
5. Deposits in transit, August 31, $2,810.
In addition, $2,126 collected for Cullumber Company in August by the bank through electronic funds transfer. The accounts receivable collection has not been recorded Cullumber Company
Prepare a bank reconciliation at August 31, 2022. (List items that increase balance as per bank & books first.)

Answers

Answer:

                            Cullumber Company

                             Bank Reconciliation  

                                 August 31, 2022

Cash balance as per bank                             $7,338

Add: Deposit in transit                                    $2,810

                                                                        $10,148

Less: Outstanding checks                              $690  

Adjusted Cash Balance                                 $9,458

Cash balance per books                                $7,374

Add: Electronic fund transfer received         $2,126

by bank

                                                                        $9,500

Less: Bank service charges                             $42  

Adjusted Cash balance                                 $9,458

InSeason Inc. started a chain of organic supermarkets that had initial success. The managers achieved a mastery of the firm's current environment, thereby filling a need in the market. However, InSeason defined and measured it success by financial metrics, with a focus on short-term performance. As a result, the firm put in place metrics and systems to accommodate and manage increasing firm size due to continued success. As a result of this tightly coupled system, InSeason developed a

Answers

Answer: resistance to change

Explanation:

From the question, we are informed that InSeason Inc. started a chain of organic supermarkets that had initial success and that the managers achieved a mastery of the firm's current environment, thereby filling a need in the market.

We are further told that InSeason defined and measured it success by financial metrics, with a focus on short-term performance and that as a result, the firm put in place metrics and systems to accommodate and manage increasing firm size due to continued success.

As a result of this tightly coupled system, InSeason developed a resistance to change. Resistance to change could be as a result of fear of failure by the company.

The accounts in the ledger of Monroe Entertainment Co. are listed below. All accounts have normal balances. Accounts Payable $507 Fees Earned $3,138 Accounts Receivable 720 Insurance Expense 675 Prepaid Insurance 1,506 Land 2,220 Cash 1,948 Wages Expense 570 Dividends 508 Common Stock 4,502 Prepare a trial balance. The total of the debits is

Answers

Answer:

The debit balance of the trial balance is $8,147

Explanation:

                              Monroe Entertainment Co

                     DEBIT                                         CREDIT

   Particulars               Amount$      Particulars               Amount$

Account Receivables      720           Accounts Payable     507

Prepaid Insurance           1,506         Fee earned               3,138

Cash                                 1,948         Common stock         4,502

Dividends                         508  

Insurance Expenses         675

Land                                  2,220  

Wage Expenses               570

Total                                  $8,147        Total                         $8,147

Contrary to financial analysts, who predicted last year that the market for home computers would dwindle, the personal computer industry continued to show strong growth in the first quarter of this year.(a) analysts, who predicted(b) analysts, whose predictions(c) analysts and their predictions(d) analysts' predicting(e) analysts' predictions

Answers

Answer:

e) analysts' predictions

Explanation:

In contrast to the financial analyst, who estimated that in the last year the home computer market would be decline but at the same time the industry of the personal computer depicts the strong growth for the first quarter of the year

So here this given situation represents the estimation of the analyst and the same is to be considered

hence, the correct option is e.

Rio Tinto's incentive to adopt new robotic technology was increased by the high wages it was having to pay to attract miners and truck drivers. In this instance, Rio Tinto began using new robotic technology to

Answers

Answer:

Rio Tinto's incentive to adopt new robotic technology was increased by the high wages it was having to pay to attract miners and truck drivers.

In this instance, Rio Tinto began using new robotic technology to substitute capital for labor in production.

Explanation:

What payment method do you think is the most practical?
A. Pay with 15 year mortgage
B. Pay with cash
C. Pay with 30 year mortgage
D. Rent
E. All of the above can be practical depending on your situation

Answers

Answer:

E

Explanation:

All of the above can be practical depending on your situation

Answer:

E no is the answer of your question.....

Kimberly owns a cupcake shop in Newport Beach, California. The market for cupcakes is very competitive. At Kimberly’s current production level, her marginal cost is $31 and her marginal revenue is $27. To maximize profits, Kimberly should:

Answers

Answer:

Reduce production

Explanation:

Profit is maximised where marginal revenue equals marginal cost. Because marginal cost is greater than marginal revenue, Kimberly should reduce production unit the point where marginal cost equals $27.

Marginal cost is the increase in cost as a result of increasing production by one unit.

Marginal revenue is the increase in revenue as a result of selling one extra unit of a product.

John has an escalator clause in his labor contract by which his salary increases automatically by the amount of the previous year's inflation rate. If John's salary is $100,000, this year's consumer price index is 105, and the previous year's CPI was 100, by what percent will John's salary be increased?

Answers

Answer: 5%

Explanation:

From the question, we are informed that John has an escalator clause in his labor contract by which his salary has to be increased automatically by the amount of the previous year's inflation rate.

If John's salary is $100,000, this year's consumer price index is 105, and the previous year's CPI was 100, the percent by which John's salary be increased will be (105 - 100) = 5%.

Thomas Company has a sales budget for next month of $1,000,000. Cost of goods sold is expected to be 25 percent of sales. All goods are paid for in the month following purchase. The beginning inventory of merchandise is $50,000, and an ending inventory of $64,000 is desired. Beginning accounts payable is $160,000.
For Thomas Company, the ending accounts payable should be:
A. $341,000
B. $356,000
C. $314,000
D. $414,000

Answers

Answer:

$264,000

Explanation:

Calculation for the ending accounts payable

First step is to find the cost of goods sold

Using this formula

Cost of goods sold=Sales budget * Sales percentage

Let plug in the formula

Cost of goods sold=$1,000,000*25%

Cost of goods sold=250,000

Second step is to calculate for the ending accounts payable

Using this formula

Ending accounts payable=Ending inventory + Cost of goods sold - Beginning inventory

Let plug in the formula

Ending accounts payable= $64,000 + $250,000 - $50,000

Ending accounts payable= $264,000

Therefore the Ending accounts payable will be $264,000

According to an old myth, Native Americans sold the island of Manhattan about 400 years ago for $24. If they had invested this amount at an interest rate of 7 percent per year, how much, approximately, would they have today

Answers

Answer:

FV= $13,605,744,645,293.70  

Explanation:

Giving the following information:

Initial investment= $24

Number of years= 400

Interest rate= 7 percent compounded annually

To calculate the value of the investment today, we need to use the following formula:

FV= PV*(1+i)^n

FV= 24*(1.07^400)

FV= $13,605,744,645,293.70  

Answer:

They would have approximately $14 000 000 000 000.

Explanation:

From the compound interest formula,

Amount = P[tex](1 + \frac{r}{n}) ^{t}[/tex]

Given that: P = $24, R = 7%, t = 400 years,

Amount = 24[tex](1 + \frac{7}{100}) ^{400}[/tex]

 = 24[tex](\frac{107}{100}) ^{400}[/tex]

 = 1.360574465 × [tex]10^{13}[/tex]

The amount they would have is approximately $1.4 × [tex]10^{13}[/tex]

A company offers ID theft protection using leads obtained from client banks. Three employees work 40 hours a week on the leads, at a pay rate of $13 per hour per employee. Each employee identifies an average of 3,500 potential leads a week from a list of 4,900. An average of 8 percent of potential leads actually sign up for the service, paying a one-time fee of $90. Material costs are $1,500 per week, and overhead costs are $9,000 per week.Calculate the multifactor productivity for this operation in fees generated per dollar of input. (Round your answer to 2 decimal places.)
Multifactor productivity

Answers

Answer:

6.27

Explanation:

The computation of Multifactor productivity is shown below:-

Multifactor productivity = (Potential leads × Number of workers × Fees × Conversion percentage) ÷ (Labor cost + Material cost + Overhead cost)

= (3,500 × 3 × $90 × 0.08) ÷ ((3 × 40 × $13) + $1,500 + $9,000)

= $75,600 ÷ $12,060

= 6.27

Therefore for computing the multifactor productivity we simply applied the above formula.

The characteristics of a world market where global competition prevails include A. a market situation where competitive conditions across national markets are linked strongly enough to form a true world market and where leading competitors typically compete head to head in many different countries. B. minor cost variations from country-to-country (as concerns production, distribution, sales and marketing, and other primary components of the industry value chain) and minimal cross- country trade restrictions. C. a competitive environment comprised of so many competitors that no company has a sizable worldwide market share. D. many companies racing for global market leadership, with most contenders using the same basic type of competitive strategy and positioned in the same strategic group. E. low barriers to entry, such as large number of rivals that the actions of any one rival have little impact on the sales and market shares of other rivals, and key success factors that vary from country to country.

Answers

Answer:

A. a market situation where competitive conditions across national markets are linked strongly enough to form a true world market and where leading competitors typically compete head to head in many different countries.

Explanation:

The characteristics of a world market where global competition prevails include a market situation where competitive conditions across national markets are linked strongly enough to form a true world market and where leading competitors typically compete head to head in many different countries.

For instance, the fierce competition between the manufacturers of mobile phones such as Android devices and iOS devices. Also, manufacturers of vehicles are into head to head competition in different countries.

Vaughn Manufacturing's allowance for uncollectible accounts was $190000 at the end of 2020 and $178000 at the end of 2019. For the year ended December 31, 2020, Vaughn reported bad debt expense of $31000 in its income statement. What amount did Vaughn debit to the appropriate account in 2020 to write off actual bad debts?

Answers

Answer: $19000

Explanation:

From the question, we are informed that Vaughn Manufacturing's allowance for uncollectible accounts was $190000 at the end of 2020 and $178000 at the end of 2019 and that for the year ended December 31, 2020, Vaughn reported bad debt expense of $31000 in its income statement.

The amount that Vaughn debited to the appropriate account in 2020 to write off actual bad debts will be:

= $31000 - ($190000 - $178000)

= $31000 - $12000

= $19000

Other Questions
Help me please.... Washington Gladdens ideas would most closely be tied to which period in US history? decide if the first number is a factor or the second number with a yes or no. a. 9; 74,520b, 3; 876 What are words used in place of nouns, such as "T" and "him"?A. Personal pronounsB. SimileC. Rule of ThreeD. Rhetorical question regional disparity must be ended for proportionate natinal development An expensive vacuum system can achieve a pressure as low as 1.53 107 N/m2 at 26C. How many atoms are there in a cubic centimeter at this pressure and temperature? What is one way that Henrys speech uses gurative language QuestionConsider these functions.f(x) = -9x + 14g(x)=-3x2Select the correct answer from each drop-down menu.iIf x = 6, then f(6)If g(x) -48, then x =and x =Submit Question 2 of 10While writing a persuasive piece, which appeal should you use to get youraudience to believe and trust you?A. PathosB. ToneC. EthosD. SimileSUBMIT A horizontal spring with spring constant 85 N/m extends outward from a wall just above floor level. A 2.5 kg box sliding across a frictionless floor hits the end of the spring and compresses it 6.5 cm before the spring expands and shoots the box back out. How fast was the box going when it hit the spring Rearrange the equation so x is the independent variable. y+6=5(x-4) The following unadjusted trial balance is prepared at fiscal year-end for Nelson Company. 1.NELSON COMPANY Debit Credit2. Cash $1,000 3. Merchandise Inventory 12,500 4. Store supplies. 5,800 5. Prepaid Insurance. 2,400 6. Store equipment. 42,900 7. Accumulated depreciation - Store equipment $15,2508. Accounts payable 10,0009.J. Nelson, Capital 32,00010.J. Nelson, Withdrawal 2,200 11. Sales. 111,95012. Sales discounts 2,000 13. Sales returns and allowances 2,200 14. Cost of goods sold 38,400 15. Depreciation expense- Store equipmen 0 16. Salaries expense 35,000 17. Insurance expense 0 18. Rent expense 15,000 19. Store supplies expense 0 20. Advertising expense 9,800 21. Totals $169,200 169,200Nelson company uses a perpetual inventory system. It categorizes the following accounts as selling expenses: Required:1. Prepare adjusting journal entries to reflect each of the following:a. Store supplies still available at fiscal year-end amount to $1,750.b. Expired insurance, an administrative expense, for the fiscal year is $1,400.c. Depreciation expense on store equipment, a selling expense is $1,525 for the fiscal year.d. To estimate shrinkage, a physical count of ending merchandise inventory is taken. It shows $10,900 of inventory is still available at fiscal year-end.2. Prepare a multiple-step income statement for fiscal year 2015.3. Comple the statement of retained earnings and the balance sheet.4. Compute the current ratio, acid-test ratio, and gross margin ratio as of January 31, 2015. (Round ratios to two decimals.) What part of the brain is known as the pleasure center?A. Brain stemB. HypothalamusC. ThalamusD. MidbrainSUBMIT A sprinkler system is being installed in a newly renovated building on campus. The average activation time is supposed to be at most 20 seconds. A series of 12 fire alarm/sprinkler system tests results in an average activation time of 21.5 seconds. Do these data indicate that the design specifications have not been met? The hypotheses to be tested are H0: m = 20 versus Ha: m > 20, where m = the true average activation time of the sprinkler system. Assume that activation times for this system are Normally distributed with s = 3 seconds. (a) What is the value of the observed test statistic? (b) What is the value of the P-value? (c) Are the data statistically significant at the 5% significance level? Explain briefly. (d) What does the decision you made mean with respect to the question "Do these data indicate that the design specifications have not been met?" (e) If the true average activation time of the sprinkler system is, in fact, equal to 20 seconds, what type of error would you have made? [09.01]Identify the domain of the equation y=x2 - 6x + 1. (1 point) You are in charge of paying claims submitted by providers. You notice a certain diagnostic provider ("Doe Diagnostics") requested a substantial payment for a large number of members. Many of these claims are for a certain procedure. You review the same type of procedure for other diagnostic providers and realize Doe Diagnostics' claims far exceed any other provider you reviewed. What should you do? Morganton Company makes one product and it provided the following information to help prepare the master budget:The budgeted selling price per unit is $70. Budgeted unit sales for June, July, August, and September are 8,500, 16,000, 18,000, and 19,000 units What is the accounts receivable balance at the end of July? Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG