The data shown above is a life table for the female Belding ground squirrel in the Sierra Nevada
Mountains.
Calculate the mortality rate (per thousand) between the ages of 1-2.
You must show your work in order to receive credit for your answer!

The Data Shown Above Is A Life Table For The Female Belding Ground Squirrel In The Sierra NevadaMountains.Calculate

Answers

Answer 1

Answer:

377

Explanation:

you plus 252and 125 together and you will get 377


Related Questions

When sweat cools on the skin, removing heat and cooling the body, what process is occurring? A. Parasympathetic nerve conduction B. Respiration C. Homeostasis D. Dehydration

Answers

Explanation: it has to be C because i got it right on my test

Vị trí các cacbon trong cấu trúc của đường đềôxyribô trong 1 nuclêôtit được thêm dấu phẩy vì:

Answers

Answer:

hi please answer my questions.

What are two major drivers of surface ocean current and deep ocean current? 1. Surface ocean current 2. Deep ocean current The choices are: A. Differences in water density, resulting from the variability of water temperature and salinity B. Global wind systems

Answers

Answer:

1-B 2-A

Explanation:

this is because the wind blowing over the water causes motion whereas deep water is effected by Differences in water density, resulting from the variability of water temperature and salinity

ASAP When ______ is hydrolyzed, it forms _______. A. protein, amino acids B. ATP, ADP C. polysaccharide, monosaccharide D. lipid, triglyceride

Answers

Answer:

The answer is ATP, ADP

Explanation:

When protein is hydrolyzed, it forms amino acids. Thus, the correct option is A.

What is Hydrolysis?

Hydrolysis may be defined as a chemical process that utilizes the molecules of water that involve the chemical breakdown of a compound.

Amino acids are the monomers of protein. These amino acids are linked together by peptide bonds. But the process of hydrolysis breaks the peptide bond between the amino acid sequences and released them significantly in free form.

Therefore, when protein is hydrolyzed, it forms amino acids. Thus, the correct option is A.

To learn more about Hydrolysis, refer to the link:

https://brainly.com/question/4352413

#SPJ5

List 3 variable that Anurag should keep the same

Answers

Answer:

seawater ,upside-down funnel and seaweed

Explanation:

What part of the brain is known as the pleasure center?

A. Brain stem

B. Hypothalamus

C. Thalamus

D. Midbrain

SUBMIT

Answers

Answer:

B. Hypothalamus

Explanation:

The hypothalamus contains the pleasure center of the brain, the nucleus accumbens. The hormone dopamine is released from this part of the brain in response to or anticipation of pleasurable activities such as eating good food, monetary rewards as well as when taking psychoactive drugs.

The release of dopamine affects other feelings such as happiness, focus, being alert as well as staying motivated. it also affect some voluntary actions as well.

Constantly seeking out activities that stimulate dopamine release may lead to addiction to such activities as in drug addiction.

Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin. What kind of a cell is this?

Answers

Answer:

An animal cell in the telophase

Explanation:

Telophase is one of the stages of cell division in animal cell .

In the animal cell during telophase, Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin because the nuclear membrane and nucleoli reform, cytokinesis is almost coming to completion and the chromosomes eventually uncoil to chromatin. Usually cytokinesis occurs during telophase.

explain why germinating seeds were used in this investigation cellualr respiration

Answers

Explanation:

As oxygen is consumed to provide energy, germinating seeds release carbon dioxide. ... HYPOTHESES: The experimental hypothesis is that germinating seeds will show a greater rate of respiration than control glass beads. Additionally, that at higher temperatures, the rate of cellular respiration in the seeds will increase.

use the numbers 12345 to place the protien creations steps below in the correct order

Answers

Use the numbers 1, 2, 3, 4, and 5 to place the protein creation steps below in the correct order. Ribosome attaches to the mRNA. Information is transcribed in DNA to mRNA. tRNA anticodon carries an amino acid that compliments the mRNA codon. mRNA leaves the nucleus. The chain of amino acids forms a protein.  

if it is helpfull please mark as brainlist

Answer:

please list numbers 12345 and then i will

Explanation:

what is a radical a group of ions

Answers

Answer:

A radical is a group of atoms of elements carrying a charge. radicals or ions are formed by gaining or loosing ions. positive radical ions are called radical cations whereas negative radical ions are called radical  anions.

hope this helps you u :)      

Which is NOT a function of magnesium in the body?
znutritio acting as a cofactor for enzyme systems in the Irody
regulating bone and mineral status
protecting teeth from acid-forming bacteria
making up one component in bone mineral​

Answers

Answer: I think it is the third one which states, "Protecting teeth from acid-forming bacteria".

Explanation:

Help anyone please????!

Answers

1. Wavelength
2. Compression
3. Rarefractiom
Please mark brainliest

Protein that accounts for why water can cross a membrane more quickly than expected is Group of answer choices

Answers

Answer:

The correct answer is "Aquaporin".

Explanation:

The missing options of this question are:

A. ATP synthetase

B. Aquaporin

C. The sodium-potassium pump

D. Integrin

The correct answer is option B. "Aquaporin".

Aquaporins are microscopic channels that belong to a family of proteins that form pores. Aquaporins are also known as water channels for its specific biological role of allowing water to cross the cell membrane. The presence of aquaporins explains why water can cross cell membrane more quickly than expected, since they function as regulators of water transference.

explain what perlemoen are?​

Answers

Answer:

Also known as "abalone" which is a

Explanation:

Answer:

any of various edible marine gastropod mollusks of the genus Haliotis

Explanation:

hope this helps

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG

Answers

Answer:

a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA

Explanation:

The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20  nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:

Schematically:

The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:

5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'

The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:

3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'

Which of the following small GTPases are NOT involved in vesicle budding or docking? A. ARF B. Rab1 C. Ras D. Sar1p

Answers

Answer:

option c is correct that is Ras

Explanation:

what is angiology????​

Answers

Explanation:

Angiology is the medical specialty dedicated to studying the circulatory system and of the lymphatic system, i.e., arteries, veins and lymphatic vessels. In the UK, this field is more often termed angiology, and in the United States the term vascular medicine is more frequent

Answer:

- study of blood vessels and lymphatic system..

Explanation:

this is the medical term...is the study of blood vessels and lymphatic system.

Biologists designed an experiment to test the effects of compost on the development of root crops

Answers

Answer:

The crop has good yield because Compost has a good effect on root crops.

Explanation:

Compost has a great effect on the development of root crops such as onion, potato, garlic and ginger etc. Compost provide nutrients to these crops as well as soften the soil due to which they grow rapidly. It also improved ventilation, soil structure and soil texture which is very necessary for the crop. Due to ventilation, oxygen gas is available to the roots which increases growth and yield of these crops. Compost also retain water and nutrients so they are available to the roots. So those plots where compost is applied observed increase in yield as compared to other plots.

DNA is negatively charged. Therefore, it is
O hydrophilic
O hydrophobic

Answers

DNA is hydrophilic in nature

In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.
1. The phenotype of the heterozygous plant is_________.
2. The genotype of the heterozygous plant is_________.
3. The genotype of the plant with yellow pods is________.
4. The genotypes of gametes produced by a heterozigous plant is______.
5. The genotypes of gametes produced by a yellow plant is_______.
A. Green pods
B. 75% AA and 25% Aa
C. AA
D. 100% A
E. Yellow pods
F. 50%
G. 25%
H. 100% a
I. 50% A and 50% a
J. Aa
K. 0%
L. 75%
M. 75% A and 25% a

Answers

Answer:

1. Green

2. Aa

3. aa

4. A and a

5. a and a

Explanation:

1. The phenotype of the heterozygous plant (Aa) would be green since the allele responsible for green color (A) is dominant over the allele responsible for yellow color (a).

2. The genotype of a heterozygous plant would be Aa. Heterozygous individuals have different alleles for the same gene.

3. The genotype of the plant with a yellow pod would be aa. Since the allele for green color (A) is dominant over the allele for yellow color (a), the yellow color can be expressed only in the absence of the (A) allele. Hence, the genotype fo yellow color has to be aa.

4. The genotypes of gametes produced by a heterozygous plant would be (A) and (a) because heterozygous individuals have two different alleles for a gene.

5. The genotypes of gametes produced by a yellow plant would be (a) and (a) because a yellow plant has the genotype (aa).

if a wild game animal is slaughtered under usda guidelines can it be prepared and served A:No. A wild game animal can never be served B:Yes a wild game animal can be served C:No wild game animals cannot be eated D:Maybe if you seek usda permission

Answers

Answer: C:) No wild game animals cannot be eated

Explanation: hope that helps (:

g dGDP is made from ________ by the ribonucleotide reductase. This enzyme is inactive when ______ is bound to its master regulatory pocket.

Answers

Answer:

1.  GTP dephosphorylation

2.  hydrolyzed or removed

Explanation:

GDP, (Guanosine diphosphate) is a biological term, that is made of composition including pyrophosphate group, a pentose sugar ribose, and the nucleobase guanine and it is made from GTP ( Guanosine triphosphate ) dephosphorylation by the ribonucleotide reductase. This enzyme is inactive when hydrolyzed or removed, and then eventually bound to its master regulatory pocket.

what is economic importance of honey bee​

Answers

Answer:

1. They are one of the most important pollinators for both wild and domestic plants.

2. Their most important product, honey, is used in baking, meals, and drinks. It is also used for shooting sore throat and suppressing the urge to cough. It also reduces the ravages of the aging process and it is an antioxidant that may help in the prevention of cancers. It is a mild salve for treating skin conditions and abrasions.

3. Propolis, a material made when bees mix resin with honey, is used to treat minor wounds and abscesses.

4. Bee pollen which are pollen balls are excellent source of amino acids and vitamins for humans.

5. Royal jelly, which is a milky secretion secreted by worker honey bees is used for asthma, hay fever, pancreatitis, insomnia, premenstrual syndrome, and other diseases.

Which part of the cell functions to recognize other cells? (1 point)
O nucleus
O cytoplasm
O cell wall
O plasma membrane

Answers

Answer:

cell wall maybe it may be wrong also

Plasma membrane of the cell functions to recognize other cells. Thus option D is correct.

What is Plasma membrane?

The plasma membrane which is an outer covering of cell present in both prokaryotic and eukaryotic cell.

It is a thin selectively semi-permeable membrane which enclose the cytoplasm along with other organelle.

Proteins and lipids are the major components of membrane, beside this carbohydrate are also present in cell membrane.  

The most common lipid in membrane is phospholipid, other lipids are glycolipid, sphingolipid.  

The function of cell membrane is to provide protection and maintain the integrity of the internal environment of the cell,

It act as a base of attachment for the cytoskeleton  for cell-cell communication.

It involve in transport of materials like nutrients, toxic substances.

Thus option D is correct.

Learn more about plasma membrane, here:

https://brainly.com/question/14727404

#SPJ2

What is the process of
evaporation?

A. The process in which plants release vapor into
the atmosphere

B. Any process that returns water from the
atmosphere to the earth

C. The process in which liquid water turns to
water vapor

Answers

The answer to your question is C

define factors affecting enzyme action:temperature

Answers

Answer:

I am secondary level student and this doesn't belongs to my coure till yet however..i have written this through google.....you may search there as well..

Explanation:

Enzyme activity occurs within a narrow range of temperatures compared to ordinary chemical reactions. As you have seen, each enzyme has a certain temperature at which it is more active. This point is called the optimal temperature, which ranges between 37 to 40C°...

Temperature. As temperature increases to the optimum , the kinetic energy of the enzyme and substrate increases, causing more collisions between the enzyme and substrate.

which climate does sparrow live hot or cold

Answers

Answer:

Hot ok please give me brilliance

Explanation:

please

b) How will you describe any three (3) major components of the environment to a named
class puyil?​

Answers

Answer:

Hydrosphere, atmosphere and biosphere are the three major components of the environment.

Explanation:

Hydrosphere, atmosphere and biosphere are the three major components of the environment. hydrosphere refers to water bodies such as ocean, sea, ponds and lakes etc that is present in our environment. atmosphere refers to the gaseous layer which is present above the earth surface. in this layer oxygen, nitrogen and carbondioxide etc are present. biosphere refers to all living organisms such as human, animals, plants and microbes etc which are present on earth surface..

the origin of a muscle is generally

Answers

explain the  question more

Answer: The stable and proximal attachment

Explanation:

a body may have zero velocity even though its speed is 10m/s. give reason.​

Answers

Explanation:

because speed is time rate at which an object is moving along a bath, while velocity is the rate and direction of object's movement .

Other Questions
Simplify: 41a-2b + 3c) + 11a There were 3 madmen and 1 doctor. The doctor was going to do a test to see if they were smart. He said to the madmen, jump under the cars, there is chocolate. 1. mad jumped dead. 2. mad jumped dead. 3. mad not jumped. The doctor said that must have been smart. he asked. Why didn't you jump? Crazy, I am waiting for the truck, I will buy a big chocolate, he said. How was the joke? I wrote. 1. What's the overall tone of this poem? 2.After reading this poem discuss your reaction to the boxer and all that he has to go thru help I'm dumb Find the slope of the line.4/3-4/3-3/43/4 how does water affect places in its gas liquid and solid states Type the correct answer in each box. Use numerals instead of words,The domain of this function is {-12, -6, 3, 15).y = -32 +7Complete the table based on the given domain.y6051515ResetNext Make a substitution to express the integrand as a rational function and then evaluate the integral. (Remember to use absolute values where appropriate. Use C for the constant of integration.) 2 sec^2(t)/tan^2(t) + 14 tan(t) + 48 dt Explain the three degrees of inflation asap!! Which of the following was not an effect of the Dust Bowl?A. 162 million acres were damaged by wind erosion.B. 10 million acres lost 5 inches of topsoil.C. The population of Oklahoma dramatically increased.D. Oklahoma's agricultural economy was negatively impacted. Six automobiles are initially traveling at the indicated velocities. The automobiles have different masses and velocities. The drivers step on the brakes and all automobiles are brought to rest.Automobile 1: 500kg, 10m/sAutomobile 2: 2000kg, 5m/sAutomobile 3: 500kg, 20m/sAutomobile 4: 1000kg, 20m/sAutomobile 5: 1000kg, 10m/sAutomobile 6: 4000kg, 5m/sRequired:a. Rank these automobiles based on the magnitude of their momentum before the brakes are applied, from largest to smallest.b. Rank these automobiles based on the magnitude of the impulse needed to stop them, from largest to smallest.c. Rank the automobiles based on the magnitude of the force needed to stop them, from largest to smallest. In algebraic expressionThree-fourths the square of a number. Assume you are selling pizzas at $ 8 per pizza. Your fixed costs (rent, salaries, and utilities) are $4,438/month. The food costs and other variable costs are 40 percent of the selling price. What is your break-even point in units if you need to make 25% target return on the sales revenue? (enter only the value) Two buses 'A' and 'B' are moving in the same direction with the velocities 30m/s and 40m/s respectively. Find the relative velocity of the bus 'A' with respect to the bus 'B'. Calculate the relative displacement between them after 4 minutes.:)Hope who are reading this may have a good life;)Lots of love from Nepal The supreme court ciyes thesecases because it seeks to what? HAPLLAPLPAL! BRAINLIEST! The quadrilaterals JKLM and PQRS are similar. Find the length x of SP You are to manufacture a rectangular box with 3 dimensions x, y and z, and volume v=8000. Find the dimensions which minimize the surface area of this box. Hi! Can you help me answer this? In part A of the lab we see that the magnetic field of a long straight wire __. a. increases with distance in a linear relationship b. increases with distance in a non-linear relationship c. decreases with distance in an inverse (1/r) relationship d. decreases with distance in an inverse-square (1/r2) relationship Helpp me pleaseeeeee