What is measurement? Write any two importance of it. Why do we need measurement?​

Answers

Answer 1

Answer:

The comparison of an unknown quantity with a known established standard quantity.

any two important of it are:

a) it helps in performing scientific experiments to establish truth about a physical phenomenon.

b) It helps in performing experiment for making our daily food.


Related Questions

3.
Read this sentence from the passage.
The tortoises which live on those
islands where there is no water,
or in the lower, arid parts of
the others, feed mainly on the
succulent cactus.
The word succulent MOST LIKELY
means
A. dried out.
B. chunky.
C. moist.
D. tough.

Answers

i think it’s C because cactuses store water in them, and also it mentions that the tortoises live in dry areas so it makes sense that they’re feeding on cactuses to get some water

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

carbohydrate are store in animal cell in the form of​

Answers

Answer:

molecule glycogen

Plants store carbohydrates in long polysaccharides chains called starch, while animals store carbohydrates as the molecule glycogen.

Glycogen molecule, which is found in the cytosol of the cell

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

The opposable thumb is a trait that connects us to other primates; allowing us to grab and use tools and increasing chances for survival. This means it is a(n) __________.

Answers

Answer:

The options to this question are;

A. genotype

B. adaptation

C. selective pressure

D. stabilizing pressure

The answer is B) Adaptation

Explanation:

Adaptation is the process whereby an organism becomes well suited to survive in its natural environment, which is aided by the possession of certain traits called adaptive features. For example, the fins of a fish makes it fit to survive in an aquatic environment, likewise the opposable thumbs of humans make us well suited to survive in our environment.

As stated in the question, the opposable thumb i.e. movement of the thumb independently of the other four fingers, is a characteristics of primates. This unique feature (opposable thumb) allows us to grab things, get a good grasp of tools, use tools effectively, write things, etc. All these ability due to the possession of opposable thumb increases our chances of survival. Hence, the possession of opposable thumb is regarded as an ADAPTATION

Name 2 features/tools in Drive that makes it easy to collaborate on assignments?

Answers

1. Live action
It shows what people are editing on your assignment so that you know what they have changed on it
2. Comments
When people have a suggestion, all they simply do is comment
Hope this helped! If it did, please mark as brainiest!

The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the likelihood that an organism could become extinct. Which of the following could also increase an organism's chances of extinction? A. an increase in predation, competition, and/or disease B. a lack of genetic diversity in an organism's species C. the inability to reproduce D. all of these

Answers

Answer:

D

Explanation:

all of those are likely to increase an organisms chances of extinction

latex from _______ is the source of biodiesel
A. Jatropa
B. Tulasi
C. Neem
D. Cactus​

Answers

Latex from cactus is the source of biodiesel.

Detectives work in three different locations when processing evidence. Which is the correct order for the locations of processing evidence? a. in the forensic lab, analyzing evidence b. in the court, testifying about their findings c. at the crime scene, collecting evidence 1. a, b, c 2. b, c, a 3. c, b, a 4. c, a, b

Answers

Answer:

The correct order is option 4. c, a, b.

Explanation:

Evidence collection and processing involves three different locations and this processing and analyzing is done by the detectives. The first location is the crime scene at which detectives collect the evidences such as photographs, blood traces and samples, fingerprint and other physical evidences without manipulating them.

Second location of processing evidences is at forensic lab at which the evidences are thoroughly tested and analyzed and match with prior records. The final location is in the court house where all the evidences and finding about them are testified.

Thus, the correct order is : option 4. c, a, b.

Why did the author think e-skin could make better hearing aids? In your answer, explain how the ears connect to the nervous system

Answers

Answer:

The author thought this because e-skin might hold promise for use in soft, wearable hearing aids. Unlike conventional aids, soft devices are more comfortable because they mold to human skin. When the ear receives sound vibrations, there are hair cells in the cochlea that vibrate and translate the sounds into electrical signals. These electrical signals are transmitted to the auditory nerve, which transmits the information to the brain.

Answer:

Sound is one of the five major senses. The nervous system carries sound signals from sensory receptors to the brain. E-skin has many sensory receptors that can carry signals toward the brain, enabling us to react to sounds. Because e-skin is soft, scientists can use it to make effective hearing aids that are quite comfortable to wear.

Explanation:

do not copy it, this is the exact answer from Edmentum

(this means it right)

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

How do I work this question out I’m struggling

Answers

I think the best thing to do is use a ruler maybe.

HELP
In humans, ventilation, digestion, and blood flow are important biological processes. Explain the relationship between the structure of tissues or organs and one of these processes.

Answers

Answer:

I am assuming the question is asking how do the processes relate to one another.

Explanation:

Ventilation happens in the lungs, where carbon dioxide and oxygen are exchanged in the alveoli. This is done via cappilaries that surround the alveoli. Cappilaries are small blood vessels, which are collecitelvy part of the blood flow system (circulation) of the body. In reguards to the digestion, there are capillaries in the vili (which are tiny finger-like structures) so that they can pick up the nutrients during digestion. Another way blood flow and digestion are connected is because the stomach is a muscle, thus is moves and requires energy. That energy comes from the oxygen and nutrients that is supplied by the blood. These are just some examples.

Which best describes food when it reaches the stomach?

Answers

Explanation:

The polysaccharides have been broken down.

Adequate food safety practices lead to less: A:Food waste B:Insurance costs C:Hospitalizations D:Training

Answers

The answer to this question is HOSPITALIZATIONS

Food is very important as it is contains the source of energy. However, food can easily be contaminated majorly by MICROORGANISMS, hence, the reason they must be well kept and preserved. Every individual should oblige by the safety rules that guide handling of food (cooked or raw).

Some of the safety rules include;

* Proper washing of hands before and after cooking* Cook food thoroughly* Separate cooked and raw food* Keep food at safe temperatures etc.

Therefore, adequate food safety practices will help reduce HOSPITALIZATIONS caused by disease causing agents.

Learn more at: https://brainly.com/question/14608053

Hospitalizations will be less if adequate food safety practices are adopted.

Adequate food safety practices lead to less hospitalizations in the society because most people hospitalize due to bad food habits and food poisoning. If we implement safety measures related to food then we can save ourselves from various diseases as well as prevent ourselves from going to the hospital so in my opinion hospitalizations will be less if sufficient food safety measures are adopted by the people.

Learn more: https://brainly.com/question/17155329

Which of the following statements is true?

Photosynthesis is a type of homeostasis.
Unicellular organisms have differentiated cells.
Respiration is a type of metabolism.
Multicellular organisms are made of only one cell.

Answers

Answer:

Respiration is a type of metabolism.

Answer:

C. Respiration is a type of metabolism

Explanation:

Both B and D are incorrect because:

Multicelluar organisms have more than one cell; while singlecelled organisims only have one cell.

Also, homeostasis is a natural way an organisms body reacts to different situations, like when you sweat, your body is realising a way to lower the heat in your body. Therfore, A. is also incorrect.

Hope this helped!

When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. When fats are used as an energy source, the glycerol portion enters ________ when it has been converted to ________. glycolysis; dihydroxyacetone phosphate the electron transport system; coenzyme Q glycolysis; fructose-6-phosphate the citric acid cycle; pyruvate the citric acid cycle; acetyl CoA

Answers

Answer:

 glycolysis; dihydroxyacetone phosphate

When fats are used as an energy source, the glycerol portion enters the glycolysis when it has been converted to dihydroxyacetone phosphate. Thus, the correct option is A.

What is the Glycolysis?

Glycolysis may be defined as the process in which glucose (sugar) is partially broken down by cells in enzyme reactions that do not need oxygen.

In order to obtain energy from fats, triglycerides must be broken down into fatty acids and glycerol through hydrolysis. The fatty acids enter to Krebs cycle and are converted into acetyl CoA.

While the glycerol portion enters into glycolysis and is converted into dihydroxyacetone phosphate.

Therefore, the correct option for this question is A.

To learn more about Glycolysis, refer to the link:

https://brainly.com/question/737320

#SPJ2

Helpppppp!!!
Which of the following is an example of a hormone?

Adrenaline
Blood
Calcium
Thyroid

Answers

I believe the answer is adrenaline, the rest just dont make sense

Answer:

Adrenaline is an example of a hormone. Hormones are chemical messengers in your body, which carry around messages. Adrenaline is a hormone that is released when you are in fear, stress, or doing something dangerous.

Let me know if this helps!

Why does the land around a once active coal mine remain barren?
A: Toxic nitrous oxides were released into the soil killing all plants.
B: C: Ozone is formed from hydrocarbons which prevent the growth of plants.
Please don't just take points. Thank you and have a good day

Answers

Hello!!

The answer is A. Toxic nitrous oxides were releassed into the soil killing all plants

Answer:

Empty coal mines are flooded with acid rain so no life forms can survive.

Explanation:

Protects the cell and controls what enters and leaves the cell

Answers

Answer:

- Endoplastic reticulum

-cell membrane

-ribosomes

-mithocondrion

^ all the ansers

Explanation:

Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

What is Cell Membrane?

The cell membrane is also called the plasma membrane. It is composed of a semipermeable lipid bilayer that regulates the transport of materials into and out of the cell. It protects the cell and provides a stable environment within the cell, and this membrane serves many functions.

The main function of the cell membrane is to transport nutrients into the cell, while another is to remove toxins from the cell. Cellular membranes are composed of glycerophospholipids, which are molecules composed of glycerol, a phosphate group, and two fatty acid chains.

Thus, Cell membrane protects the cell and controls what enters and leaves the cell. So, the correct option is (C).

Learn more about Cell Membrane, here:

https://brainly.com/question/11906743

#SPJ2

Your question is incomplete, most probably complete question is:

_____Protects the cell and controls what enters and leaves the cell

A) cell wall

B) lysosomes

C)cell membrane

D)Vacuole

When you centrifuge the DNA isolated from the bacteria, the DNA separates into two classes. One class of labeled DNA includes very large molecules (thousands or even millions of nucleotides long), and the other includes short stretches of DNA (several hundred to a few thousand nucleotides in length). Which two classes of DNA do these different samples represent

Answers

Answer:

Leading strand and Okazaki fragments

Explanation:

The two classes of DNA that the different samples represent include the leading strand and the Okazaki fragments.

The large molecules DNA with thousands/millions of nucleotides constitutes the leading strand of the DNA while the short stretches of DNA with just a few thousand nucleotides in light constitute the Okazaki fragments.

This is because, during replication, the leading strands of DNAs are usually synthesized in a continuous manner and end up forming a long, continuous daughter strand while the lagging strands are usually synthesized in short, discontinuous fragments known as the Okazaki fragments.

The continuous/discontinuous replication of the leading/lagging strands of the DNA is due to the characteristics of the enzyme responsible for adding bases to the growing daughter strands. The DNA polymerase enzyme can only add nucleotides in the 5' to ' direction.

What factor about cellular respiration are you testing? ( what makes the three bottles different?)

Answers

Answer:

Gas.

Explanation:

Gas which is present makes the three bottles different from one another. There are three factors which is used for testing of cellular respiration such as amount of oxygen consumed during this process, amount of glucose used and amount of carbondioxide produced during cellular respiration. During cellular respiration, oxygen used in order to break down glucose and releases high amount of energy with the waste materials such as carbondioxide gas.

how to minimize flood​

Answers

Answer:

some of the ways are...

Explanation:

establishing strong damavoiding construction around water resources properly utilizing and storing rain water for future useflood cannot be stopped totally as it is the effect of nature but its effects can be minimized by using our scientific knowledge and methods


Mention the types of bees​

Answers

Answer:

ok thus very good percent few Mohammad khan

If capeland switches from producing 0 watermelons to producing 18 million tons of watermelons, what does it give up?

Answers

Answer:

Attached to this solution is an image of the complete question and data.

The correct answer is:

6 million pairs of shoes

Explanation:

From the diagram attached to this answer, the following data can be gotten:

Watermelons                   shoes

(Millions of tonnes)          (Millions of pairs)

0                                        15

8                                        14

14                                       12

18                                       9

20                                      5

21                                       0

From the pattern of the data shown above, we notice that as the production of one commodity increases, the other is given up (decreases)

Therefore, to find how much shoes are given up if Capeland switches from 0 watermelons to 18 million tons of watermelon, we will find the difference between the number of shoes produced at 0 and at 18 million tons of watermelon

at 0 watermelon; shoes = 15 million pairs

at 18 million tons of watermelon; shoes = 9 million pairs

Therefore, number of shoes given up = 15 - 9 = 6 million pairs

Hence, 6 million pairs of shoes are given up tp increase production of watermelon from 0 to 18 million tons

A possible answer to a scientific question that can be tested is a

Answers

The key to a good and manageable investigation is to choose a topic of interest, then ask what is called a “testable question.” Testable questions are those that can be answered through hands-on investigation by the student.

how can new stuff be made from old stuff

Answers

Answer:

BUY A NEW ONE

clean it

or sell it , with the money you sold the item use that money to buy a new one

Explanation:

Answer:

That is called upcycling. IKEA has started doing that with their products

Explanation:

how does the cell wall contributes towards maintaining homeostasis in the cell​

Answers

Answer:

The water wants to flow from the higher concentration, which is outside of the cell, to the lower concentration, which is inside of the cell. The cell membrane helps to regulate and slow down the flow of water into the cell. This is yet another way that the cell membrane helps maintain homeostasis.

I hope it helps ❤️

answer answer answer answer

Answers

Answer: C

Explanation: Amoeba use pseudopods to move around and people use feet to move.

Answer:

The answer is C

Other Questions
Quina is cooking fish for a group of travelers quina has 78 huge fish and each fish can feed 3 travelers. how many travelers can Quina feed? The distance of planet Mercury from the Sun is approximately 5.8. 107 kilometers, and the distance of planet Venus from the Sun is 1.1. 10 kilometers. About how many more kilometers is thedistance of Venus from the Sun than the distance of Mercury from the Sun? Last year, Rob set up the Road Runner Race for his school.The race was 1,200 meters long and 188 people signed up torun the race. 38 people did not show up to run. This year,there will be 3 times as many runners as last year. Howmany people will run the race this year? Can someone help me for words to live by I need a good quote, around 3 when you tell the most important part of text you are identifying In English, a noun that is being described by another noun comes second. In Spanish, the noun that is being described comes_____, followed by _______ and the describing the noun. 2 divided by 3 + 2 divedes by 3 +3 divided by 3 =? Ming is a microbiologist. Which sentence best describes why Ming must have strong analytical skills? A. He uses technical equipment during his experiments. B. Ming works in coordination with other experts. C. He must determine which antibiotics treat an infection effectively. D. Ming must seek funding for research. E. He must share his knowledge and suggestions with his colleagues. A tin of tennis balls costs $6.99, and each tin contains 4tennis balls.If the tennis balls were sold individually, thenapproximately how much would one tennis ball cost?$ which of the following statements must be true about this diagram ? check ALL that apply what is a disavanege for renewable solor power Dante is baking two different recipes, cookies and brownies. The cookie recipe requires 1.5 cups of sugar, and the brownie recipe requires 1.25 cups of sugar. Write an addition equation to represent the total amount of sugar Dante needs. Enter your answer as an addition equation, like this: 42+(-53)=-11 7 pounds of raw material are required to make 1 finished unit. The company desires an ending raw materials inventory for each month equal to 29% of the following months production (in units of raw material) . How many pounds of raw material should be purchased in May? 1. Why is f(x)=(3x+13)2+89 not the vertex form of f(x)=9x2+2x+1? 2. What is the vertex of the parabola with the equation y=(x2)2+10? A local museum charges $25 per adult and $12 per child for admission fees. At the end of a day, the museum made $9,014 in total admission revenue, not including sales tax, and had a total of 450 guests. The system of equations below can be used to model the number of guests that were children, x, and the number of guests that were adults, y. The net of a right rectangular prism is shown below: Find the volume of the prism with the given net (in cubic inches). You are a student in Danang city. You will describe your neighborhood for new students. You should say: 1/ Where to buy food2/ Where to buy furniture 3/ Where to get a bus to university4/ Where to send a package5/ How do you feel about Danang city? Which statement best describes relevant?o the goal of a discussion groupO explores a topicO directly related to the topicO responses to questions GIVING 15 POINTS PLS FASTDrag the tiles to the boxes to form correct pairs.Match each addition operation to the correct sum.-24 8 + 30131.8728.98+(-52.22)6545%+39-23.2456.75 +75.12ResetNextNext I need help with this please if anyone know I will appreciate it