3. Which plants are usually the first to grow during secondary succession?
A ferns
Blichens
Cweeds
D trees

Answers

Answer 1

Answer:

ferns

Explanation:

these are alsi known as conifers which require a great amount if light

Answer 2

Im not a science student just trying beans I guess


Related Questions

Which of the traits below are completely influenced by the expression of genes? (Choose all that apply)
weight
attached or unattached earlobes
hair texture
eye color

Answers

Eye color bjfijdjsuddjjdcnvnfjd

Answer:

attached or unattached ear lobes

What can you learn about by studying DNA?

Answers

Answer:

Explanation:

                  The study of human DNA and genetics can be intellectually fascinating, but it also has plenty of practical applications. From the use of DNA in court cases to the discovery of new therapies for genetic diseases, a thorough understanding of the human genome can have important medical, social and legal impacts.

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

• How the knowledge of classification be applied to assess the characteristics of different organisms when visit to zoo, herbaria or gardens.(Students may do research on internet to answer this question )
plz correct answer
be quick

Answers

Answer:

Compare two organism on the physical features and mode of nutrition.

Explanation:

Organisms are classified in groups and sub-groups on the basis of similarities and differences. so in order to compare two organisms, start with the similarities that are present between them. If similarities are more so they belong to the same group or if differences are more than both are placed in different groups. for classification, see the physical appearance of organism, mode of nutrition and habitat etc. If organisms are identical, they belong to the same species, if one or two characters are different so their genus will be same but specie is different. In zoo animals are different from the animals which is present in garden so compare the physical features of zoo and garden animals.

how many different versions of a gene are carried in a single normal cell?

Answers

Answer:

two versions of a gene are carried in a single normal cell called alleles

The following specimens/slides were shown to the students: mushroom, moss, earthworm, volvox, bacteria. The teacher asked them to classify them into the five kingdoms.

Answers

Answer:

Mushroom-Kingdom Fungi

Moss-Kingdom Plantae

Earthworm-Kingdom Animalia

Volvox-Kingdom Protista

Bacteria-Kingdom Monera

Explanation:

The classification of the organisms into five kingdoms is as follows:

Mushroom- Kingdom FungiMoss- Kingdom PlantaeEarthworm- Kingdom AnimaliaVolvox- Kingdom ProtistaBacteria- Kingdom MoneraWhat is classification?

Classification is distributing the organisms into different groups according to their similar characteristics. The five kingdom classification is the approved form of classification today.

The five kingdoms are Monera, Protista, Fungi, Plantae, and Animalia, and the organisms are distributed in these kingdoms.

Thus, the classification is following:

Mushroom- Kingdom FungiMoss- Kingdom PlantaeEarthworm- Kingdom AnimaliaVolvox- Kingdom ProtistaBacteria- Kingdom Monera

Learn more about classification, here:

https://brainly.com/question/14489978

#SPJ2

Superficial similarities in structures that have the same function can seem like they are evidence of a common ancestor, but they are not. An example of this is the convergent evolution of wings in insects as well as in birds. What are these types of structures called

Answers

Answer:

Distinguishing between Similar Traits

Similar traits can be either homologous structures that share an embryonic origin or analogous structures that share a function.

LEARNING OBJECTIVES

Explain the difference between homologous and analogous structures

KEY TAKEAWAYSKey PointsOrganisms may be very closely related, even though they look quite different, due to a minor genetic change that caused a major morphological difference.Unrelated organisms may appear very similar because both organisms developed common adaptations that evolved within similar environmental conditions.To determine the phylogeny of an organism, scientists must determine whether a similarity is homologous or analogous.The advancement of DNA technology, the area of molecular systematics, describes the use of information on the molecular level, including DNA analysis.Key Termsanalogous: when similar similar physical features occur in organisms because of environmental constraints and not due to a close evolutionary relationshiphomologous: when similar physical features and genomes stem from developmental similarities that are based on evolutionphylogeny: the evolutionary history of an organismmolecular systematics: molecular phylogenetics is the analysis of hereditary molecular differences, mainly in DNA sequences, to gain information on an organism’s evolutionary relationships

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Why is it necessary to separate oxgynated blood and deoxgynated blood in living organisums?

Answers

Answer:

For efficient transportation of blood.

Explanation:

if you think about fat as old stuff,what new stuff can be made from it

Answers

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

Fat is derived from plant and animal sources. They include seeds, fruits, fatty fish.

Fats serve as a source of energy in organisms and also serve as insulation.

If you think about fat as old stuff,what new stuff can be made from it means of the things fats can be made from and they include Paints, Lubricants, Biofuel, Face cream, Soap etc. These products are manufactured in industries on a large scale due to their high demand.

Answer:

Paints, Lubricants, Biofuel, Face cream, Soap,

Explanation:

What is the role of Langerhans cells? prevent pathogens from entering the body using antibacterial agents destroy pathogens that enter the body using white blood cells identify pathogens that enter the body and carry them to lymph nodes for destruction

Answers

The role of Langerhans cells is that they prevent pathogens from entering the body using antibacterial agents.

What are Langerhans cells?

Langerhans cell is a dendritic cell of the skin and mucosa, containing Birbeck granules, and present in all layers of the epidermis but most prominent in the stratum spinosum.

Langerhans cells play important roles in the immune system by acting as the outermost guard of the cutaneous immune system where they induce the first reactions against pathogens encountered via the skin.

Therefore, the role of Langerhans cells is that they prevent pathogens from entering the body using antibacterial agents.

Learn more about Langerhans cells at: https://brainly.com/question/15660598

#SPJ2

Answer: 3.identify pathogens that enter the body and carry them to lymph nodes for destruction

Explanation:

-gene 1
-gene 2
-gene 3
How are these three genes related?

Answers

Answer:

Depends on the locations of these gene segment on the chromosome whether it be found on the same or different.

It can either be linked or unlinked.

Which of the following are all examples of pollution
Pesticide Run-off
Desertification
Global Warming
Poaching
Burning of Fossil Fuels

Answers

Burning fossil fuels

Before working at the hospital, Beth was given a Mantoux skin test to detect tuberculosis. If it were positive, the site of the test would become hardened and red. What type of response is this?

Answers

The options are missing from the question,the missing options are;

a. Anaphylactic

b. Histamine

c. Immediate allergic

d. Delayed allergic

e. B-cell mediated.

The correct answer to the question is option D

DELAYED ALLERGIC.

Delayed allergic response is a type of late response to antigen that occurs 48-72hours after exposure to an antigen.

This type of allergic response is mediated by T-cells and macrophages.

They are otherwise known as delayed hypersensitivity response/reaction.

The response is delayed because there is sensitization upon first exposure to the antigen, therefore if there is a re-exposure,a secondary cellular response is initiated triggering the actions of the already sensitized T-cells and macrophages.

what is a warning safety sign​

Answers

Answer:

Hey there!

A warning safety sign is a sign that warns you that there may be a safety hazard around you.

Let me know if this helps :)

please give the correct answer to this question​

Answers

Answer: Lymphatic system

Explanation:

Not respiratory and excretory for sure.

Not nervous because the diagram doesn't show spinal nerves clearly. So its lymphatic system.

:-)

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

Select all that apply.
Which conditions relate to the research of van Helmont?
plant mass related only to soil
conclusions partly correct
demonstrated plant food from soil
conducted around 1400 AD.
plant mass related to H 20

Answers

Answer:

I'd say the best Answer is A & C

Explanation:

Glycolysis and gluconeogenesis are opposing pathways in that they begin or end with the same metabolites and share common intermediates and/or enzymes. Yet, for energetic reasons, the two processes cannot be the exact reverse of each other. How is this possible

Answers

Answer:

Due to difference in their products.

Explanation:

Glycolysis and gluconeogenesis are not exact reverse to each other because in glycolysis, glucose is converted into pyruvate, adenosine triphosphate (ATP), NADH, protons i.e. hydrogen ions and water whereas in gluconeogenesis, pyruvate is converted into glucose and glycogen. So due to  the formation of different products of each process we can say that glycolysis is not exact reverse of gluconeogenesis.

Plz help me ASAP TwT

Answers

Answer:

Response

Explanation:

It is response because your pupils are responding to the light flashing in your eyes and therefore they get smaller.

Hope this helps :)

Answer:

Response

Explanation:

We can use process of elimination. Reproduction does not fit in this context--nothing is reproducing. Nothing is growing, either. Development usually refers to when an organism develops, which doesn't fit this context either. Response is the only one that fits--your pupils are responding to the sudden light.

where are genes located in a prokaryotes cell?

Answers

Vas happenin!
Hope your day is good well or night

In the nucleus

Hope this helps *smiles*

An ecologist samples the abundance of various species along an environmental gradient and fails to find clusters of species. Instead, peaks of abundance of dominant species are merely randomly spaced segments along a continuum. This distribution of species supports the

Answers

Answer:

This distribution of species supports Gleason´s Individualistic concept of a community.

Explanation:

This theory was proposed by Gleason and it states that plant species respond individually to environmental factors that continuously change at spatial and temporal levels. This means that the combination and distribution of plants in a certain point or area are unique because each vegetable species has a different distribution pattern and a different tolerance and abundance rate. Hence each species´ response curve to a certain gradient has its own shape and size and it different from other species curves.  

Plants assembly growing in an area is the result of environmental conditions and migration rate of species. As every area is continuously getting propagules of different species, the survival success of each plant depends not only in environmental factors, but also depends on the tolerance to other new species and their interactions. This combination along a gradient always results in different composition and abundance of species. This is why a sample can not be confined to a clearly defined vegetable community.

This point of view is known as individualistic or continuum concept of vegetable community. Gleason believed that vegetable species were distributed as a continuum and that communities can not be identified as combinations of associated species that repeat in space.

john is testing the effect of temperature on the solubility of sugar in water

Answers

Answer:

As John is testing the effect of temperature on the solubility of sugar in water. To test this, he will measure the amount of sugar dissolved at different temperature level.

1. Viruses such as avian (bird) flu and swine flu that mutate and can spread from animals to human populations are known as what?
O A. Vectors
O B. Transmuting viruses
O C. Epidemics
O D. Zoonoses

Answers

Answer:

B

Explanation:

they are transmuting viruses

B. Transmuting viruses is the answer

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

Which of the following is NOT an organ system in the human body?
A. Endocrine system
B. Replicatory system
C. Digestive system
D. Lymphatic system

Answers

B. The replicatory system is not a organ sytem in the human body.

Help!!!
I'll give brainliest the brainliest. ​

Answers

Answer:

resists the turgor  pressure of the cell:  A : cell wall

controls the activities of  the cell : C : nucleus

site of the chemical  reactions of the cell  including synthesis of  proteins:  D : cytoplasm

Answer:

1. A -  Cell Wall

2. C - Nucleus

3. B. Mitochondria

Give brainliest

1. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. A phylogenetic tree containing two main branches for evolutionary relationships among the animals.
B. The first branch leads to Drosophila.
C. The second branch divides into two branches, 2a and 2b. Branch 2a leads to Lancelet.
D. Branch 2b divides into two branches: 3a and 3b. Branch 3a leads to Zebrafish.
E. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Frog.
F. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Chicken.
G. Branch 5b divides into two branches leading to Human and Mouse, respectively.
2. This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.
A. The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.
B. The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.
C. A frog is the ancestor of both a mouse and a chicken.

Answers

The figure shows a tree diagram with two main branches. The first branch leads to Drosophila. The second branch divides into two branches 3a and 3b. Branch 3a leads to Lancelet. Branch 3b divides into two branches: 4a and 4b. Branch 4a leads to Zebrafish. Branch 4b divides into two branches: 5a and 5b. Branch 5a leads to Frog. Branch 5b divides into two branches: 6a and 6b. Branch 6a leads to Chicken. Branch 6b divides into two branches leading to Human and Mouse, respectively.

This phylogenetic tree was constructed by comparing sequences for a homologous gene involved in development. Select the correct statement.

The nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

A frog is the ancestor of both a mouse and a chicken.

The common ancestor of a human and a frog and the common ancestor of a mouse and a chicken lived at the same time.

Answer:

The answer is below

Explanation:

Given the information above, and from the available pictures which showed the detailed analysis of the information presented in the question. It can be concluded that, the nucleotide sequence of this gene in a mouse is more similar to the sequence in a chicken, and both are less similar to the nucleotide sequence of this gene in a frog.

Hence, the right answer is option B.

A molecule will become an ion when which of the following happens?

Answers

Loses or gains a charge

why is it necessary yo separate oxgynated and deoxgynated blood in livng oranisum

Answers

Explanation:

it is necessary in mammals and birds to separate oxygenated and deoxygenated blood because this makes their circulatory system more efficient and helps in maintaining a constant body temperature

Other Questions
Place the 4 steps of biofilm formation, listed below, in the correct order. 1. Surface (substratum) is preconditioned by environmental molecules.2. Quorum sensing and the establishment of the extracellular matrix commences as microbes attach more stably.3. Biofilm matures and some microorganisms escape to the planktonic state.4. Microbes attach and detach from the preconditioned surface. ***50 POINTS*** Type out what is on the pictures. What is the length of AC Which expression has the same value as 4x 3y?O 3y - 4x0 -3y - 40Submit Answer4x + 3y)0-4x + (-3y)POP Telecoo Can someone plz help me :< a cake recipe calls for 4 1/2 cups of sugar. a caterer has 50 1/2 cups of sugar on hand. how many cakes can he make? ASAP!!!!!!!!!!What is the line of symmetry for the graph of y = -3x^2 + 12x - 11?wrong= reportedty Hola! Mi nombre es Eloisa y soy ecuatoriana, pero vivo en Miami, Florida. Mi familia y yo estuvimos de vacaciones en un parque nacional de los Glaciares en Estados Unidos. El parque nacional de los Glaciares tiene 25 glaciares; en el ao 1850 este parque tena 150 glaciares. La geografa del parque nacional de los Glaciares en Montana tiene montaas grandes, lagos hermosos, reas llanas con muchas rocas y glaciares muy bonitos. What can Eloisa do to better understand the issue facing Glacier National Park in the text above? Learn about the origin of the local food. Research the reason for the declining natural resource. Speak about the influence of prior inhabitants. Volunteer to clean up local rivers and beaches. Palo DuroSome places simply warrant more attention. One of the most illustrious sites in the world is known by very few except regular adventure-goers. Travelers are awed by Palo Duro Canyon as its deep, red landscape appears seemingly out of nowhere. The canyon, similar in length to the Grand Canyon in Arizona, has scenic views just as glorious as those of the more famous canyon. At night, coyotes can be heard in the distance as the high winds gust through the valley, echoing the howls off the steep canyon walls. During the day, the hateful sun heats up every visible crevice, providing a contrast to the cool, breezy nights. The favorable aspect of the day is its gift of sight, of the stunning erosion that has taken place over millions of years, or of the rocks impossibly balanced on one another and their relentless determination to remain unmoved. This place and its striking diversity deserve recognition for doing exactly what nature does best: providing wonder to all. Drag each tile to the correct box.Match each key idea from the text to how it is emphasized in the image.the stunning erosion that has takenplace over millions of yearsthe steep canyon wallsIts deep, red landscape appearsseemingly out of nowhere.The image shows layers of rock.The image shows the height of the canyon.The image highlights the canyons colors. Where do the convection currents of the magma happen? In the crust and the atmosphere?In the crust and core?In the mantle and core?In the mantle and crust? What are Adjectives. Quick Lone Wolf Technologies Inc. assembles circuit boards by using a manually operated machine to insert electronic components. The original cost of the machine is $60,400, the accumulated depreciation is $24,200, its remaining useful life is five years, and its residual value is zero. A proposal was made to replace the present manufacturing procedure with a fully automatic machine that will cost $113,800. The automatic machine has an estimated useful life of five years and no significant residual value. For use in evaluating the proposal, the accountant accumulated the following annual data on current and proposed operations: Current Operations Proposed OperationsSales $191,500 $191,500 Direct materials $65,200 $65,200 Direct labor 45,300 15,100 Power and maintenance 4,200 7,200 Taxes, insurance, etc. 1,500 5,000 Selling and administrative expenses 45,300 45,300 Total expenses $161,500 $137,800Required:Prepare a differential analysis report for the proposal to replace the machine. Include in the analysis both the net differential change in costs anticipated over the five years and the net annual differential change in costs anticipated. Which of the following pairs of compounds have the same empirical formula?a. acetylene, C2H2, and benzene, C6H6b. ethane, C2H6, and butane, C4H10c. nitrogen dioxide, NO2, and dinitrogen tetroxide, N2O4d. diphenyl ether, C12H10O, and phenol, C6H5OH 5. The speed of a transverse wave on a string is 170 m/s when the string tension is 120 ????. To what value must the tension be changed to raise the wave speed to 180 m/s? what is x+2/-1 = 3? i need to know Considering the various rejections of the modern made by postmodernism "The Postmodern Condition," how does postmodernism affect you personally? Do you think any of those conditions of postmodern existence are true and in play in your life? How so? Be specific and use as much detail as possible to explain your position. Sam weighed his dog. He rounded the weight to the nearest tenth of a pound to get 18.6 pounds. Which could have been the actual weight of Sam's dog? g To decrease the intensity of the sound you are hearing from your speaker system by a factor of 36, you can Entries for Stock DividendsHealthy Life Co. is an HMO for businesses in the Fresno area. The following account balances appear on Healthy Lifes balance sheet: Common stock (3,000,000 shares authorized; 2,200,000 shares issued), $15 par, $33,000,000; Paid-in capital in excess of parcommon stock, $9,000,000; and Retained earnings, $89,550,000. The board of directors declared a 5% stock dividend when the market price of the stock was $18 a share. Healthy Life reported no income or loss for the current year.For a compound transaction, if an amount box does not require an entry, leave it blank. If no entry is required, select "No entry required" from the dropdown.a1. Journalize the entry to record the declaration of the dividend, capitalizing an amount equal to market value.Stock Dividends Stock Dividends Distributable Paid-In Capital in Excess of Par-Common Stock FeedbackRecall that a stock dividend affects only stockholders' equity.Learning Objective 3.a2. Journalize the entry to record the issuance of the stock certificates.Stock Dividends Distributable Common Stock FeedbackWhat is the company giving to the stockholders?Learning Objective 3.b. Determine the following amounts before the stock dividend was declared: (1) total paid-in capital, (2) total retained earnings, and (3) total stockholders' equity.Total paid-in capital $Total retained earnings $Total stockholders' equity $c. Determine the following amounts after the stock dividend was declared and closing entries were recorded at the end of the year: (1) total paid-in capital, (2) total retained earnings, and (3) total stockholders' equity.Total paid-in capital $Total retained earnings $Total stockholders' equity $ I REALLY NEED HELP ASAP WITH THESE 2 QUESTIONS!!!!!!!!!