A small publishing company is planning to publish a new book. The production costs will include one-time fixed costs (such as editing) and variable costs (such as printing). The one-time fixed costs will total $ 63,042 . The variable costs will be $ 11.25 per book. The publisher will sell the finished product to bookstores at a price of $ 25.50 per book. How many books must the publisher produce and sell so that the production costs will equal the money from sales?

Answers

Answer 1

Answer:

  4424 books

Step-by-step explanation:

After the revenue from each book pays for its own cost, it can contribute to the payment of the fixed costs. That "contribution margin" is ...

  $25.50 -11.25 = $14.25

If each book sold contributes that much to the recovery of fixed costs, then the total number of books that must be sold to break even is ...

  $63,042/($14.25/book) = 4424 books

4424 books must be produced and sold so production costs equal sales.


Related Questions

Please answer asap this person made a mistake what is the error and correct solution to this problem

Answers

Answer:

6

Step-by-step explanation:

Hello, please consider the following.

[tex](4+x)^2=4^2+2\cdot 4\cdot x+x^2=16+\boxed{8}x+x^2\\\\\text{ ... and not ...}\\\\16+\boxed{4}x+x^2[/tex]

So the correct equation becomes.

[tex]x^2+64=16+8x+x^2\\\\8x=64-16=48\\\\\text{ we divide by 8 both sides of the equation.}\\\\x=\dfrac{45}{8}=6[/tex]

Hope this helps.

Do not hesitate if you need further explanation.

Thank you

Answer:

Error : The expression ( 4 + x )² was expanded incorrectly.

Correct Solution : x = 6

Step-by-step explanation:

The planning of the solution is correct, by Pythagorean Theorem you can say that PQ² + QO² = PO², and hence through substitution x² + 8² = ( 4 + x )². Let's look into the calculations.

PQ² + QO² = PO²,

x² + 8² = ( 4 + x )²,

x² + 8² = 16 + 8x + x²,

64 = 16 + 8x,

48 = 8x,

x = 48 / 8 = 6, x = 6

As you can see, the only error in the calculations was expanding the expression ( 4 + x )². ( 4 + x )² = 4² + 2 [tex]*[/tex] 4 [tex]*[/tex] x + x² = 4² + 8x + x² = 16 + 8x + x², not 16 + 4x + x².

)Patrick buys some bananas for 35%. He sells all the bananas for $40.60. Calculate profit
percentage. Show your working.

Answers

Answer:

40.60-35=5.6

Step-by-step explanation:

Profit is cost minus the amount you sold it for

g natasha is in a class of 30 students that selects 4 leaders. How many ways are there to select the 4 leaders so that natasha is one of the leaders

Answers

Answer:

3,654 different ways.

Step-by-step explanation:

If there are 30 students in a class with natasha in the class and natasha is to select four leaders in the class of which she is already part of the selection, this means there are 3 more leaders needed to be selected among the remaining 29 students (natasha being an exception).

Using the combination formula since we are selecting and combination has to do with selection, If r object are to selected from n pool of objects, this can be done in nCr number of ways.

nCr = n!/(n-r)!r!

Sinca natasha is to select 3 more leaders from the remaining 29students, this can be done in 29C3 number of ways.

29C3 = 29!/(29-3)!3!

29C3 = 29!/(26!)!3!

29C3 = 29*28*27*26!/26!3*2

29C3 = 29*28*27/6

29C3 = 3,654 different ways.

This means that there are 3,654 different ways to select the 4 leaders so that natasha is one of the leaders

The probability distribution of number of televisions per household in a small town is given below.

x 0 1 2 3
​P(x) ​ 0.05 0.15 0.25 0.55


a. Find the probability of randomly selecting a household that has one or two televisions.
b. Find probability of randomly selecting a household that has one or two televisions

Answers

Answer: 0.20

Step-by-step explanation:

The given probability distribution of number of televisions per household in a small town:

x          0       1     2      3

​P(x) ​ 0.05 0.15 0.25 0.55

To find : The probability of randomly selecting a household that has one or two televisions ( in both parts a. and b.).

The computations for this would be :

P( 1 or 2) = P(1)+P(2)

= 0.05+0.15

= 0.20

Hence, the required probability= 0.20

Answer:

Step-by-step explanation:

A study was conducted by a research center. It reported that most shoppers have a specific spending limit in place while shopping online. The reports indicate that men spend an average of $240 online before they decide to visit a store. If the spending limit is normally distributed and the standard deviation is $20.
A. Find the probability that a male spent less than $210 online before deciding to visit a store.
B. Find the probability that a male spent between $270 and $300 online before deciding to visit a store.
C. Ninety percent of the amounts spent online by a male before deciding to visit a store are less than what value?

Answers

Answer:

(A) The probability that a male spent less than $210 online before deciding to visit a store is 0.0668.

(B) The probability that a male spent between $270 and $300 online before deciding to visit a store is 0.0655.

(C) Ninety percent of the amounts spent online by a male before deciding to visit a store is less than $265.632.

Step-by-step explanation:

We are given that the reports indicate that men spend an average of $240 online before they decide to visit a store. If the spending limit is normally distributed and the standard deviation is $20.

Let X = the spending limit

The z-score probability distribution for the normal distribution is given by;

                           Z  =  [tex]\frac{X-\mu}{\sigma}[/tex]  ~ N(0,1)

where, [tex]\mu[/tex] = mean spending limit = $240

           [tex]\sigma[/tex] = standard deviation = $20

So, X ~ Normal([tex]\mu=\$240,\sigma^{2} =\$20^{2}[/tex])

(A) The probability that a male spent less than $210 online before deciding to visit a store is given by = P(X < $210)

     P(X < $210) = P( [tex]\frac{X-\mu}{\sigma}[/tex] < [tex]\frac{\$210-\$240}{\$20}[/tex] ) = P(Z < -1.50) = 1 - P(Z [tex]\leq[/tex] 1.50)

                                                            = 1 - 0.9332 = 0.0668

The above probability is calculated by looking at the value of x = 1.50 in the z table which has an area of 0.9332.

(B) The probability that a male spent between $270 and $300 online before deciding to visit a store is given by = P($270 < X < $300)

     P($270 < X < $300) = P(X < $300) - P(X [tex]\leq[/tex] $270)

     P(X < $300) = P( [tex]\frac{X-\mu}{\sigma}[/tex] < [tex]\frac{\$300-\$240}{\$20}[/tex] ) = P(Z < 3) = 0.9987

     P(X [tex]\leq[/tex] $270) = P( [tex]\frac{X-\mu}{\sigma}[/tex] [tex]\leq[/tex] [tex]\frac{\$270-\$240}{\$20}[/tex] ) = P(Z [tex]\leq[/tex] 1.50) = 0.9332

The above probability is calculated by looking at the value of x = 3 and x = 1.50 in the z table which has an area of 0.9987 and 0.9332 respectively.

Therefore, P($270 < X < $300) = 0.9987 - 0.9332 = 0.0655.

(C) Now, we have to find ninety percent of the amounts spent online by a male before deciding to visit a store is less than what value, that is;

         P(X < x) = 0.90     {where x is the required value}

         P( [tex]\frac{X-\mu}{\sigma}[/tex] < [tex]\frac{x-\$240}{\$20}[/tex] ) = 0.90

         P(Z < [tex]\frac{x-\$240}{\$20}[/tex] ) = 0.90

In the z table, the critical value of z that represents the bottom 90% of the area is given as 1.2816, i.e;

                     [tex]\frac{x-\$240}{\$20}=1.2816[/tex]

                     [tex]x-240=1.2816\times 20[/tex]

                     [tex]x=240 + 25.632[/tex]

                     x = 265.632

Hence, Ninety percent of the amounts spent online by a male before deciding to visit a store is less than $265.632.

a swift can fly at 160km/h. what is the speed in m/s? show clearly how you worked out your answer.

Answers

Answer:

[tex]\huge\boxed{\sf Speed = 44.44 \ m/s}[/tex]

Step-by-step explanation:

Speed = 160 km / hr

To convert km/hr to m/s, we multiply it by [tex]\sf \frac{10}{36}[/tex]

Hence,

[tex]\displaystyle Speed = 160 \times \frac{10}{36} \ m/s\\\\Speed = \frac{1600}{36} \ m/s\\\\Speed = 44.44 \ m/s\\\\\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807Peace!

Find the length of AB¯¯¯¯¯¯¯¯ A. 19.56 B. 51.86 C. 42.99 D. 34.98

Answers

Answer:

Apllying cos on the triangle

cos(angle)= Base/ Hyp

cos(34)= 29/ AB

AB= 29/0.8290

AB=34.98

Step-by-step explanation:

The length of AB is 34.98 units which the correct answer would be an option (D).

What is the right triangle?

A right triangle is defined as a triangle in which one angle is a right angle or two sides are perpendicular.

What are Trigonometric functions?

Trigonometric functions are defined as the functions which show the relationship between the angle and sides of a right-angled triangle.

Given that ΔABC

∠C = 90°

Here base = BC = 29 units and hypotenuse = AB

To determine the length of AB

Apply the cosine on the given right triangle

⇒ cos(θ) = Base/hypotenuse

⇒ cos(34) = 29/ AB

∴ cos(34°) = 0.8290

⇒ 0.8290 = 29/ AB

⇒ AB= 29/0.8290

⇒ AB = 34.98 units

Hence, the length of AB is  34.98 units

Learn more about Trigonometric functions here:

https://brainly.com/question/6904750

#SPJ2

There are 13 members on a board of directors. If they must form a subcommittee of 4 members, how many different subcommittees are possible?

Answers

Answer:

9

Step-by-step explanation:

13-4=9

what are the next terms in the number pattern -11, -8, -5, -2, 1

Answers

Answer:

4, 7, 10, 13

Step-by-step explanation:

Hey there!

Well in the given pattern,

-11, -8, -5, -2, 1

we can conclude that the pattern is +3 every time.

-11 + 3 = -8

-8 + 3 = -5

-5 + 3 = -2

-2 + 3 = 1

And so on

4, 7, 10, 13

Hope this helps :)

6. If the equations kx - y = 2 and 6x - 2y = 3 have a solution then state the value of k a) K = 3 b) k 3 c ) K 0 d) k = 0 7.

Answers

Answer:

k ≠ 3

Step-by-step explanation:

Given the system of equation;

kx - y = 2 ------------------- 1

6x - 2y = 3 -------------------- 2

Rewriting the equations in the format ax+by+c = 0

Equation 1 becomes kx - y - 2 = 0

Equation 2 becomes 6x - 2y - 3 = 0

where a₁ = k, b₁ = -1 and c₁ = -2  and a₂ = 6, b₂ = -2 and c₂ = -3

For the system of equation to have a unique solution the following must be true;

a₁/a₂ ≠ b₁/b₁

Substituting the coefficients into the condition, we will have;

k/6 ≠ -1/-2

k/6 ≠ 1/2

Cross multiplying we will have;

2k ≠ 6

k ≠ 6/2

k ≠ 3

This means that k can be any other real values except 3 for the system of equation to have a unique solution.

NEED HELP ASAP


Which point represents the center of the circle shown below?

Answers

Answer:

Point O represents the center of the circle

Step-by-step explanation:

HOPE IT HELPS. PLEASE MARK IT AS BRAINLIEST

Answer: Point O

Explanation:

Point O is in the middle of the circle

And other point are not in the middle

Based on experience, the Ball Corporation’s aluminum can manufacturing facility in Ft. Atkinson, Wisconsin, knows that the metal thickness of incoming shipments has a mean of 0.2771 mm with a standard deviation of 0.000855 mm.


(a) A certain shipment has a diameter of 0.2742. Find the standardized z-score for this shipment. (Round your answer to 3 decimal places.)


z



(b) Is this an outlier?


Yes

No

Answers

Answer:

(a) The standardized z-score for this shipment is -3.392.

(b) Yes, this an outlier.

Step-by-step explanation:

We are given that the Ball Corporation’s aluminum can manufacturing facility in Ft. Atkinson, Wisconsin, knows that the metal thickness of incoming shipments has a mean of 0.2771 mm with a standard deviation of 0.000855 mm.

Let X = the metal thickness of incoming shipments.

The z-score probability distribution for the normal distribution is given by;

                              Z  =  [tex]\frac{X-\mu}{\sigma}[/tex]  ~ N(0,1)

where, [tex]\mu[/tex] = mean thickness = 0.2771 mm

           [tex]\sigma[/tex] = standard deviation = 0.000855 mm

(a) Now, it is given that a certain shipment has a diameter of 0.2742 mm and we have to find the standardized z-score for this shipment.

So, z-score  =  [tex]\frac{X-\mu}{\sigma}[/tex]

                   =  [tex]\frac{0.2742-0.2771}{0.000855}[/tex]  = -3.392

Hence, the standardized z-score for this shipment is -3.392.

(b) Yes, we can consider this as an outlier because the standardized z-score is very large and this value is far from the population mean.

Simplify the following expression. 12a + 2a

Answers

Answer:

[tex]14a[/tex]

Step-by-step explanation:

Combining like-terms gives us [tex]12a+2a=14a[/tex]

Hope this helped!

Answer:

14a

Step-by-step explanation:

Find the distance between the points (-4, -2) and (-8, 6)

Answers

Answer:

distance=√[(x2-x1)²+(y2-y1)²]

√[{6-(-2)}²+ (-8-(-4))²]

√(64+16)

√[100]

10

Points given

(-4,-2)(-8,-6)

Distance:-

[tex]\\ \sf \longmapsto \sqrt{(x_2-x_1)^2+(y_2-y_1)^2}[/tex]

[tex]\\ \sf \longmapsto \sqrt{(-8+4)^2+(6+2)^2}[/tex]

[tex]\\ \sf \longmapsto \sqrt{(-4)^2+(8)^2}[/tex]

[tex]\\ \sf \longmapsto \sqrt{64+16}[/tex]

[tex]\\ \sf \longmapsto \sqrt{80}[/tex]

[tex]\\ \sf \longmapsto 8.4[/tex]

Given the following situation:
A cell phone company offers a data package by charging $20 a month plus $12 per gigabyte of data used. Write a linear equation
that relates the cost C, in dollars, to the amount of data used. Use it to determine the amount of data used if they charge you
$116.

Answers

9514 1404 393

Answer:

C = 20 +12g8 gigabytes

Step-by-step explanation:

At $12 per gigabyte, the data charge will be 12g where g is the number of gigabytes. Then the total charge is ...

  C = 12g +20

__

If C = 116, the value of g is found from ...

  116 = 12g +20

  96 = 12g . . . . . . . subtract 20

  8 = g . . . . . . . . . . divide by 12

The amount of data used is 8 gigabytes if the charge is $116.

Commute times in the U.S. are heavily skewed to the right. We select a random sample of 45 people from the 2000 U.S. Census who reported a non-zero commute time. In this sample the mean commute time is 25.2 minutes with a standard deviation of 19.1 minutes. Required:a. Can we conclude from this data that the mean commute time in the U.S. is less than half an hour?b. Conduct a hypothesis test at the 5% level of significance. c. What is the p-value for this hypothesis test?

Answers

Answer:

The mean commute time in the U.S. is less than half an hour.

Step-by-step explanation:

In this case we need to test whether the mean commute time in the U.S. is less than half an hour.

The information provided is:

 [tex]n=45\\\bar x=25.5\\s=19.1\\\alpha =0.05[/tex]

(a)

The hypothesis for the test can be defined as follows:

H₀: The mean commute time in the U.S. is not less than half an hour, i.e. μ ≥ 30.

Hₐ: The mean commute time in the U.S. is less than half an hour, i.e. μ < 30.

(b)

As the population standard deviation is not known we will use a t-test for single mean.

Compute the test statistic value as follows:

 [tex]t=\frac{\bar x-\mu}{s/\sqrt{n}}=\frac{25.2-30}{19.1/\sqrt{45}}=-1.58[/tex]

Thus, the test statistic value is -1.58.

(c)

Compute the p-value of the test as follows:

[tex]p-value=P(t_{(n-1)}<-1.58)=P(t_{(45-1)}<-1.58)=0.061[/tex]  

*Use a t-table.

The p-value of the test is 0.061.

Decision rule:

If the p-value of the test is less than the significance level then the null hypothesis will be rejected and vice-versa.

p-value = 0.061> α = 0.05

The null hypothesis will not be rejected at 5% level of significance.

Thus, concluding that the mean commute time in the U.S. is less than half an hour.

through: (3, - 3); slope = 2/3

Answers

Answer:

y=2/3x - 5

Step-by-step explanation:

Since we have the slope and a point, we can make an equation in point intercept form (y=mc+b) by using the point slope form formula (y-y1)=m(x-x1), where (x1,y1) is the point you plug in.

(y-y1)=m(x-x1)

m=2/3

y1=-3

x1=3

y- -3=2/3(x-3)

y+3=2/3(x-3)

Distribute 2/3 with (x-3) by multiplying

y+3=2/3x - 2

Subtract 3 from both sides

y=2/3x - 5

Can someone help I would really appreciate

Answers

Answer:

18/a

Step-by-step explanation:

quotient means divide

18/a

How many different sets of polar coordinates can be given for a point, within one rotation? I thought it was infinite, but the given options are 1, 2, 3, and 4.

Answers

Answer:

the answer is 4

Step-by-step explanation:

so 1 rotation is like a circle 1 unit circle requires 4 quadrant to be in this is the most simplified i can get

Answer:

Solution : 4

Step-by-step explanation:

The question asks us how many polar coordinates are possible for one rotation. For one rotation there will be 4 polar coordinates, one present in each quadrant such that,

( r, theta ), ( r, theta ), ( - r, theta ), ( - r, theta )

Respectively if theta was q say,

( r, q ), ( r, - q ), ( - r, q ), ( - r, -q )

Therefore there are 4 sets of polar coordinates for one rotation, in each of the 4 quadrants.

In a genetics experiment on peas, one sample of offspring contained green peas and yellow peas. Based on those results, estimate the probability of getting an offspring pea that is green. Is the result reasonably close to the value of that was expected? 350 127 3 4 The probability of getting a green pea is approximately . (Type an integer or decimal rounded to three decimal places as needed.) Is this probability reasonably close to ? Choose the correct answer below. 3 4 A. No, it is not reasonably close. B. Yes, it is reasonably close.

Answers

Complete Question

In a genetic experiment on peas, one sample of offspring contained 436 green peas and 171 yellow peas. Based on those results, estimate the probability of getting an offspring pea that is green. Is the result reasonably close to the value of 3/4 that was expected? The probability of getting a green pea is approximately: Is the probability reasonably close to 3/4?

Answer:

The  probability is  [tex]P(g) =0.72[/tex]

Yes the result is reasonably close

Step-by-step explanation:

From the question we are told that

   The  number of  of  green peas is  [tex]g = 436[/tex]

     The number of yellow peas is  [tex]y = 171[/tex]

   The sample size is  [tex]n = 171 + 436 = 607[/tex]

The probability of getting an offspring pea that is green is mathematically represented as

       [tex]P(g) = \frac{g}{n}[/tex]

        [tex]P(g) = \frac{436}{607}[/tex]

        [tex]P(g) =0.72[/tex]

Comparing  [tex]P(g) =0.72[/tex]  to   [tex]\frac{3}{4} = 0.75[/tex] we see that the result is reasonably close


Which expression is equivalent to -80?
O -4.5
O-4.5
O 4/5
O 4.5

Answers

Answer:

-4/5

Step-by-step explanation:

When you divide -4 from 5 you get -0.80

To which set of numbers does the number sqr rt-16 belong? Select all that apply

Answers

Answer:

The square root of -16 is an imaginary number and a complex number. Sqrt(-16)=4i. We use the i to indicate that the number is imaginary since there is no number that can be multiplied by itself to get a negative number (a negative times a negative is a positive, and a positive times a positive is also a positive). So the use of i tells you immediately that it's an imaginary number. You can tell the number is complex because it has both a real and an imaginary part and could be written in the form a+bi, where a is a real number and bi is an imaginary number. In this specific case, the real part (a) is 0 and the imaginary part (bi) is 4i.

Step-by-step explanation:

Help please, i really need the answer asap.

Answers

Answer: Bottom right corner

The larger metallic object is initially at rest, so the velocity is 0 when t = 0. The speed changes after t = 3 seconds.

Answer:

It would be the last one.

Step-by-step explanation:

It says the object is initially at rest, so you look for a table with 0 m/s and you find the last table had been at rest for 0 -2  seconds. The small rocky object initially had a speed of 90 m/s and then decreased to 36 m/s as its energy transferred to the metallic object. The metallic object's speed from time 4-6s with the small rocky object equals the small rocky initial speed.

Rocky Object initial speed = 90 m/s

Rocky Object new speed = 36 m/s

Large metallic object speed after collision = 64 m/s.

64 m/s + 36 m/s = 90 m/s

Large metallic object speed after collision + Rocky Object new speed

= Rocky Object initial speed

You can also test this for kinetic energy.

Find the equation with the given slope through the given point. Write the equation in the given form AX+BY=C m=1/9 (-6,2)

Answers

Answer:

x - 3y = 12

Step-by-step explanation:

Find the point-slope form of this equation and then convert the point-slope form into standard form (ax + by = c):

y - k = m(x - h) becomes y - 2 = (1/9)(x + 6).

Multiplying all three terms by 9 removes the fraction:

3y - 6 = x + 6, or x - 3y = 12

If Q(x)=x2−6x−2, find Q(−4).

Answers

Answer:

Q(-4) = 38

Step-by-step explanation:

Q(x)=x² − 6x − 2

To find Q(−4) substitute the value of x which is - 4 into Q(x)

That's

Q(-4) = (-4)² - 6(-4) - 2

Q(-4) = 16 + 24 - 2

We have the final answer as

Q(-4) = 38

Hope this helps you

what is 92 Times 37

Answers

Answer:

3404

Step-by-step explanation:

92 x 37 = 3404

2. (1 pt) The following statement is true or false;
When we know the population standard deviation, o, we use a standard normal
distribution (z-score) to calculate the error bound EBM and construct the
confidence interval and when the population standard deviation, o, is unknown,
we use a Student's t distribution (t-score) to calculate the error bound EBM and
construct the confidence interval.
a. true
b. false​

Answers

Answer: True

If you know the population standard deviation (sigma), then you use the Z distribution. If sigma is not known, then you use the T distribution.

Side note: Even if sigma is not known, you could use the Z distribution if the sample size n is greater than 30. If n > 30, then the T distribution is approximately about the same as the Z distribution.

The lines shown below are parallel. If the green line has a slope of -2, what is the slope of the red line?



A.
2

B.
-2

C.


D.
-

Answers

Answer:

the slope of the read line is also -2

Step-by-step explanation:

A lab technician needs 35 ml of 15% base solution for a certain experiment,
but she has only 10% solution and 20% solution. How many milliliters of
the 10% and the 20% solutions should she mix to get what she needs?

Answers

Answer:

17.5ml- of 10 percent solution, 17.5ml- of 20 percent solution

Step-by-step explanation:

35:100*15=5.25- ml of alkali in the base solution

Suppose we need x ml of 10 percents solution and 35-x - of 20 percents.

Then The quantity of alkali in the first one (10 percents) is x/100*10=0.1x

when in the second one we have (35-x)/100*20= 7-0.2x of alkali

0.1x+7-0.2x=5.25

7-0.1x= 5.25

0.1x=1.75

x=17.5- 0f 10 percents

35-17.5=17.5 - of 20 percents

Dia is 10 years old. How many years have to add with twice of her age to get 24? ​

Answers

Answer:

4

Step-by-step explanation:

twice her age:

10*2 = 20

24-20 = 4

Answer:

4 i believe that's the answer

Other Questions
A horizontal spring with spring constant 85 N/m extends outward from a wall just above floor level. A 2.5 kg box sliding across a frictionless floor hits the end of the spring and compresses it 6.5 cm before the spring expands and shoots the box back out. How fast was the box going when it hit the spring Rearrange the equation so x is the independent variable. y+6=5(x-4) The following unadjusted trial balance is prepared at fiscal year-end for Nelson Company. 1.NELSON COMPANY Debit Credit2. Cash $1,000 3. Merchandise Inventory 12,500 4. Store supplies. 5,800 5. Prepaid Insurance. 2,400 6. Store equipment. 42,900 7. Accumulated depreciation - Store equipment $15,2508. Accounts payable 10,0009.J. Nelson, Capital 32,00010.J. Nelson, Withdrawal 2,200 11. Sales. 111,95012. Sales discounts 2,000 13. Sales returns and allowances 2,200 14. Cost of goods sold 38,400 15. Depreciation expense- Store equipmen 0 16. Salaries expense 35,000 17. Insurance expense 0 18. Rent expense 15,000 19. Store supplies expense 0 20. Advertising expense 9,800 21. Totals $169,200 169,200Nelson company uses a perpetual inventory system. It categorizes the following accounts as selling expenses: Required:1. Prepare adjusting journal entries to reflect each of the following:a. Store supplies still available at fiscal year-end amount to $1,750.b. Expired insurance, an administrative expense, for the fiscal year is $1,400.c. Depreciation expense on store equipment, a selling expense is $1,525 for the fiscal year.d. To estimate shrinkage, a physical count of ending merchandise inventory is taken. It shows $10,900 of inventory is still available at fiscal year-end.2. Prepare a multiple-step income statement for fiscal year 2015.3. Comple the statement of retained earnings and the balance sheet.4. Compute the current ratio, acid-test ratio, and gross margin ratio as of January 31, 2015. (Round ratios to two decimals.) What part of the brain is known as the pleasure center?A. Brain stemB. HypothalamusC. ThalamusD. MidbrainSUBMIT A sprinkler system is being installed in a newly renovated building on campus. The average activation time is supposed to be at most 20 seconds. A series of 12 fire alarm/sprinkler system tests results in an average activation time of 21.5 seconds. Do these data indicate that the design specifications have not been met? The hypotheses to be tested are H0: m = 20 versus Ha: m > 20, where m = the true average activation time of the sprinkler system. Assume that activation times for this system are Normally distributed with s = 3 seconds. (a) What is the value of the observed test statistic? (b) What is the value of the P-value? (c) Are the data statistically significant at the 5% significance level? Explain briefly. (d) What does the decision you made mean with respect to the question "Do these data indicate that the design specifications have not been met?" (e) If the true average activation time of the sprinkler system is, in fact, equal to 20 seconds, what type of error would you have made? [09.01]Identify the domain of the equation y=x2 - 6x + 1. (1 point) You are in charge of paying claims submitted by providers. You notice a certain diagnostic provider ("Doe Diagnostics") requested a substantial payment for a large number of members. Many of these claims are for a certain procedure. You review the same type of procedure for other diagnostic providers and realize Doe Diagnostics' claims far exceed any other provider you reviewed. What should you do? Morganton Company makes one product and it provided the following information to help prepare the master budget:The budgeted selling price per unit is $70. Budgeted unit sales for June, July, August, and September are 8,500, 16,000, 18,000, and 19,000 units What is the accounts receivable balance at the end of July? Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number the water is.......... Assume that a randomly selected subject is given a bone density test. Those test scores are normally distributed with a mean of 0 and a standard deviation of 1. Find the probability that a given score is less than 1.99 and draw a sketch of the region. In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.1. The phenotype of the heterozygous plant is_________.2. The genotype of the heterozygous plant is_________.3. The genotype of the plant with yellow pods is________.4. The genotypes of gametes produced by a heterozigous plant is______.5. The genotypes of gametes produced by a yellow plant is_______.A. Green podsB. 75% AA and 25% AaC. AAD. 100% AE. Yellow podsF. 50%G. 25%H. 100% aI. 50% A and 50% aJ. AaK. 0%L. 75%M. 75% A and 25% a An ideal gas is enclosed in a piston-cylinder apparatus with the piston being freely movable. Given that LaTeX: \DeltaE is positive and LaTeX: \DeltaH is negative following a process, ____ the system absorbs heat and expands during the process. the system absorbs heat and contracts during the process. the system loses heat and expands during the process. the system loses heat and contracts during the process. the system loses heat but neither expands nor contracts during the process. What weakness of Japan's geography did the allies exploit?A. Japan has no access to the sea, so Allies surrounded them easilyB. Japan relies on Imports, so Allles cut off supply linesC. Japan's borders are very large, so Allies were able to sneak in undetectedD. Japan has large oil fields, so Allies were able to take the oil to refuel while fighting