As above, let
$$f(x) = 3\cdot\frac{x^4+x^3+x^2+1}{x^2+x-2}.$$Give a polynomial $g(x)$ so that $f(x) + g(x)$ has a horizontal asymptote of $y=0$ as $x$ approaches positive infinity.

As Above, Let$$f(x) = 3\cdot\frac{x^4+x^3+x^2+1}{x^2+x-2}.$$Give A Polynomial $g(x)$ So That $f(x) +

Answers

Answer 1

Answer:

Hello,

Step-by-step explanation:

[tex]\dfrac{f(x)}{3} =\dfrac{x^4+x^3+x^2+1}{(x-1)(x+2)} \\\\=\dfrac{(x^2+3)(x-1)(x+2)-3x+7}{(x-1)(x+2)} \\=x^2+3-\dfrac{3x-7}{(x-1)(x+2)} \\\\=x^2+3-\dfrac{3}{x-1} +\dfrac{1}{(x-1)(x-2)} \\\\\dfrac{f(x)}{3}-\dfrac{3x^2+9}{3} =-\dfrac{3}{x-1} +\dfrac{1}{(x-1)(x-2)} \\\\\\ \lim_{x \to +\infty} (\dfrac{f(x)}{3}-\dfrac{3x^2+9}{3} )\\\\=0+0=0\\\\\\P(x)=-x^2-3[/tex]

Answer 2

Answer:

[tex]g(x)=-3x^2-9[/tex]

Explanation:

[tex]3\frac{x^4+x^3+x^2+1}{x^2+x-2}[/tex]

+[tex]\frac{p(x)(x^2+x-2)}{x^2+x-2}[/tex]

We need p(x) need to be a degree 2 polynomial so the numerator of the second fraction is degree 4. Our goal is to cancel the terms of the first fraction's numerator that are of degree 2 or higher.

So let p(x)=ax^2+bx+c.

[tex]3\frac{x^4+x^3+x^2+1}{x^2+x-2}[/tex]

+[tex]\frac{p(x)(x^2+x-2)}{x^2+x-2}[/tex]

Plug in our p:

[tex]3\frac{x^4+x^3+x^2+1}{x^2+x-2}[/tex]

+[tex]\frac{(ax^2+bx+c)(x^2+x-2)}{x^2+x-2}[/tex]

Take a break to multiply the factors of our second fraction's numerator.

Multiply:

[tex](ax^2+bx+c)(x^2+x-2)[/tex]

=[tex]ax^4+ax^3-2ax^2[/tex]

+[tex]bx^3+bx^2-2bx[/tex]

+[tex]cx^2+cx-2c[/tex]

=[tex]ax^4+(a+b)x^3+(-2a+b+c)x^2+(-2b+c)-2c[/tex]

Let's go back to the problem:

[tex]3\frac{x^4+x^3+x^2+1}{x^2+x-2}[/tex]

+[tex]\frac{ax^4+(a+b)x^3+(-2a+b+c)x^2+(-2b+c)x-2c}{x^2+x-2}[/tex]

Let's distribute that 3:

[tex]\frac{3x^4+3x^3+2x^2+3}{x^2+x-2}[/tex]

+[tex]\frac{ax^4+(a+b)x^3+(-2a+b+c)x^2+(-2b+c)x-2c}{x^2+x-2}[/tex

So this forces [tex]a=-3[/tex].

Next we have [tex]a+b=-3[/tex]. Based on previous statement this forces [tex]b=0[/tex].

Next we have [tex]-2a+b+c=-3[/tex]. With [tex]b=0[/tex] and [tex]a=-3[/tex], this gives [tex]6+0+c=-3[/tex].

So [tex]c=-9[tex].

Next we have the x term which we don't care about zeroing out, but we have [tex]-2b+c[/tex] which equals [tex]-2(0)+-9=-9[/tex].

Lastly, [tex]-2c=-2(-9)=18[/tex].

This makes [tex]p(x)=-3x^2-9[/tex].

This implies [tex]g(x)\frac{(-3x^2-9)(x^2+x-2)}{x^2+x-2}[/tex] or simplified [tex]g(x)=-3x^2-9[/tex]


Related Questions

In the expression 7³ - 4 · 3 +8, the first operation is? A. An Exponent B. Subtraction C. Multiplication D. Addition

Answers

Answer:

An exponent

Step-by-step explanation:

look at PEM/DA/S

Parenthesis

EXPONENTS

and then you can stop the first operation is 7^3

this is an exponent

(also brainliest if this helped please!)

The first operation according to the PEM/DA/S rule to evaluate the 7³ - 4 · 3 +8 expression is an exponent.

What is PEM/DA/S rule?

It is the order or sequence of evaluating a math expression. We can remember the order using PEM/DA/S: Parentheses, Exponents, Multiplication and Division (from left to right), Addition and Subtraction (from left to right).

In the given expression, using PEM/DA/S rule (Sometimes called BODMAS; the synonym of PEM/DA/S):

evaluate 7³ - 4 · 3 +8

The first operation is an exponent term, i.e.,

[tex]7^{3}[/tex]

Hence our first operation in the sequence of evaluating the given expression value is an exponent.

To learn more about PEM/DA/S, refer to the link:

https://brainly.com/question/36185

#SPJ2

Hello!! Please help me ASAP
Using special right triangles show and explain all work for each problem. Each solution and work should demonstrate your understanding of Special Right Triangles (30-60-90 and 45-45-90)
Find the missing side length and angle of this triangle. I've attached the triangle.

Answers

Answer:

Step-by-step explanation:

The basic 30-60-90 triangle ratio is:

Side opposite to 30° angle is : x

Side opposite to 60° angle is : x √3

Side opposite to 90° angle is : 2x

From the diagram we learn that

x√3 = 10

[tex]x = \frac{10}{\sqrt{3}}=\frac{10*\sqrt{3} }{\sqrt{3}*\sqrt{3}}\\\\x=\frac{10\sqrt{3}}{3}= 5.77\\[/tex]

∠T = 30°, Side opposite to ∠T is AC = 5.77

∠A = 90°, side opposite to ∠A is TC = 2x = 2*5.77 = 11.54

Match each statement with its corresponding value for the system below:

y = -2(3)x and y = 9x - 2

1. The number of points of intersection.
2. The x-coordinate of the solution.
3. The y-coordinate of the solution.

Answers

Answer:

1. 1 point

2. The x-coordinate of the solution = 2/17

3. The y-coordinate of the solution = -16/17

Step-by-step explanation:

Given that the equation is of the form;

y = -2³×x and y = 9·x - 2, we have;

y = -8·x and y = 9·x - 2

1. Given that the two lines are straight lines, the number of points of intersection is one.

2. The x-coordinate of the solution

To find a solution to the system of equations, we equate both expression of the functions and solve for the independent variable x as follows;

-8·x = 9·x - 2

-8·x - 9·x=  - 2

-17·x = -2

x = 2/17

The x-coordinate of the solution = 2/17

3. The y-coordinate of the solution

y = 9·x - 2 = 9×2/17 - 2 = -16/17

y = -16/17

The y-coordinate of the solution = -16/17.

What is the distance between the points (2, 10) and (-6,4) on the coordinate
plane?

Answers

Answer:

10

Step-by-step explanation:

the distance is given by

[tex] \sqrt{ {(2 - ( - 6))}^{2} + {(10 - 4)}^{2} } [/tex]

=

[tex] \sqrt{100} [/tex]

= 10

Rewrite using exponents

AxAxAxAxAxAxA



need answer quick!!! please

Answers

Answer:

A^7

Step-by-step explanation:

Microsoft Excel might be useful when establishing relationships involving vertex-edge graphs.
O True
False

Answers

Answer:

True

Step-by-step explanation:

Microsoft Excel is a great tool and has saved me on countless occasions in graphs and tables. I agree with the earlier answer by Hedland.

Find the third term of the geometric sequence when a^1=1/4 and r=−2

Answers

Answer:

The answer is 1

Step-by-step explanation:

Since the sequence is a geometric sequence

For an nth term in a geometric sequence

[tex]A(n) = a ({r})^{n - 1} [/tex]

where n is the number of terms

a is the first term

r is the common ratio

From the question

a = 1/4

r = - 2

Since we are finding the third term

n = 3

So the third term of the sequence is

[tex]A(3) = \frac{1}{4} ({ - 2})^{3 - 1} [/tex]

[tex]A(3) = \frac{1}{4}( { - 2})^{2} [/tex]

[tex]A(3) = \frac{1}{4} \times 4[/tex]

We have the final answer as

A(3) = 1

Hope this helps you

f(x)=-5x-4 and g(x)= -3x-2, find (f-g)(x)

Answers

Answer:

Step-by-step explanation:

(-5x-4)-(-3x-2)

-5x-4+3x+2

-2x-2

-2(x+1)

What is the solution to

Ax+ bx + C=0

Answers

Answer:

x = -C / (A + b)

Step-by-step explanation:

Without given values for the constants A, b, and C (Assuming they are constants), the best we can do is to isolate the variable x.  Let's proceed to solve for x.

Ax + bx + C = 0

x (A + b) + C = 0

x (A + b) = -C

x = -C / (A + b)

So now, when you get the values of the constants A, b, and C, you can plug those in to solve for variable x.

Cheers.

plot -½ on the number line​

Answers

Answer:

this would be towards the front and the very end

write 1,245 in word form

Answers

Answer:

One thousand two hundred and forty five.

Hope this helps! (づ ̄3 ̄)づ╭❤~

Step-by-step explanation:

A number is more than half of another number by 4. The difference of these two numbers is 2. Find these numbers.​

Answers

Answer:

10,12

Step-by-step explanation:

let the two numbers be x and y

difference between x and y is 2

but y is ½x + 4

x -(½x+4) = 2

x - ½x - 4 = 2

½x = 6

x = 12

y = ½x + 4

y = 10

the 15 chihuahua puppies ate 63 cups of food last week if each puppy ate the same amount of food how many cups of puppy food did each puppy eat

Answers

Answer: 4.2 cups

Step-by-step explanation: 63 divided by 15=4.2

PLEASE HELP
Type the correct answer in each box. Use numerals instead of words. If necessary, use / for the fraction bar(s).
Complete the inverse function for the function given below.

Answers

Answer:

[tex]f^{-1}[/tex](x) = 0.5x + 2

Step-by-step explanation:

let y = f(x) and rearrange making x the subject , that is

y = 2x - 4 ( add 4 to both sides )

y + 4 = 2x ( divide both sides by 2 )

[tex]\frac{y+4}{2}[/tex] = x

Change y back into terms of x with x = [tex]f^{-1}[/tex] (x)

[tex]f^{-1}[/tex] (x) = [tex]\frac{x+4}{2}[/tex] = 0.5x + 2

Answer: F -1(x)  = 0.5 x + 2

Step-by-step explanation:

Just took the test on edmentum and got a 100

What should I write?​

Answers

Step-by-step explanation:

Let's say we have (m*x+d)², with m and d representing constant values (a number). If we expand, we can see that

(m*x+d)² = (m*x+d) * (m*x+d) = m²*x²+2*m*x*d + d². Matching that up with

ax²+bx+c, the value multiplied by x² in our factored perfect square is m² (so m²=a), the value multiplied by x is 2md ( so 2md = b), and the constant is d².

Going back to the problem, we want to see how the values of a and c correspond with a perfect square trinomial. In our perfect square of (m*x+d)², our resulting trinomial has m² = a and d² = c. This points to the fact that a must be a square of something (for example, if a = 1, √1=1, so this works) as well as c if they are part of a perfect square trinomial. If a and c are both squares of other numbers, then it is possible that ax²+bx+c is a perfect square trinomial. If they are not, then it is not possible

Evaluate the following expression for x = 1 and y = -3.
3yºx+x-y

Answers

Answer:

8

Step-by-step explanation:

yº  (in words, 'y to the power zero') is simply 1.  We then have

3yºx+x-y  =  3(1) + 2x - y  =  3 + 2x - y.

Substituting 1 for x and -3 for y, we get the expression value:

3 + 2 - (-3)  =  8

PLEASE HELP! WHOEVER ANSWERS BEST WITH EXPLANATION BECOMES BRAINLIEST! Maria is conducting a survey to determine the ages of 100 dogs in an animal shelter. Which of the following questions is an appropriate statistical question for this survey? What is the number of dogs in the shelter that are more than 5 years old? What is the average number of years a dog stays at the shelter? How old is the youngest dog in the animal shelter? How old is each dog in the animal shelter?

Answers

Answer:

The answer is either A or B. Answer D is not appropriate for a survey of 100 dogs. Answer C, is also not correct, because it doesn't exactly matter out of 100 dogs. Answer A, is more accurate, then Answer B, because it is more of a statistical question, as in surveys, we want statistics. Thus, I must go with A) - What is the number of dogs in the shelter that are more than 5 years old?

Step-by-step explanation:

Answer:

the average

Step-by-step explanation:

option1: will help you get a population of those above five only therefore frequency for a large group of above five years which you can't analyse

2: you are able to see e.g average is 25yrs so your classes can start from e.g 0 to at most 26yrs therefore clearly defined classes

3 and 4: help you either get upper and lower limits but the other respective limits are infinite

1) Which is a prime number?
19
15
18
22


Answers

Answer: 19

Definition:

Prime: Prime numbers are numbers that can only be multiplied ONE time.

Example: 19×1=19

Composite: Composite numbers are numbers that can be multiplied MORE THAN ONE time.

Number 15: 15×1=15, 15×2=30, 15×3=45

Number 18: 18×1=18, 18×2=36, 18×3=54

Number 22: 22×1=22, 22×2=44, 22×3=66

Answer: The answer is 19.

Step-by-step explanation:

If 8(x) = -2 and g(x) = 2x2 + x = 3, find ( +g)(x).

A. 2x2 + 2x-5
B. x - 6
C. 2x - 3+1
D. 2x2 + x +1

Answers

[tex](f+g)(f)=f(x)+g(x)\\\\\\f(x)=\dfrac{x}{2}-2\\g(x)=2x^2+x-3\\\\(f+g)(x)=\dfrac{x}{2}-2+2x^2+x-3\\(f+g)(x)=2x^2+\dfrac{x}{2}+\dfrac{2x}{2}-5\\(f+g)(x)=2x^2+\dfrac{3x}{2}-5\\(f+g)(x)=2x^2+\dfrac{3}{2}x-5[/tex]

What is the expression for “the difference between four times a number and three times that number”???

Answers

Answer:

B

Step-by-step explanation:

The correct equation will be 4N-3N

The graph of
is positive over the interval and negative over the interval . What happens on the graph when ​? Explain.

Answers

Answer:

Positive and negative intervals on a graph

Step-by-step explanation:

The positive regions of a function are those intervals where the function is above the x-axis. It is where the y-values are positive (not zero). The negative regions of a function are those intervals where the function is below the x-axis. It is where the y-values are negative (not zero). hope this helps you :)

Positive & negative intervals on a graph

The Vertices of a quadrilateral are A(4,-3),B(7,10),C(-8,2)and D(-1,-5).Find the length of each diagonal.Show me with the steps Please!​

Answers

Answer:

13 and 17 units

Step-by-step explanation:

explaination is in pic.

The length of the diagonals of the quadrilateral AC and BD are 13 units and 17 units respectively, as per length between two points.

What is the length between two points in a plane?

The length between two given points (x₁, y₁) and (x₂, y₂) will be:

√[(x₂ - x₁)² + (y₂ - y₁)²] units

Given, the vertices of a quadrilateral are A(4,-3),B(7,10),C(-8,2)and D(-1,-5).

Therefore, the diagonals of the quadrilateral will be AC and BD.

The coordinates of the diagonal AC are (4, - 3) and (- 8, 2).

Now, the length of the diagonal AC will be:

= √[(-8 - 4)² + (2 - (- 3))²] units

= √[(- 12)² + (5)²] units

= √[144 + 25] units

= √(169) units

= 13 units                                  (length can't be negative)

Similarly, the coordinates of the diagonal BD are (7, 10) and (- 1, - 5).

Now, the length of the diagonal BD will be:

= √[(-1 - 7)² + (- 5 - 10)²] units

= √[(- 8)² + (- 15)²] units

= √[64 + 225] units

= √(289) units

= 17 units                                  (length can't be negative)

Learn more about the length between two points on a plane here: https://brainly.com/question/14898312

#SPJ2

Need help pls will give you a good rating.

Answers

Answer:

x^ ( 6/35)

Step-by-step explanation:

x ^ 2/5  ^ 3/7

We know that a^ b^ c = a^ ( b*c)

x ^ ( 2/5 * 3/7)

x^ ( 6/35)

Solve for b.
-32 + 10b = -22

Answers

Answer: b = 1

Step-by-step explanation:

= -32 + 10b = -22

-32 + 10 = -22

b = 1

Check: -32 + 10(1) = -22

= -22

Answer:

b=1

Step-by-step explanation:

Hello,

We would like to solve for b in the equation -32+10b=-22.

When we want to solve for a variable, we want to isolate it on one side (have it on one side by itself. No other numbers.)  

So to start, add 32 to both sides to remove it from the left side (-32+32=0).

-32+10b=-22

+32         +32

______________

10b=10

Now, there isn't anything with 10b, but we want the value of b by itself (1b), as 10b is 10 times the value of what b is.

So divide both sides by 10

b=1

Hope this helps!

Question 10(Multiple Choice Worth 1 points) (06.01 LC) Choose the polynomial that is written in standard form.
2x2 + 3x4 + 10x6
4x4 + 6x3 + 10x4
−3x8 + 9x2 + 10x
−7x6 + x3 + 10x8

Answers

Answer:

  −3x^8 + 9x^2 + 10x

Step-by-step explanation:

A polynomial is in standard form when the exponents of the variable decrease left to right. The only given expression in that form is ...

  −3x^8 + 9x^2 + 10x

2. Peter, Jeff, and John, each perform subtraction incorrectly as follows:
How would you explain their mistake to each of them?
Peter:
Jeff:
John:

Answers

Answer:

peter: subtraction mistake at unit place . wrote 6 in place of 9

Jeff: subtraction mistake at tens place: wrote 4 while the correct digit is 3

peter: He has written 3 at unit place while correct digit is 2

John: he has carried 1 twice from 5 at hundred place and then subtracted 2 from it which gives value 1 at hundred place.

Step-by-step explanation:

we have to subtract 503 from 269

      9

  4 10 13

    503

   -269

    ____

     234

Solution

since 3 is less than 9 , we take a carry from 0 but 0 cannot be carries so we take 1 carry from 5\

thus

5 becomes 4, 0 becomes 10,

now 10 can be give  1 carry to 3 at unit place, so 3 becomes 13

now 9 is subtracted from 13

13-4 = 9

this is the mistake of Peter

he has written 6 at unit place which should be

peter: subtraction mistake at unit place . wrote 6 in place of 9

____________________________________________________

since , 1 is carried from 10 at tens place, 9 is left at tens place

so we know subtract 6 from 9 at tens place

9-6 = 3

Here mistake is done by Jeff

Jeff: subtraction mistake at tens place: wrote 4 while the correct digit is 3

________________________________________________

at hundred place,

one is taken from 5 , hence 4 is left at hundred place

we have to subtract 2 from 4

4-2 = 2

hence,

Here, mistake done by both both Peter and jeff

peter: He has written 3 at unit place while correct digit is 2

John: he has carried 1 twice from 5 at hundred place and then subtracted 2 from it which gives value 1 at hundred place.

Evaluate-2 xy, if x= - 4 and y= 1.

Answers

Answer:

8

Step-by-step explanation:

-2 xy

Let x = -4 and y = 1

-2 (-4)*(1)

8(1)

8

What is the width of the rectangle shown below?
4x + 3
A = 8x2 – 10x – 12

Answers

Answer:

2x-4

Step-by-step explanation:

Area of a rectangle = Length * Width

Given parameters

Area A = 8x2 – 10x – 12

Length of the rectangle = 4x+3

Required

Width of the rectangle.

Substituting the given parameters into the formula

8x2 – 10x – 12  = (4x+3)*width

width = 8x2 – 10x – 12 /4x+3

S

Factorizing the numerator

8x² – 10x – 12

= 2(4x²-5x-6)

= 2(4x²-8x+3x-6)

= 2(4x(x-2)+3(x-2))

= 2(4x+3)(x-2)

Width = 2(4x+3)(x-2)/4x+3

Width = 2(x-2)

Width = 2x-4

Hence the width of the rectangle is 2x-4

Please answer this question now

Answers

Step-by-step explanation:

Hi, there!!!

Here, the question is about the volume of cone,

given that,

diameter = 12m

radius of a circle= 12m/2= 6m

height (h)=9 m

now, we have,

volume of a cone= 1/3×pi× r^2×h

or, v= 1/3×3.14×(6)^2×9

After simplifying it we get,

v= 339.12 m^3

Hope it helps....

A bag of chocolates weighs 70 grams. If the weight of the bag increases by 25% find the new weight of the bag.

Answers

70 x 1.25 = 87.5
Therefore the new weight of the bag is 87.5g.
1.25 (x) 70 = 87.5 , the bag is weighing at 87.5g
Other Questions
You are in charge of paying claims submitted by providers. You notice a certain diagnostic provider ("Doe Diagnostics") requested a substantial payment for a large number of members. Many of these claims are for a certain procedure. You review the same type of procedure for other diagnostic providers and realize Doe Diagnostics' claims far exceed any other provider you reviewed. What should you do? Morganton Company makes one product and it provided the following information to help prepare the master budget:The budgeted selling price per unit is $70. Budgeted unit sales for June, July, August, and September are 8,500, 16,000, 18,000, and 19,000 units What is the accounts receivable balance at the end of July? Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number the water is.......... Assume that a randomly selected subject is given a bone density test. Those test scores are normally distributed with a mean of 0 and a standard deviation of 1. Find the probability that a given score is less than 1.99 and draw a sketch of the region. In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.1. The phenotype of the heterozygous plant is_________.2. The genotype of the heterozygous plant is_________.3. The genotype of the plant with yellow pods is________.4. The genotypes of gametes produced by a heterozigous plant is______.5. The genotypes of gametes produced by a yellow plant is_______.A. Green podsB. 75% AA and 25% AaC. AAD. 100% AE. Yellow podsF. 50%G. 25%H. 100% aI. 50% A and 50% aJ. AaK. 0%L. 75%M. 75% A and 25% a An ideal gas is enclosed in a piston-cylinder apparatus with the piston being freely movable. Given that LaTeX: \DeltaE is positive and LaTeX: \DeltaH is negative following a process, ____ the system absorbs heat and expands during the process. the system absorbs heat and contracts during the process. the system loses heat and expands during the process. the system loses heat and contracts during the process. the system loses heat but neither expands nor contracts during the process. What weakness of Japan's geography did the allies exploit?A. Japan has no access to the sea, so Allies surrounded them easilyB. Japan relies on Imports, so Allles cut off supply linesC. Japan's borders are very large, so Allies were able to sneak in undetectedD. Japan has large oil fields, so Allies were able to take the oil to refuel while fighting A single-slit diffraction pattern is formed on a distant screen. Assuming the angles involved are small, by what factor will the width of the central bright spot on the screen change if the slit width is doubled?a. It will become four times as large.b. It will double.c. It will be cut in half.d. It will become eight times as large.e. It will be cut to one-quarter its original size. Show Work! A warehouse worker shipped 289 boxes of notebooks. Each box contained 36 notebooks. What was the total number of notebooks shipped?(A) 2, 601(B) 9, 404(C) 10, 404(D) 10, 413 Adnde ______ ustedes? Question 18 options: a) voy b) va c) van d) vamos 7. Characteristics of a newsworthy incident include: timeliness, proximity, prominence, uniqueness, human interest, and: A. Visual interest B. Conflict C. Media agenda D. An easily understood situation Write the equation for each question: 9. the sum of 5 and four times a number is 3210. four less than the square of a number is 1211. The product of 3 and four more than a number is 20Marking Brainliest -3(-5x-2u+1) use the distributive property to remove the parentheses